Rattus_norvegicus Locus RGD1565297_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RGD1565297_predicted
Rattus_norvegicus
RGD1565297_predicted
11
SNORA77
8376..8500
10244
GCGTGGCGAGGTACATTTTGGAGCTCCAGTTTAAAGATCTCTGAGGTGAACAAGTCATC
CCTTATGTAGCTGTAGAGCCCAGGCTGAGTTCCAGGCCCTGCAGCTGGCCCAGGGTCCTC
TTTCTCATCTTGACATACTGAGGCTGCAGAGCTGCCCACTGCACTGACATCCTGGCCGCA
GTCCTCCATGTGCTCCGGAACCTATGTGGGAATAAACCGGCTAGGCTGAAGGCTCCAACT
AGTGTGACTACTACCTGTTTGGCTTGCTCCCCAAACAGCTGACAAATCTCCATTAGTGCA
CACTACAAGAGGCCCTGGCCAAACCCACTCTTTTACTCCAGACCCAAGTCTCCCCCATCC
TATCTTGATCCGACAGTAATGACTGCAGCCCGAACCACCTCCGACCACCCGGCCCCTATC
TCCTGCATGTCTCCCTTTGCTTTACTTCCGTGTCCAGCTTCTCACTCATCGCCTGGCTCG
TCTGTTGCCTGGACCAGGGTGCTCACGAGGACCACCAGCTAGGCCTCTCAAACAAGTGCT
CAGATACGAGGTGCGCTGCGGTGAAGGTAGACCGCAGCTCCACACAGGGACTCAAAACTC
GGGTGCTCAGAGCTGGGACTGAGCTCTACAGATGCACCGCCCGCTCCCCAAGAGCCGGTG
AGGGGGACACGCTTCGCCTGCCTTTAGTCGGCCAGCGAACCCCGGCCGCGTTTCTTTTCT
CTGAGGGCTTGGCTTCCGATGACGTCACCGCCACGCGCCGAGTCCAGACTGATCCTTCCA
CTAGCCGCTCACGCTAGCGTCAGAGGCACTCACAGGTTGCAGACGGAAGTGTGCGCGTGG
GTCGACGGGAGAGCGCGCTCCTCCGGCTGAGGCGCGGCCGGGCATGCGCCGCGGGCGTTT
TGGCGGGAAGCGCGGGGCGGGCCGGACAATGAATGTCCGCCGTCAGAGCCAATAAAGCTG
CACTGGTTTTGAATCACTGCGCGTTTCCCGCCGCTGGGGTCAGGGGTCAGGGTTCGGGTC
GGGGGGCGGAGGGAAGAGCGGACGGGCGGGAGACGCCGGCGCCAGACGCGGAGGAAAGGA
GCTGCGACTAGCCGCCCAGAGGCCGCCGAGCCAGCGACGCCTGAGCTAATCGAGCCGCCG
TCGCCGCGCCCCCATGGCGGCCGCCAAGGTACGGTGAGGCCCGGGTGGGGCCGGGCAGGC
CGAGAGGCAAGGGCCGCTATGGGCGGCCACGTGGGCGGCCCGCGCCTCGGCCTCCAACCC
TCGCTGGCTTGCGTATTCCGGGCCTCTCCAGGCGCCTGGGCCTGGGATGCTCGAGGTCTT
TGGGGTCGGGGAGTAAGAGCTGCTGGCCAAGACTCCGGTCTCGGGGGCTGCAGGGCGCGT
GACCTTGTGGTCTGCGGAAGAACAGCCATGGCCAAACTGGGCTCTCGGCTTCACCTGGGG
ACCTGGAGGCGACCGATCTCCTCTGTCGTGGCCCACTTGTGATCTTTCCATTAGCGTCGG
CCATCCTTCTTCCAATTGCCCCCAGATCCCTTCATTCATTAGGTCATTCCGCCTTCGGTG
GGGGAAGCTCGCGATCTAGCACAGAATACAGATATTAGACGCGAGGACTCTGGGCGGGGG
CGGCTTTGTTGGTGGCTCGTGTGTCGGCCGCAGCTTAGCCGCAGTGCTGAGAAACCCAAC
GAAAGGTTTCTATTCCTTTATCCTGTTGAGTTAGGTAGTGAGTCTGGGATTTTTCTGTAT
TATCAAAGCACGTGATCTTGTCCGATTTAAACATGCATGCCCTTGTGATCCTCCACGTTG
GGTCAGAATCTTAGAGCTTATTTGTCGTGCTTTTCTTAGCTTCTTTCAGCTTAAATTTTC
CAACTTGGGTAAAATTGCTGGAGGGATTGTAAATTCATGTAAATGCTGGTTCTCCCATAG
CAGTTTATCTTCCTAGTAAACTAACAAGTGCTTGGGTATTCCTCATTAAAAACTGTAATG
ATTGCTCTTCCTTTTGAGTCTATCATGCTCTTTTTATGGCGGGTGTAATTTTATTTTACA
GAAGAGGGAGTTTCTCCCAAGCTACTTTGCCAAGGACTTGGGTGTGTGTAACCGATTGAT
GTTTGAGTGTGTAGGAGGAGTGTCAAAATCCATTGTCTTGTTTCATGCTATGCTGTGGTT
TTTGTGATGCTGGTTGTAAATACAGTCAGATGATGTGAAAGTTAAGACCGAAGGCTTAAT
TTCCAATTTGGGGAAGGCCTGTCTTCATTTTCCAGGCGCCATGTGTGATTGATGATGCCC
ACTGTGGACCAAATCCACCAGCCAGCAGCATCACTTCTTACTCTCTCTACACAGGACAGT
CACGAGGACCACGATACTTCCACAGAGAATGCAGAGGAGTCCAACCACGACCCCCAGTTC
GAGCCAATAGTTTCTCTTCCTGAGCAAGAAATTAAAACACTGGAGGAAGATGAAGAGGAA
CTTTTTAAGATGTAAGCCTGCTGAGGTGTCCTGGAAGTATCTTTAGGTGGACTGATGAAA
CAGGAAAGAGAGAGTGGACAGGAAGCTGGTCTCTGCAGGTCATGTCTTTAAAAACTTGCA
ATGCCCAACAACCATAGTTGGACCATTTATGTTTTCCTCTTCAATTCCTAGAGGAGCCAG
CCAAGCTAGGAGTTCTGTCCCTTGTACTGTTTCTCTTTCAGGTGTAAGCCTTAGTGATAC
TTTCTGGCATAGTCTCTTTGTGATTTCTGTGGATTTCTGGCTTGGACTGAGCTTGATAAC
GGCTTTTTTAGGAAAGTGCGTGAAGTTGTATGGTCCTAGCCTTACATTGAAAATTGAACC
ATTTGTCTGCCAAAAACTTTGCCTGGTACCCTGCTGCCTTGTGACTAGTCTGATGAAGGG
TATCCCCATGACTGTTCTGTCACCTGAGTCTCTGTAGCAGAATGTGGTGGCTCACGCCTT
TAATCTCTGCGCTTGGGAGGCAACAGTAGGCATTTTTCCGTGGATAGCTGGTCTATAGAA
ACAGGTTCCAGGACTCCACAATGAGGCCTTTTCTGCAGGGTGGGGTCCCTTTGTTGAGCA
GAGAGTCTTCCACGCTTTCCTTTTTTTCTGCTTTGTTTCCTGTTGCCTTAACTGTGTATC
CTTAAAGACTGAGGCTTGTTTAGCTCTTGTTATTATTTTTTTTTTTTTTTTGGTTCTTTT
TTTTGGAGCTGGGGACCGAACCCAGGGCCTTGCACTTCCTAGGCAAGCGCTCTACCACTG
AGCTAAATCCCCAACCCCTCTTGTTAATTTTTATGTGTGTGTTAGTGTTTTGCCTACATT
GATGTCTGTCTCTACACAATATGCTAAAGGAGGCCAGAAGAAAGTAGTGGATCCCTTGAG
ACTAATGTAACACAGTTGTGAGTTGCCATTTGGACCTCTGGAAGAACAGCCAGTGCTCTT
AAGTGCAGAGCTGTCTCTCCAGCCTCCAGCTCATGGTTTTGCAGGTTAGAAAGTATGAGG
TCTGAGAGAGTAGTGCTTGCTGTGCTGTAGACCTCCGTCTCATCTTAATGTGGCAGTGCA
TCATGGTACATGTAGTAAAATCAAGAGAATTTGCTAATGTCAAATTTTCAGGTATGCCCA
AGATGTTAGATAAAGGTTCACGCTCTGAAGTGAGGGAGGAAGGGAGGCTTGCCCAAGGAG
AGCCATAAATACACCTTTGTACTACCTAGAAGGTGATGGTCCACAGCTCTGTTTCACAGA
AATCTCCCTGAGTCATGTGGTACTTGATTTTGAACACTTGATGCTGAAAGTACACCAGTG
TCCTCGGTATAAGACCGCATCTTGTACCTTTATAAGGGTCTTTGAGCTTTTGCTTAAGGA
GTTAAGTGAAGACACAGTCTCCCTGTGCAAGACTGAATTTGGTGGAGAGCAGAGGCTTTA
TAAGAGCAAATGCAGGCTACAAAGGAAGAAGGGTGCTGGCTTGGCCCAAGGGACAGGTGT
GCTGGACTACTTGCTGGACTGGATACCTGAACCCTGGAGGCTATGAAAGGTTCCTCTGAC
AGGAAATTGTTGCTGAGCATGTGGAAGATAACATCCCTAAGGCTGATATGGGTTCAGGGC
ACTCGTGTGCCCTTTGCAGCTTCTTTACCTACTGTGGGCCATGAGAATCCTTAGATGTGT
CTCCAGGGAAGGTCCTTTGCTATGAAGTAAAAGCAACACAATCCCTGGGTTGTATTTTGC
CTAGGAATTCTCGGTGCCCAAAGGCCTTAGAAAAAGGTTTTTGGGGAGGGCATGGTGTTC
AACAGTACCCATTATATTGAGTGTTGAAAGAACAGGTGTTCCTTTATGGTAATTGGTCCA
GGTGTGAGTTCCCTCTCTGTCTAGATGTTTCCTTATTGGCTCTTCTTACAGGCGTGCAAA
GCTGTTCCGGTTTGCTTCAGAGAATGACCTCCCAGAATGGAAGGAGCGAGGCACTGGAGA
CGTCAAGCTTCTGAAGCATAAGGAGAAAGGGACCATCCGCCTTCTCATGAGGAGGGACAA
AACCTTGAAGATATGCGCCAACCACTATAGTAGGTCTTTATATCCTAGAGTTTTTAGGAG
CTGGTTTCCAGGGGAGTGGGGGTATATTTATGATACTTGTTGAACTTAAAACAAGTCTCT
GAATTGTGACAGTGAAACTTACAGAATTCAGGCTGTGGGCAAGATAGGTCCAGGCTAGAT
TTGGGTGGTGATATATGCACTTTCTGTTATGTTCTACTACCTCTAAGCTGTTGCCTGGGG
TGATAACAGGAAGGGAACAGGGCTGGCAAGACAGTAACTGGGGAGTGCTGTTGGCCAGGT
GTGGTCTTGTGCGCTTAGAAAGAGGTCTCAACAAGCTACCCCTCCCTGTTTGTCTCAGGC
TTTTTAGATCCATCTTGGGCTGTGTAAAGCACATACATTTTTTACACCCTCCTTTGCCTT
GAAATAATGCACTCTAGCTGGGCAGGGTTGACATCCACTCTAACCTGACCCACCTCGGAC
CCCTTACTGATAGCAGATCCCATCTTCACTCTGCCCCAGCTGTAGGCTGATGAGCTCTCT
ATAACCAATGAGGTGAGGGAGAATAGCCTTTACAGTCATCGAGATAGGAGATCCTTTAGT
GGTCATGACAAGGCCAATGTCCAGACTGCAGCCAGGCCTCTGGGCACAGCAATCAGCATC
TGAATACACAGTGCACAAAATCATCCTCCAACAGGGCTGCTCTTAATCCTGGTAGATTCT
CTAATGCAAAAATCTACATTTTCTAAACTTGAAAAAAATCTTTTTTTTGCTTTTGGTGGG
GATGGGGTCCAATGTGTAGACCAAAGAACAAATTTGTGGAATCTGTTCTTTCCTTAACAC
TTTCACATGAATCCTGGAATCAAACTTGGATCACTGAACTTGCGTAGCTGGTGATTTTAT
CTACTGGACCCATTTTTTTTTTCCTTCATGTGTGCATGTGCCATGGCCATGGCAGATGAA
GAGCAACTTGTAGGAGCCGGTTGGCTCAGCTTGTAATTCTGGGGATGGGACTGATCGGGC
CTGTAAAGTGCCTTTACAGTTTACAGACTGTCTTTCTGCAGGCTACACTTTTTAACCCAT
TGGGATCTTTTGTCTTGGGTATATAGGCAGACTGTAGATAAGATCAGGGCTTCATAGGTG
GTTTGCTGAGGCGAGGGCATGAGAAAGACCTTTGCCCTCCCTATCTTACAGGTGCCTCAG
TCTCCCCTCGGTCCTAATTTGGAGCTTTCCCTGAGGTGAGGGGGAATCAAGCTGCTCCCA
ACCCTGACTAGTCTCTGTGATCATCTCGACTTGGGCACCTGGGTGGGGCGCCTCCTCTCA
CCCAGGTTGTGGGTCAAGGTTGGGCATTGATCGGTCACTATTCTGTGACTGACGAGACAC
CATGACCATAGCAGCTCTCACAAGGCATTTAGTTGGTGGCTTGCTTAAAGTTTTAGAGGG
TTGGTCCATGAGCATCATGGCAGGAAGCAGACAGGCATGGCCCTGGAGCAGTAGCTAAGT
GAGAGCTTTACATCCTGATCTTAGGCACCAGTTGGAAACAGAGATGGCCTGCTGGCATCA
GCCTTTGAAACAGCCCACCCCCAGGGATACACTTCTTTCAGCAAAGCCACACCTGCCCCA
ACAAAGCCACTCCTCCTAATCCTTTCAAACTGTTCTTTAACTGAGAACCAAGCATGCAGA
TCTGAGCCTCTGAGGGGCATTCACAGGTTTGGGGAAAGTGAGAATGTGGAGTATGCAGTT
TCTAAGACCACTGTTGGCCTGGTGTGGCTCAGATCTCTTGAGTTCCAGCTTTAGCTGTCA
TGTGTGGTCAGAGGGCCTCCCTGAAATCCTGGAAATACTGCCAAGGGTACAGGGACTGTG
ACTGGGCATACACATCAGTGAGTGATATTCTAGATGAGCAGACTTTTCAGTGGAGGACAG
TTCTGTCAATGCTTAGCTCTCCCTTGGTTCTATATAGGACCTGAAGAATTCAGAATAAAT
ATGTCTGAGTTAGGACTTATTTTCCGTGACATACCTAGTGTTTGTCGTGGGATTCTGGTA
TCCATTGTTTGTGTTCTTCCTGGACTATATAGCAACTGTGATGGTCCTGCTTTCAGGCTC
CTTTGCCTCTGGGTTCCCACCTTTCAATCAGCCAGGTTCGTGTTGGTGTGAGCATGTGTT
TATAGCTATATGTTGGCCACCATTAGGAAGGTTTGAGCCAGAGTAGCTCCCCCTAAAACA
GCAGGAGGCAGAGCCTGTCCTTCAGGATCTTGAGCTGTTTCCACATGAGGACTGCTCTAG
TTTTACGCAGATGTGGTTTTCATCAGGGTGTAGTTGTGTAGACCTATATTTTAAAATCCC
TTCCCAGGAGTGGAACATCTACCCCTCTTTTAGGGTTCTAATGACAGATTAAGGCGTGAT
GCCACCAAACCATACTCTGGGCACTGATGAGTTTATTGGGCTTTCTTAAAGAACAAAGAC
TATTCATCAGGCTGGATCTGGAAAGCTAGCAGGGATGATAGCTTTTCCACAGGTAAAGCC
CTCTCCCTTTGTCCTTCCCAGCCTAATACTCTAGCCCTCCTGGAAGAGAGCACATGCAAT
TAGGGCAGAATTGCACATAAGCTGTGATAGGAGGTAGCTGGATACCTAGGTAGGGTCTCT
GGCCTTAAGGGGATATAAATAGTCAAGCCCAGCTGGGATAATTTGCAAGCGGGCATAGTT
GAACACTCCAGTATGGTGGTTGCTTGGCTTCAAGGGTAATCAAGTACAACAGCCTGGCTC
TCACATTCCAGACTCCATGTTGACTGAAATGGGTACCCTCAATTGGTGAGCAGGTTGCTC
TGGGTGGTTTGGCCACTGTCCTCACAGGCTTCTCTCCCTTAGTCACACCAATGATGGAGC
TGAAGCCGAATGCTGGCAGTGACCGCGCCTGGGTCTGGAATACCCACGCCGACTTTGCTG
ACGAGTGTCCCAAGCCTGAGCTGCTTGCCATCCGCTTCCTAAATGCTGAGAGTAAGCAGA
ACTTGCCCAACTGTGGGTCACCTGCTGGGCACCTGATTTAGCCCAGAGCATACAGAGCCT
CTGACATTCTAGGGATCTGTATAAACAGTTGTTGCATCCAGTTGACTCCCATCAGGTGTG
TGGAACCAGAGACACACCCTAGAGTTTCCTCCTGCTGCTGCTTCTGCTTGGTTTCTGGTA
CCTCAAGACTGGGACACTGGTGTCCCCTACGGACGCTTAGGCACCTGTACCAGCAAAGAC
TGCAGAGATCTGCAAGCCCTGGCTGATCTCTCTTCCATGGGGGAATCTTTCTAGTCTGAA
TTGCCACAAAGCTGTGCCCTGGGGATCCTGGAGAGTCAGCAGGTACCATGGCCAATGCCC
TAGTGGCTGGTGCTCTTGTGAAAGTGAGCCTTGCCCTTGGTCTGGGAGTATAGTGTATCT
GGTAGCCCTTCCAACATGAGTAGAGTCTATAGTGAGAAGAGCTTTGGCCCTTGGTCATCT
GGTTGTGATAGACAGCTAGCTAAGCAGAATCAGTGACCCCTGGAGGGACTCAATGCAGGT
ATCAAATAGTCAGAAATTGCCCTTGGGGCTGGGCGTGGTAACGCATGCCTTTAATCCCAG
CACTTAGGAGGCAGAGGCAGGTCGATCTCTTGAGTTTGAGGTCAGGGCAACCAGGGATAT
GTAGCAGGATCCCATCTTTAACCATGAGTTGGCGCTTTAGAACCTTAGAATATTGCCAGT
CTACTTTGAGAACTTTCAAACACAGTCCCTTCTCTTTTTACAGACGCACAAAAGTTCAAA
ACAAAGTTCGAAGAATGCAGGAAAGAAATTGAAGAGAGAGAAAAGAAAGGTGACATGGTG
TCCTGGGTGCTGCGGGTGGGTGGGATGCAGTGCTTTGCAGATTCACTCTGCACCTGGCTG
TAGCTCCAGTCTGGTGCTTTTTCCATCTGCCAGAGAAACAATCCGGGTGCTGTGGCTGCC
TCTGCCTGTCAGGGGCAATACAGCGGCCTGGGGACACAGCCCGATGCCTTGCAGGCTTTG
GCCTCCTAGCATTTGTGGTCAGTTTCAGGTACAGAGCTGAGTCACAGCTCTTTGGAACCC
ACCAGGAGTAAAAGGGCTTTTAAGATATATTCCTCGTTTTCTCAACGAATTCTGTTTTCT
GTTCCTCTGGGGCAGACAGGCCTGGGTTAGTAAGTGACCACACATCACCAGCAGCTTGCT
GGGCTCTCTGAGGCCATCTGGGGAGAGTGGTAGGTGATGCTTGGGGGAAAGGTCGAGCCT
GCACTGGGTGAGTGCCAAGAGTAGTGCAGTCTCGTGGCCAGACTTCTCTGTTGTCTTACT
GTGATTGCCTGTTTTTGCAGGACCAGGCAAAAATGATAATGCTGAAAAGGTGGCTGAGAA
GCTGGAAGCCCTTTCAGTGAGGGAGGCCAGAGACGAGGCTGAAGAGAAGTCTGAGGAGAA
GCAATGAATCATTCTGTCTTTTTCCTTTCCTTTTCTTTTTAAAAATTTGCCCCACCCTTT
AAGGTTTGTTTTTATTCTGTTTTGTTTTTACAAGGGACTTTATAAAGAACTGAATTCCAA
CCTTCAGGTTGTTTTTTTTTTTTTTTTAACTTTTTTTTTTCCTCCAAGTTTTGACACCAT
TGAACATGACTTCAGAAATCCATTCCCCAGTCATGAAAATGTACTGTGCTAACTTTCTTT
TCCATAGTGGAAACACTTATTTATAGTCATCAAAAATAGTGAATAAAAAATGCCTTTGAA
AACCTGGACCAGCTGACAAGGCTATGTGGTGGGTGGGGAAGGTGTCTGTTTCTGGAGGTC
ACTGGGTGTGTGTGGCTGCTTCCTTGCTGCTGGAACTAGTGCTTTGTGCTGTTGTATGGG
GGGGGGGGGGCCTCTGGTTAATAGAGCAGCAATCAGCTCATTCTTGTACTGTGCCATAGT
GTGGCTATGTCTAGCCCTACAACTCTCCTGTTGGAAACGATTAGATGCTCCCAACACATC
TTCAAATAGCACTCTAGGAGTCTGGACCTTGAATGCTAAATTTAGCACTGTTAGGATTAG
GGACTACTTGGATAAAACCTGCCCCGTGGGGTTAGAGATGGCTCATCCGTTAGGAGTACT
TGCTGCTCTTGTAGAGCATTTGAATTCAGTTTTAAGTTCACAATGGACTGAAGCTCAAGG
GAATTAGACACTCTCTTCCTTGCTAGGCAAAACAAATGATTGATATATATATTTACATAT
ATATACAGGCAAACAAAACCTGGTCTGTTGTGTGCCTTTCACAGGCTGGGAGCCATGGTG
TGGCGTCTGATCACATTGCAAGATCTAGTCTCTTACTCTAGCAGATTCCAGTAGCTCTTG
CTAGGTGTGGTTTTGGGCCTGGATATTTGTTGATGTTTCTTACTAAACTGATCCTGTTAC
ATCTGACCTTGTCCTTTGTAGGGTGTGTACAAATGCCTGCCTGCCCGCCTTTCCCTCCTT
CATTTCCCTCCCTTATTTTTGTATGTTAGAGACTGGGTTTCTCTGTATATCATCCCTGGC
TGTACTTGAACTCCCTCTGTGGATCAGGCAGGCCTCAAACTCAAAAGATCTGCATGCTGG
ATTAAAGATGTGTGCCACTACAGCCCAGCTTAAAACTCTTAAAATTGTTTAACTAGTATT
CAAAGTTTTCATTGTGACATTTCCACATAGATGTATTGTATGTACTTTTACCATATTCAC
AGCTCTCCTCCTTGCCCACCCCTGCAGAAGTACCTTTTCATTCCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1167, 2334..2470, 4371..4528, 7362..7490, 8263..8328, 8840..9244
1153..1167, 2334..2470, 4371..4528, 7362..7490, 8263..8328, 8840..8943
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved