Rattus_norvegicus Locus Eif4a2
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Eif4a2
Rattus_norvegicus
Eif4a2
11
SNORA63, SNORA63, SNORA4
3594..3718, 4938..5066, 5256..5395
8600
TATTATGGGCAATACGAGCTGTATCGTCTCAATTTCAGTAAGGCAACATTAGACGATTA
AAATAGGTTTTTTTTTGTTTGTTTGTTTGTTTTACCAAAAGAGACAAACAGCTTTTGAAG
TGCTGGGGCTGAGCCTGCCAGGAGCACGCATTAACGTTTTTGTGTTACAAAGAATGACAG
GTCCTTTGCAAAAGTTGGTAGTGATTCTATCAATCATTTCTCACACCTGTTAGGTTGAAA
CTGTTAGCATTACTTTTTAAACCAGACCTGAAGACGACCGACCAGAAAGACATGAAATTC
GAATCACCACCCTAGGGACATCTGTTAATGATACTCCAAGTTGTGCTCCTCGTCTTAAAA
AAAATATAACAGCAAACTGGATTTCCTAGGATATGCTGGGTGGCCGACATTTTCCGTGGC
AGGGGTTTCACACGTTCCAGATCTGAACGGATATTAAATGGCTGGGCGAAATGCCAGGTG
GCCCTTTACTGTCACATTAAACAGCAGTGAGAACGGGCGGGGTAACCCGATTCCGTTCCG
GCGCGGAACGCGGCGGCCCGGCCCAGGGCCACGCTGACGCGCAGGTAGCCCGGAGCTGCG
TCCTGGAGACGCCGCCCGCCAGCGAACAGCGCCACCGGCTTCCGCCCTAGGCGCCCCCGG
CTCCGCCGGCCTCTGCGGCAGGGCCGCGGAAACCCCGTAGGAGCAGGGCGGCCGAGGAGC
GCGGCGCGCGGTCGCGCTGCTGCAATATTCTTCCGCCGAAATCAAAGAGTCCCAGGCCCC
CTCCTGATTCATGGATCTCCAGGAACGCTGTAATACCAAGTAATAGTGAAATGTGGATTT
TGTCATCGACTCCTTTAGGGCTTCACCTCCGGTAACAAACTCCAGGAGTACAATTTTGTG
GCTTCCGAAGAGGGAATAAGAAAATTCCTCCGCGAGAAACGGGTTCCGGCCGCGAGCCTA
TAAAAAACGGGCGGCGCCGTCCCGCTGTCTTTTCAGTCGGGCGCTGAGTGGGTTTTCGGA
TCATGTCTGGTGGCTCCGCGGATTACAACAGGTACGGCGCTCCTGGGGCGGCCGGTGGCC
TGTAGTGAAGGTCACTAGCACCCGCGGTTGAGGTGGGTGGCTAGCGGCCACACTGCAGGT
ATGCGGGCTTTTTCTTAGGGCACACACAGTCTCCTTGTGTCCTTCGAGAAGCTTCCATGA
TGGTAGGACTCCAGATGTTGGGGAGACAGGACGGATAGGAGAAGGGAGTATTAAGGATGC
CCTTCCTTAGGACACATTGTGACATCTTGGCCGCTGCCCCTCCCCATGTGGGACATGGCA
AGCAGAGCCGTGGCGCAGTCTGCTTAGGGCAGGATAACCGGGTCCCGAAGGTTTATTTGC
CGCCAGCGGCGCGAGCTGGGGTTCTTAGTGTTCTGTCGAGGTGGGAGACCGGACAGCCAG
AGGACGATCACCCTGGACCGTAAACGGGGCGACGAGCCGTTGGCATGGTCCTGCCAGGGC
CTCTCGGCGTCAATCACGCCGGCTTGCGCAGAGTTAGGGGCGGAGCTCGGCGCGCGGAGC
GCTCGCGAGAGCTTCCCTTCCCAAACGGGAGGCCCGGGTCCTAGGGCACTAAGTAGAGGG
GCCTCTACACGGAGGACTCCAAATCCTCAGCTATTGGGAAGAACGAATGGTGTCTACCTG
CAATGCCACTGTTCTTGAGGCATTTTCAGTAGAGCACACGTGCGCGGAGGGTAATGAGGC
ACGGGGTGGAAGGGCCTTTTTAAGGGCTTGTGGCTTGGAAGAAGTATGTCTAACTGCAGT
GTTCTTGTCAGCAGAGAACATGGCGGCCCAGAGGGAATGGACCCCGATGGTGTCATCGAG
GTAAGGAATGGGTGTGGACGTTAAAGGGTTGGGAGGTACATTTTTTTCCGTCTTACTCAT
AGTTTTATTATTAACTTACAGAGCAACTGGAATGAAATTGTTGATAACTTTGATGATATG
AATTTAAAGGAGTCCCTTCTTCGAGGCATCTATGCTTATGGTTTTGAGAAGCCTTCAGCT
ATTCAGCAGAGAGCTATAATCCCATGTATTAAAGGTAAAACTCCACTGACATTTAGGATA
AGTGTTCTGCACCCACGTGGACCGTAAAAGGGAAAGTGACCTTTTGGGGAAGTACTAGCA
CCTGTTTGTATTCCTTAAAGTGAAATGATGGCAATCATCTTTCGGGACTGACCTGAAATG
AAGAGAAAACTCTCTGCTGATCACTTATATGGGCATAATTTATGTTCCAACTGGAATACA
TGGTGTGTAGTAGAAGTAACGATTTGATGTGGGATCGGTAAATATGTATCCTACTTTTTT
TAGGATATGATGTGATTGCTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTA
TTTCCATCCTGCAACAGTTGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCC
CCACCAGAGAACTGGCTCAACAGGTATTGATAGTGTAGTTCAAAAACTGCTTGCGTGTTG
CATAGGTTTCAGGTTTCACAACTGTGAAGGATTTAAAATTAAGACGTATAAACTGTCCTA
GTCCTATGAGAGCCCTCATAATGTCCGTGCATGCAGGGAGTTTGTTGTTAGCGAACAGGA
ATGGGTATTGTAGGTATGACTTGTAGGGCCTGGTGTAGCTCAGTTAAACCCATAGGTTTC
TCAGGGTGGATTAGAAATTTGGAATGCAGTTGTGCAACATGAAAACTGCAGTGACATGTT
AACCATTTGACTGTCTCAGTAGTTTGTGATGCATCTGTTGCATGCTATGTTTTCAAAGCG
CTGCTATATTGGCTTTGAAGTAAATTCCTGATGAAGCTGCAAGCTTTACTCAGGTGAGGA
TAAGGCTCAGTGCCTTGTGGGAGAAATACCAGCATTTGCCCTTACAGAGAACATTTCACT
ACACAGTGGAGAATGTAGACATTTTTTTTTACCTGTGTTCCTAGTTGGTGTTTGAGGCAA
CAGGGCACCAAGTTTGAAAAGACAAGAAGGGAGCATTAAGTAGTTCAAGAGTGAATTTTA
AGCTTGTAATTAATAAGTTTTGTGCTATGCATGCATAAAAGCTGTTGGCATATATATGAT
AGTACAATTATGCCTTTAAGCTTAGTCCTAGACCTTGGCTTTACAGAATGATAACTAAAA
TATTTTGCTTTTAGATCCAAAAGGTCATTTTGGCTCTTGGAGATTATATGGGAGCAACTT
GTCATGCTTGCATTGGAGGAACAAATGTTCGAAATGAAATGCAGAAGTTGCAGGCTGAAG
CCCCTCATATTGTTGTTGGCACTCCTGGGAGAGTATTTGATATGCTAAACAGAAGATACC
TTTGTAAGTGACTTTTAAAGGCTCTTTCTTATCTGTCACCAAGAAGGCTGTGAGAACTTT
GAGATGAAGTATGACTTTCTTATTAACAGCTCCAAAATGGATCAAAATGTTTGTTTTGGA
TGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAGATCTATGAGATTTTCCAAAA
ATTAAATACAAGCATTCAGGTAAAGTTCGTTTCTATTCATTTGGGTTTGGTTTCATGCAG
GTACAGTTACAATAAAACTGAAGTGTTCTATTGTCGTTCCCCCTGCTTAAAGTATCTGAT
ACATTACTATCTCTGCCTAGCTCTACCATAGTAAGGCAGAGACGCTTGGTTTCAAACATT
TTTCCCTATAGTATTTGCTGCAAGCTTATACAAACTAAACAGGTAAAGACAGTCATTTCT
TTTTTAAAGGTTGTGTTACTTTCTGCCACAATGCCAACTGATGTCCTAGAAGTGACCAAG
AAATTCATGAGAGATCCAATTCGAATTCTGGTGAAGAAGGAAGAATTGACCCTTGAAGGA
ATTAAACAATTTTATATTAATGTTGAGCGAGAGGTAATTTTCTTTATTAAATGTAAGGGT
TTTTACCTTCTTGTATAAGCACTGTGCTAAAATTACAGGAACTAGGATTATATCTTGGTT
TTTGTAATAATGCTAGCAGAGTACACACAAGAAGAAGAGTAACTGCACTGGATTCCAAAG
ACTGGGGTGGACCTCTTTCTTAATGTCCAGTGTCCTTTGTCATAAGATTCGGTGCAATAA
GTCTTTAGATCAATTCTCCTTGGAGATCATGACCATTTGGGGGTAGCATCAGGTATTTTA
CATTGTGGCTCAACAATTAAGTAGCAACAAATTTATGGTGGGGAAATGTATTAGAGGTTT
GTAGCATTAGGGTTGAGAACCGCTGTGGGATGATGTCACAGGTGAGGCAGGTACAAGATA
GAGTGAGGCCTGTCATTGGATGAGAAGGAAGGATGGGTGGGAGAAAAGTTTGAAGGAAGA
GATGGGAACAGAAGAGGAGAGAGTTGGCGGGGGTTTGGGAGCTGACACTAAGCTTCTGTG
TGCACCTTTACAGGTTCTTATGACTGTTCTTAAGGGGTGGCTTTGTATATATTTGGGTGG
GCAATTATATCTTATAAATTGGACCAAAGGTTATTGTTTGTGTGTTCTTTCATGTAGCAG
TTTAAGTGTAAGGGAGTGTGGGGTGGCTGGTCTGGGCTGCCACAGAGTTGGGGTATGTGC
TTCTGGCAAGAAATCTAGCAGGATACCTTGGGGACTTGCTGGACTTGAGGGGTTAAGACA
GTCATACTTTTATGTATTTTTACATCACAAACCACTGCTTTAGTTTTGTTGAAAATCATG
GAAATTTTGTTTGACTTTAGGAGTGGAAGCTGGACACTCTTTGTGACTTGTATGAGACTT
TGACTATCACACAAGCAGTTATTTTTCTCAATACAAGGCGCAAGGTGGACTGGCTCACGG
AGAAAATGCATGCCAGGGACTTCACAGTTTCTGCTCTGGTAAGAGTTGTTGGATTTAGTA
ATGCTAATTATAGCCATTAAGCAGGATTTTACTACAATATGGCTGCTCAGTGCTGTGTTG
TCGTTCCCCCTGCTCAGAACAATTGTTTCTTAACTATACCTGTCTGCTGTCTACCTGTAG
CAGCCAGGGACGCTTGGTCTCATACATGATAGAAAGAAATTAAATGAATGCCTGACCTGA
ATAGGGATTGCTGAATTGAGTTGTTGTATTTGCAGCATGGTGACATGGACCAGAAGGAAA
GAGATGTCATCATGAGGGAATTCCGATCAGGGTCAAGCCGTGTTCTGATCACTACTGACT
TGTTGGTGAGTTTGCTGTTTTGTTTTGTTTTCTTAAGTACCAAAAGCTAGATTTGTGGAA
AAGGTTTTATTTAATAACCTTAACCAGTTCACGCTATTTGGCAGAATGAGTAAGACCACA
CTCCACAGTGGACTATACCACTTAGTATGGTTCATTACTATATTGTGGCCTACATTGATT
GCAGAGATGTCTAGGTTTTGGATTATATTAAACAACCTCTTTATTTCAGGCTCGTGGGAT
TGATGTGCAACAAGTGTCCTTGGTTATAAACTATGATCTACCTACCAATCGTGAAAACTA
TATTCACAGGTGAGAAGAAAGCATCTCCAATATTTGTATTGGAGAAGTAATATTTGTATT
GGAGAAGTAAATTCAAACATGTCTACGGTGTTTTGTATACAAGGTACTGACTGGCAAATC
AGGGAATAGATTGCAGTAAAAAGGCATAGTAATTTACTAAGGTCTAAAATTGTGTTTGGG
AAGATTGGTCAGAACAAAGTGGGAAACTGTGTAATGTGGCCAAGGTTGTGTATTCACATG
CAGACTAGGTTGATTTAGATTTCTTTGGTCTTAGCTTATGTTTGAGCCTTATAGTGATTT
TTCTTGTGTCCATGTGCTTTTTTTCTTGGTGATTGATTCTATACAGTTGGGATTTTCTTG
GTGTTGCTGGTAGCATTTTGAGTGATTCCCTGGTTTAGTTATAGTGGCTTTTTATCCCTA
AATAAATTGAATTGTACTTTGTTATATGATGTAAAAAAAGACTTTTTAAAAAATACAGGA
GTCGATAGCGGCAGTTGATGACGAGATGGCGCTCAGAAACGGCGTTGACGTAATTTAGGA
CGTGGAATCATAAGCGAAACAGCACACTGTTTGAATAAAGAGCGAGTCGGTATTTATATT
TGATTTTCTTTTGTCATGATTATTTGATATTTTAAGTTGTTCCAGCCCAAGGCATTTTTG
TATGTTAGCATTTCTGATAGGGAGCATTAGGTGGTTGTATTGTCTGGTACTTTGTAGGAA
GGTAGAGAGCTGTTTTGGAGGTGTAACACGTTTGAGTAATTTGAGTATAACGTGTGAAAA
GAAGCTGAGCAAAAAGCAGTGATGAGTTTGGGTTACCATACCAAATACTTGCTTTCACAC
TGGAAAAAGTAAGTTTTAGAAAATAGTTAACCTTGCAGTATTTGTATTTACAGTTTACAG
TTCCAGAAGTGCGTCGAATGGATTGTATAACTGTTTCTTTTATTCCTGGTGTTTACATTT
GTCCCAGGCTGACAACTGCTCCTGGCTGGCCCACTTTGGTATGGGCTTTAATTTCACCCC
AAACACAATACTGTCATCTGCTTTACTGTAATGCTCAAGGCGCCTATCTCATTTTGCAGC
CAGACAGGCCTTGAATTCTTTTGGCACTATCTGCAAAGGAAGATGTTTTCCCACCTGGAT
ATTGGTTTTTATCAGCTAGTGCTGCACTTAAAAGCACGAACCCTAACCCTGATAAGTAAC
CAGCAGCTGCTGGTTAACAAGTGGATCGTCATATTCAGTAGCTTTGAATGGTACTAAAGC
AACTTGCTGACTGCTGCTTTCTTTCTCTTATACAGAATTGGCAGAGGGGGTCGATTTGGG
AGGAAAGGTGTGGCTATAAACTTTGTTACTGAAGAAGACAAGAGGATTCTTCGTGACATT
GAGACTTTCTACAATACTACAGTGGAGGAAATGCCCATGAATGTGGCTGACCTAATTTAA
TTCCTGGGATGAGATAGTTTGGAATGCAGTGCTCGCTGTTGCTGAATAGGCGATCACAAC
GTGCATTGTGCTTCTTTGAGAATATTTGAATCTTGTCTCAATGCTCATAACGGATCACAA
ATACAGATTCTGATAGCAAAGCGACTTTAGTCCTGAGCTCTTGTGAGGAAAGGCATTGGC
TTTATCCTCTTTAGAGTTAGACTGTTGGGGGTGGGTATAAAAGATGGGGTCTGTAAAATC
TTTTTTTCTTAGAAATTCATTTACTAGTTATGTAGAAATGGTTGTATTAGATGTTCTCTA
TCATTTAATAATATACTTGTGGACTAAAAGATATAAGTGCTGTATAAAATCAGCCAATTA
TGTTAAACTAGCATATCTGCCTTTATTGTGTTTGTCATTAGCCTGACTAGAAAGGCCTTT
AAAGTGATCTTTTTTTAGAGAAAATTTGAATGCATTTTGTTTATTGTATTTATTCAATAA
AGTATTTAATTAGTGCTAAGTGTGAACTGGACCCTGTTGCTAAGCCTCAGCAAGCAATCA
TCCTAGGTAGGGTTAACAACCCCCCAGTAAAATTGCCATATTGCACATGTCTTAATGAAG
TTTGAATGTTAAATAAAAATTGTATATTCACTTTATATACAGGTGGTTTGGTCCTTTATT
TCTATTATTCATACAAAAGAACATCGATCTTAACAGTTCTGGGTCAGTTGCTGCATCACA
GTTGCGCAGAGGCTCATCAGCTGCAGGTGCTCATCTGCACCATCTGCTAAACACTTATCC
ACCTCCTGCAAAGGAAATGGGAAAGATGAAGGCGAGCCCAAAGAGATAGCTTGGTAACTT
TTTGAAGTGTAAAATACTTACAGCAAGTTTTTCTGTAATGATGGACTTCTGTTTATCAGA
CAGATTTTCATCTTCTATGATTGAATCATGAAGTTGGTTGACAAGCTGAGTGGCTGCATG
CCCTTCATCTATTAGGTTCTGCAACAGAAAGTATGCGGTCTTAACTCATTAAATGGACCC
CAAGCGGGCTTTACCCCACCCATGCTGACAAGGGAAGACTGCTGCTGAGAATTGCCGCAG
TGCAAATTTACCTTCAGCACGGCTTCTAGTTTGTCAAAAGAGCCGCTGTGACATGCAGTG
ACTATTCCCTCAATGGTTGCAGCTGGTATTACCTGAAACAATAAGCATTAGAAAGCAGCA
GATCTCTAGGACTGACTGAAAGTCAGAAGACTTAGGTGTGTACTTGCCCCAGCAATGTCT
GTGATCACATCTTCCGAGATTTCCTTTCCACCTGTTAGTCGAGTAGCACTTTGAAGAAAT
GTAATTGCTTTCCGTAAATCTCCTTCTGATATTCTAACAAGATAAGCTATTTCCTGAAGA
GAATTTGCAAGAAAACTGTTAACATCAAGATTAGAGCATTATTTTCAGGACCTCTCTAAG
AGGTAAAAAGGGATTAAATCCCTAATCACCATAGTAATTACCTCATCGCCAATTTTGACA
TTTTCCTTCTCAGCAATATCCAATAATCGCTTCTGTTGAATTTTATCTGACAGAGGCTTG
AAGCGGAATTTTGAACATCTAGAAGTGAGGGGTTCAATTATTCTGAAAAAGATTGAAAAC
ATGTATTTCAAAGCATAGAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1050, 1811..1859, 1941..2073, 2343..2482, 3194..3362, 3449..3558, 3789..3932, 4760..4897, 5135..5224, 5449..5528, 6815..7600
1022..1050, 1811..1859, 1941..2073, 2343..2482, 3194..3362, 3449..3558, 3789..3932, 4760..4897, 5135..5224, 5449..5528, 6815..6956
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved