Rattus_norvegicus Locus Fbxo45
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Fbxo45
Rattus_norvegicus
Fbxo45
11
SNORA79
4618..4760
14537
GTGAAGCTGGAAGGCTTGGCTCCCCTTGAACTGAAGTTCAAATAATGCTAGGTTCTTTT
CCTCCCACTGTTGGGATTACAAATTACAAAACAAAAAACAAAAAACTACACATATTTCCT
TAATCTTTTTACTATGAGATGAACCGAATTCACTATATTTTGTCCAAAAGACTGTGACAC
TTGGTATTCAAATGACCCTTTGAAATTACCCAAACTTGTTTAATATCAAATATAATAAAA
ACCTGCGTATTTACGACGGTTGCTCAGATTTAGCCACCTTACTTTTAGAATGGATACTGT
ATAGATGTTCTGTTGAGTCCCCTACTGTCCTAGCCAGGAAAAGACGATGTCAATTTCTCA
AGGTAAAAAATAAAGTAAAATGGATCTAACCTGACCACGACAAGAGGTCTCCAACTGCCC
AAAGGTAAAGTTAATGGATCCAAGCGAACTGAAGATGAAGGATCTAAGAACTGGCTAGCA
AACTTTGTCGTAAACAAAGTTGGAGAATGAGCAGAAAGCAAATGAAACGGGAAACTCCGT
AGGAAGAGAGGCCAAGGAAAGCCGACTCAAGGCCATTAGAGGAAAAACAGAAAAACGCAC
TTGAGAACAGATCAGAATCCCACTAGCCAACAGCCTCATACCTGGGCTTCCAGTTCCCGG
TGGCGCGTAGTGATGACCTCAGGCGCAGCATCCAATCCCATCAAGCTTAGGGAGCGAGGC
GCCTCCACCGAACAGTCACTTCCGGGCTGAGAGGCGCGGCGGCCGAGCTGGGCGTGCGCC
CTTGCTTCTTGCCCTCAACCCGCATGGCGGATCCCGGGGCGCGTCGCGGGCAGGCAGGGC
GAGGCGGGTGGTTCCGGCGCCCGCGCTGAGCGGCTACGAGGGGCGGGGACCCGAGTGGCC
CGCGCCATCTGCCCTCAGTGAGGCGGGGCGCGCAGCGGACGCCCCCGGGCAGGGGCGGGA
GCGGTGGAGGCGCGAGCGGCTGTCGCTGAAAGGGGCGGTGAGCGAGCTGCTCCGGTCTCT
AGGCGAGGCTTGGCCTCCCGCGCCGAGACGGGGCGCAGCGACGGCAGCGGCGGCCCTCGG
GCCGGCTGGTGAGGCGATGGCGGCGCCGGGCCCGGGGGCTGGGGCAGCCTCGGGCGGCGC
TAGCGGCGGCGCCGGNGCCAACNNGCGGGGGCGGGNCNNNNNGCTCGNGNNGNNNNGNGN
NNNNNCNNNNCNNCCGNNNNGCNGGCCGNTNNNNNNGGNGNCGNGNGGNNNNNNNNNGNG
NNTNTCNGNNNNNGTNTNNNNNNNNNGCGNNNNNNNNTNCNNNNNCGTNNNGNNNNNTNN
NNNNNNNNNNNNNNNNNNNGNNNNNNGNNNNNNNNNNNNGNNNNNNNNNGNCNNNNNNNN
NGNANNNGNGGNNNNNTNNNNNNNNNTNNNNNNNNNNGNNNNNNNNNNNNNNNNNTNNNN
NNNNNNNNNNNNNNTNNNAGNNNNNNNNNNANANNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCGCGGCGATGAGAACAGCGAGGTGTGGCGGAGCCTGT
GCGCCCGCAGCCTTAGCAGAGGAGGCTATGCGCACGGACATCCTCTGCAACCTGCCCAGC
TACAAGGCCAAGGTGAGGGAATCCCGGGCCATGTCGAAGCCCAGTTCCTCTCCTGCCCGG
TGTTCTTGGGGTTTACCTTGAAAGCTTGAGTTAGAGGTTTCATCTCACCATCCCGTCTTT
CTACGGCTTAAGCCAGTCAGTACCACCCCTCCTTTCCATAACGATCTTTTCTTTGGATTG
AAGTTGTGCTTCGTAATCCACCTCACTTTTAAAAATACTAGGTGGTTTCCCATCATTCAT
TTTCCTCAGCTCTACTTTCAACAGTTTTTGCTCTTAAAGACCAGCCGATACCCTTGATCA
TATATTTTCCCTGGCCTCCAAGTAGAATGGCACTAATGCATTCGAGGTCGCTTTAAAATG
GGTTTAGTTGCTGGGGCTTTTGCGTTCACCATCCCCTTTCTTGGCTCTGATTAATAAGCA
CGTTTTCATTATTTTCACCCATGTTCTCTTAGGGCCACAATATTTAACGCTTCCAAGTGA
TGATCAGGGTAGGCATCCTGCTAACTAACTTGTAAGAAAGAGACTTTAATATTACTTCCT
CTCATTGGTGCGGTATAACTCATCAAACTGCCTTGTCCTGCTGTTATTGATAACTTTTCT
TAGTTCTACTGGGGTGATGTCTCTTTTGTCATGTAATATGTTTATTCCTGTTTTGCTGGG
CTTTTGTTGTTGTCGTTCTTGATTCTTGTGCTTTCATAACAAAATTAAAATGCTAACAAA
CAGGTCGTGGCAGGACCAAGTATTCTCCAGCATACAAACAAAAGGCCTTGGACTAAGGTT
CATGTAGGTAGATAGTAGCTCTTCAGGATAGCAGTCATCAAAAGCATATGAAGCTGGATG
TGGTGGCGCACACCTTTAATCCCAGCACTCCAGAGGCAGAGGCAGAGGCAGGTGCACCTC
TGTGAGTTAGGGCCAGCTTGGTCTGCCAAGTGAGTTCCAGGACAGCCAGGGCTACATAAA
ATGAGAGACTGTCCAAAACAAGGAGCATATACGAGAGATGATAGACGTCTGACCAGGAAT
GTAGTAAATATATCTTTTCTTTTTTAATTCTATATTGCCAGTGAGTGTCTAAGTAATTTT
TAATGTGAAATAGGTGCACTCTTTCTTTTAATATACATGTATTATTATAAATATGTGTAT
ACACATATTTTATGTCTGTTTTTGGAGACAGGGTCTCACTGTGTGTCCGGGTGGTCTCCA
ACTTGCCATCTTTCTGTCTGTTCCTTGAGAGTGCTGGGATTATAGGATGGGCCACAGTAC
TGATATATTCTTATATATTAAGACGAGTTTTCGTCTGATGAGAGAAGGAACACTGCTGTC
AATTATGTCAACTACCAAATAAATTGTCTGTCTGTCTGTCTGTCTTTCTTTTTTTCTTTC
TTCCTTTCTTTCTTTTTTTCTTTCTTTATTTATCTGAGACAGGATTTCAGTATTCAGCCT
CGGCTGGCTTGGAAGTTAACAGAAATCCACCTGCCTCTTGTCTTCAAAGTTCTGAGTCTA
AAAGTGCCACCACTCCTGCCACCGTCCCCATCATATTTTTGTACTTATTTTTTCTTTGAC
ACAAGTACACATACTCATGCATATGTGAAGAATACCAGTGCCCACAGAATCTAGAATGTC
TACTGCTGTAGCTGGAGTTACAGACATGTGACCTCCCTCTGCAACACACACACACACACA
GGAAAATCAGGGGGCACTCTTTTTTTTAATTTTAAAAGATTTTATTTATTTTATGTATGT
GCTCTCTAAATAAATAAAAAGGTTTTATTAATTTAGTATGTGCACACTAGAAGTGTGCAT
CAGATCTCATTACAGATGGTTGTGAACCACCATGTGGTTGCTGGGAATTGAACTCAGAAC
CTTTGGAAGAGCAGTCAGTGCTCTTAACCACTGAGCCATCTCTTCAGTCCCCGGGGCACT
CTTAACTGCAGACTAAATTGATACTGATTTTGGTTTTTCCGGAGAGATTATAGTTTTAAG
TTTCTAATCTTCATTATCTTTCTGCTGCGTGCACTGCGGCTCCAAGGTGGGCTTGTCTTA
CCCAGGTTCTTGTAGGTGACAATTGTGAAAATGCAGTGTTAATTCAGGAGGACTCAGTGT
AGAAGTCCTTAGACAGGGAAATAACTAACATGTGGCACACATTGCTACCTAGTGTAGTAT
AGGAATACTAGCAGTCCGTGGGGAGGAAGAACTTAGGAGCTGAGTGGAGAAAAAGTTTGA
GATTAAGATGCCACAAAGCTGAACTTTAAGATGAGGTTTATGATGTTAAATTTTATGAAA
AACTCTGAGCAGAAAAACAAGGAAAGCAAAAATGCAAACTCTTACCCACACTTTGCCTTG
TGGGGATTACAGTGTAGTAGAGTGCGTGTGCGTGTTCATGTGCCTGCGCCTGCCTACAAG
CCTTCCTGCCTTCCTGCCTGCCTCCCTGCCTGCGTTTCTTTTTTCAGTACTGGGGATTGA
ATATGTGCTAGCTGCATCCCCCAGCCTGGGGGAATAGCTATTAATCTGATCACTGCCGTT
GTGAAACTGCATCTGGTAAGTATTATGAGTGAGAGTCACATCTGTTCTGAGTGTCAGTAA
TGGAGGATTTAACTAGGTACGGAGGTCAGGAAGAGACTTTCTTATAAGACATGATGCACA
AGCTTAGTGACACCTAAAAGATAAGTATAGAGGCCAAGAGGAGCAAGAAGAGCCTCTGAG
GAGGGACTCTGCTTGTATGAGAAACAAGGTGACTGCCAGTGGTTGCTCTGAGAGTGCAGG
TGACGCTGGTTTGAGTAAGATAAAAGGAGTGGGACACACTACACTGAAGCCTTTCTAGTT
GTAAGCAAGAACAATGGCCGTGGGGAGTGGTGCCATGATCAGTTTGTGGGTTAGTTTTGA
CTCCACTATGGAGAACAGGTTGGAATACGATTTTAGAAATGTGGTAGATCCACTAGAAAG
AGGGTAGTGAAGGAGATGGGGGAAAATGGACAAACTTAGGAAATAGAGTAACAGAATTTG
ATGACTGTTCCTCCTATTGCCTTTAGATGTGGCACTAGGATTTTAGGTCATCATAAATTA
AAATTGATTTTTTTCACTCAGAGAATATTAAGATACTGGGATTATCTATGTACTCTCTGA
AATTTGCGGGATCAAACAGTTTTGTTTTTTTTGTTGTTGTTTTTTTAAAGAATCTGTAGA
ATGTGGCAGTAGTTTTGAAATAAAGACGAGGAAGAAGGAAGAGCTAAGGATGACTCCTAG
ATATTTGGCTTATATAATCTAAGTATCACTTGAGCAAGAGTTTGGAGGAAAATGACAGCA
AGTTCAGTTGTGGAAGGTCAGAATTCATAGTGTCTTTGAGATATTCGTCAGATTTCAGAT
AGGCAGCTCCTGATAGCCAAGGGTTAGAAGCAGTCTAGGCTAAAGATAGGAATTTCTAGT
TGGACTGAATGAAGGGAAATACTGCTGTAAAGGTGACTGGGGACTGGCTGTATCGTGGAA
GAGGGCCTTTGGAAACAATCTGTTATGTATTGTTTGGGCTTTATTCTGCACCTGGAAAAC
CATACAAGTCTGAACAGAAGAACAGTGAAGTAAAGCTGGGCTTTAAAAGACCAGGCCATG
GGATACAGAGGAGAGAAAGACACAACTGGAGGAGTGCCACAGAGAACGACTCTGCATGGT
GACAGTAGACCAACAGCTTGTTGAGGGAAGGTGCATCCAGCAGAACTCCCAAGGCAGCTG
AGCAAATGCGAGGAGAGTACAACACTGGGAAGTGTTTGGTTGGTTCATTTTGTTCTCCTT
CCTTTCTATCCCTACCTTTTAAAAGACTTGTTTATTTATGTTATGTATGAGTACATTGTT
GCTCTGAGGGCATCAAATCCTAGATGGTTGTGAGCCACCATGTGGTTGCTGGGATTTGAA
CTCAGGACCTTTGGAAGAAGCTGTCAGTGTCCTTAACCACTGAGCCACCTCTCCAGCCCC
CGTCCTTCTGTCTTATCTCCTTCTTCCATGCTGCTCAAACTAGGGCATGCTTAGCACTCA
CTGTGCCATTGAACATTCCAGAAATGTTCTTTTTTATAACTCACGCTTTACTTATTTCCA
AGTAGTATTTAGTCATCCCAAATATTTTGTATCAAAGTATACCCTAACTTTCAGACTTAC
ATTCTGAGCTAGACCTTTTTCATTTTTGTTTTTAGAAGTGGAATTAGAGACAGCTTGTTG
AGAAAGGGCAGGCCCTCTGCAGAAGAAGGGTGAGCTAAGAGCTGGGGAAAGTGTGCACTC
AGAAGCCCTGGGCTAGGTCCTCATGCTGTTGAAATAGGAAACCTCCGTTTTTCAGAAAGA
GACAGAAACTATGACTTTAATTTTTTGTATTGTTTTTAAAAATAGAGTTTGTTTCTCTGT
GTAGCCCTGGCTGTCCTGGAACTTGCTCCATAAACCAGGCTAACCTCAAACTCAAAAGAT
CCACCTTCCTCTGCCTCAGTGCTGGGATTAAAGGTAGGTATACTTGGCCTTTAAAATTTA
TTAATTGGGTATTTTTCATTTCATTTGAATTTTTCAGTATTTGTTCTAAGAACAAAGATC
CATAATATAATCACAATGCTACTGTCATCTCCAAAATGAAACTAACAGTAATTCCTTAAT
TCAGAAGTTGCAGTATTGTCTCATAAATGTGAAATATATAGTTTAACTTATGGCTTATCT
AATCAGGATCTGTATATGTCCTTCGAGAAGGAGTCGTGATGGGGCTGGGGATTTAGCTCA
GTGGTAGAGTGCTTACCTAGGAAGCCCAAGGCCCTGGGTTCGGTCCCCAGCTCCGGGGGG
AAAAAAAAAAAAAAGAACCGAGAAGGAGTCGTGAGGTCTGTTAAGGCTATCTTAGTAAAC
AGACTGATTCTGTCTCCCGCCTCTGCAGCTCATTTGTCACCATCTACCTTCCTTAATGTT
ACCCAGCATGCTCTTCTCCGTCCCTTCCTATAGACTCTACAGTGCAAAGCATGACCAGTT
TAGATTACAGTACATTTCTGTTTGTTTGTTTGGTTTGTTGGTTGGTTGGTTAGTGGTGGT
TTTTACAAAATACTTTTTACTAAAGTCATGTGTTTAGAGGTATGGTAGAAAACAAGATCC
TAAGTGTGACGTTAGTGAATGGAGTTCAGGAGAGAGGAATGATGGGGATTGGGTGGTCCT
GGCAAAGAACACCTTCATGGAGGTGGCGGTAGAAAACTAAGAAGAGGACGCAGATATGGC
ACGAGGAGGTGGGAACAAAGGGCAGCAGCCTGCTCTGGAAGGCTTTGAAGCCAAGCAGGG
CTAGCAGTTGCTGTGGTGCTATCCAAAGGTATTAGCTGCCATGAGATTCAGTGGAAGTAA
TGTTTTAGAAGAGACTTCTGGAGAGCAGAGGGAGGGAGTCACTGTAAATGAACGTGGTCG
AATCAGTTCAGCGAAATCGGAGATTGAGGAAGAGGTTGTTAATATCACTGGGGCAAAGGG
AAAAATTAGAGAAGAAGCACCTGGAACTTGTAAGACTAGGAATAGGTGACGAGGAAATCG
TAGTTTAACATTATCTTGAGAACTTCATCCTCTTCTTGTCATTCTTTTGATTTAGAATCA
TACTTGTTGGTGGGGATTTCCTTCCCCTATTCACGTTTATGATGCCCATGTCACACCACA
CCACACCAACACATAATTAAAAAAAAAAATATAAACAGAAACAGATAAGGAAAAATTAAA
AAGTGCTTCGTTTGTCCATTTTCCTTGTGGAGACAGAATGCCCGAAACAAGGACTTACTG
TGCAGCACAGCAGCAGTGAGACAGTGACGTGCTGGCTGTGGAAAAATGACCTCGACCTGG
GAGCTGGGTCCCTGGCTCTCTAAGGCTCTCCTGCGTGCTGTTGCTCTTTAGGTCTGTAAC
CTCCCCCTCCTCCCTTTTTTCCCTTCAGATTTATTTATTTTGTGTATGGGTGTTCTTCCT
GTATATACCTTGTTCCTTCAGTGCCCACAGAGACCAGAAGATGGTGTTAGGTTCTCTAGA
ACTAGAGCTTCAGTGTGTTGGGAATTGGTTCCTAGGTCTTCTGCAAGAGCAACAAGTGCT
GTTAACTGGTGAGCCATATCTCCAGCCACACATACATACATAGATATATCCACATATAAA
TACATATATCTGTATTTCCCCCCTCTTACGTGTAGCCCTGGCTGTCCTGGAACTCACTCT
GGATACCAGCCTGGCCTCAAACAGATCTACCAACCTCTGCTTCCCAAGCGCTGGGATTAA
AACCATGTGCCTCCATGCCTGGCCCTAAGTTTTATATTTTTAAAAGATGAGAATTTGTCA
TTATTTGTACAAAGGAGCTATTTTTTTTTAATGTTTTAATGTTAGTACCTTAAAAAAAAA
CTTTATGAAAGGTCAGCTCATTTATCCTCTTGATAGCTGCTCCTTTTAAGTCCTCTGGTT
GAATTTGTTTTATTTTATTTATTTTTTGTTTTGTTTTGTTCTGTTGAGGCAGAGTTTCTC
TGTGTAGCCCTGGCTGTCCTAAAACTCACTCTGTAGACCAGGCTGTCCTTGAACTCAGAG
ATTTGCCTATCTTTGCCTCCTCCAGGGATTAAAGGCCTGCACTACTAGTACCTGGCTTCT
TCTGGTTGAGTTTGTGTGCTGTCTAGGGGATGTAACTTGGAACAAAAGAGACTGCTGATG
TCAGTGTATGAGTAATGCCTAGTGAGTAAACAGAGAGTCTAAGGGAGTTTGTGGTCAGTA
AAATCCTCTCTTCACTTTAGAACTGCAGTGACTAAGGTCTTTATATAATATTTTATATAA
AACACACACATATATTTTCCTCTTGCATATGCTGGACTAGAACATTACCAGTGAGCTCAG
CCCTGACATAGCTCAGGCTGGCCTCAAACATGATATCTACTGTGGATAACCTTAAACTTC
AGCTCTTCCTTCCTCCTCTTCCCCAGCAATGAGCTCAGTGTGTGCCACAGTAGGCTATGA
TTCTTGTTTATTACAGCATTGACGATGTGGAAACCACACCACCTAAGTGTAAATAAAAGC
AAAGAAAGTGATGTGCTGAATTTTCATATGCCATCCACACAAGTGTTAACACTGACTCAG
GACAAATCTGGTTTCATGTTCACCCCATTCTCCCTCTAGCTATTTCAAAGCAGTCACCAT
TTATAGTTATTTTATGCATAAACATTTTAGTAATATCTCTATAAAGTACAAGAATAGTTG
TGTACATTGTTACGTTTTAAGTTTACTTGTAGAAATTATACTAGTTTGGGATTTGGTCAG
TTAGACAGTTGAATTGGTCCCCTCTTTCTTTGAACAGGAGTTTTCTGTTTCCCTTGTTCA
TTGTGACCTGGCTCAAGTGATGTAGAGTCGTTAGGCCTGCACGCATGTGTTACCGTGCCT
AGCTCTAGCTAGGAGTTATTTTTAACAGGGCTTAGTATCTAATGACAGTTTCCCACCAGA
AAATTTAGTCATTATTTGGAAATAGTGTTATTTAAAAGTTTATAATCTGGGGTTGGGGAT
TTAGCTCAGTGGTAGAGTGCTTGCCTAGCAAGCGCAAGGCCCTGGGTTTGGTCCCCAGCT
CCGAAAAAAAGAAAAAAAAAGTTTATAATCTTATTATCTATAAATACAATGCCTCAAGTC
TTTTGGTTTTTTGATTTGGGACAGGGGAGAGAGATGGGGTTTAGTTGCCAAGTAGCCTAG
GCTGGCCTTGAATTTTCAATCCTGTTTCAGCATCCCGGAGGGCTCTGAGATCTGAGATCA
CAAATGTGAGCCATCACATTACACTTGCTGCCCTTTAAGGTAAAAGTCAGTTATTCTTTT
GTTCTGTTTCTTGTGGTTTTAGGTACGTGCTTTCCAACATGCCTTCAGCACGAACGACTG
CTCCAGGAATGTCTACATCAAGAAGAATGGCTTTACATTACATCGGAACCCCATCGCTCA
GAGCACCGATGGTGCAAGGACCAAGATTGGTTTCAGTGAGGGCCGCCACGCCTGGGAAGT
CTGGTGGGAGGGCCCTTTGGGCACTGTGGCAGTGATAGGGATTGCTACGAAACGGGCCCC
CATGCAGTGCCAAGGTTATGTGGCTTTGCTGGGGAGCGACGACCAGAGCTGGGGCTGGAA
TCTGGTGGACAATAATCTACTACATAATGGGGAAGTCAATGGCAGCTTTCCACAGTGCAA
CAATGCACCCAAATATCAGGTGAGAGACGGCATTTCCTCAGTGTGGGCCTTTTCCAGTTT
GTTTTAATGTTGCTACTCTAAGTTTTTTCTTTGTTTTGACGAGTTTTAAAATAAATGGTA
GAGGGTTACATTCAGTATTTCTTAACACACATTTGAGCAGTCCTTCCTTGCCCTGGATCG
GGATTGCCAAGTTTTTCCTGTACAGGCTAAAGGGTAGATTTATTGGGTTTTGCTGTATGT
CTCAGAAAAGTCAGCAGTTGTGTTGGTGTAACATCAAATGAGCTATAGATACTGTGAATG
AAGGAGCATGGTGTGCTGGGAAAGACCGCATTTATGCTGCAGGACTAGTTTGGCCACGGG
CAGTCCGTTGGTTCATGTTCAAGTGTCATGAAACATCCACAGGTCTGGTTTTGTTGGTCA
TCTCATCACAACAAATGCATGTATGCGCATATACGTGCATATTTACTCTGCTTCCTACTA
ATGTGGAGTCAGAGTCCTTGGAGGTGTAACGTTTTCTCTAGAGATGAGTTCAGGCAAGCT
GCTACTTTTTTTTTATTTTTTTAGTATCTTAAATGTGTTTTTAAACTTTATTTTATGGGT
ATGGGTGTTCTGTCTGCATGTAAGTCTATGCATGCCTGATGCCCCCAGAGGCCAAAAGAG
GAAGTAAGATCCCCTAGACCTGTAGTCACAGCCAGTGTAAGCCACTGTGTGGGTGCTGGG
AGTTGAACTTGGGTCCTTTAGAGGAGCAGACGGTGTTTTGACTGCTGGGCCACCTCTCCA
TGCCCTGTTCCTCCATCCTATGTCTTATGTCACTTGGTTCCAGAATCAAGGCTGTGTCCT
GACGCCACATTACTGTAGACTCAACAGAGTGGAAGACAGTTAAGTAGGGTTACAAACACT
GAGTTAACTGTGGTTAAGAGGACTTGATGCTTTTCCAGAGTTCAGATCCTATCAACTAAA
TGACCTTTGATTCCTCCAGTATGCCTGTGTTTGAGTCTGTATTGTCTGACTCTAATGTAG
TCACTCCAACTCTTCCTGGAGTACTGTGACAGGGCATCCTCCTGCCCTTTGCTTTTGATC
CATCTTTTAAATGGGGCCCTCAAGAGCAGGTGGTTTAGTTTTTTTTTATTTTTTTAAGAT
TTATTATATATGCGTACACTGTAGCTGTCTTCAGACACACCAGAAGAGGACATCAGATCT
CATTACATTTGGTTGTGAGCCACCATGTGGGTGCTGAGATTTGAGCTCAGGACCTGTGGA
AGAGCAGCTGGTGCTCTTAACCTCTGAGCCATCTCTTCAGCCCTAGTCTTCTTTATTCAA
CAACATTTCAGTCTCTCTCTTGAGAGTTTAGTCCATTTGTACATATTATAATTGTTAGAC
AACTTAATAGTATCTTTGTGTCCCATAATTCATGATCTTTTATTCCTCATCTGCCAACCT
TGTTCTCTTTGTTGTTTATTTGTTTGCTTTTGAGACAGGGCTCACTACGTATATTCCTAG
CTGGTCTGGAACTCACAGGTATCCACCAGCCTCTGCTTCCCGAGTGCTCGAATTAAAGGT
GTGCACCACCGTGTTTGCCACTTTGTCTTCTTTGATTGCAGATTCTATCGCTCTGGCCTC
ATGTCCATTGCCCGTTTATTTTACCATCTCAGCTGCTGTTGAACCAGGCTGATGAGTTAC
TGTTACTGTATGCTCTCCTTTTCTGTCTCCATGTCTCTGTTGAAATTTGTTTCCACACAC
AGAGTAACTAAACATACTTTGAATTCTTTGTCAAATTAGAAAGAAAGCCTAGGTCCAGTA
GTTTCTTTGGATTTCCCACTACTTCAAGAATCATACTTTTCTTATTTTAGCCTAGTGATT
TTTCTTTTTGAATTGAAAATTTTATGTGTGGTAAGGTGTATTAACAACTCTAGAATGTCT
CCTTTTTCTAGAAACTGCCTTATTCTTTGGTGCATGTTGATTTTCTATTAAAGGAAGACA
GTTAACCTGTTGCAGCAGCAGCTTTCGCCTCTGGTCTTCTAGGCCTCTGCTCTCTCAGTC
CACTTCCCTGGGAGCTTTTCATGTGTGTCATCTCTGTGGTCTCCTGTGGGCTTGGGTGGA
GTTTGTTCAGATTTGGATGCTCGCTCCTCTCTGCTTTGCTCCCTTCCACGGTGTCTACTT
GTTCTGCCATCCACTTTTTTTTTCTTTTTTAATTTTTAATTTTTGAGACAGAGTCGCCCC
ATGTAGCCCTGGCTGTCTTAGAACTCACTGTGTAGACAAAGCTAGCCTCAAACTCATAGA
GCTCTGCCTGCCTCTGCCTCCAGAGTGTATTTTACCCCCTGATACCAGCACTGTGGAGAC
TTGTGCTTTGCAGTTTCTTTACTGTGAACATACATGCTGTAGGTTCCTAGGTTCCCAAAC
TTGGAAGTTTCAGCGGGGTTACTTATGTCGCCTTAATCTGCTTCAGAACAAGGTTAGTCC
CTGAGACTGATGGCCAGACTCCTAGGATAACAAACTCTGTTGCCTGACAGAGCTGGAGTA
TTGTTCTCCTTCTATTTGTCTGGTAGGCATCGTAAAGAGATTGGATATATTAGTGGTTCA
GTTGGGCAAAGAGTAGCTAAAAGCAGAAGTTGGTGGTCATTTGTGACAGGAAATAAATGA
AGGAAAATTATGGACAACAGCAGGAGTTACCATAATTATGAAGTATTAAATCTCAATTAT
AAATTGTAGGACTTTCTACTTCCTCTCCCTTTGGAGACAGGAGCTCATGTGTCTTAGCTG
GCCCTGGTCTCTGTGCAGCCAGTGATAACTGTGAACTTCTATGCTCACCTCCCACCCAGG
TGCCGGGGTTACTTACCAGCATGCTCCATTCCCAGTTTGGTGCTTGGGATTGAACCCAGA
GCTTCATGCATGCGAGGCAAGCAGCCTGTCAGAGGAGGCTGTGGCCAGTTCTTTCCCGCC
TTCAGCATACATTGTAGCCAGCCTTTATGGATGCCAATTAGAAAGATGACACAGTCCTGC
TATTCCAGGCTTTAAAGTGGGAGAAAAGCTGGACATAATGCGTTTGCAGTTTAAACCATC
AGGTACTGCTCATTTTTAAAGCCAGGCACAGCAGCACAGGCGCACACCTCTGGTCTCAGC
ACACAGGACACAGAGGCAGGAGGATCTCTGAATTCAAGGCCAGCCTGCTCTACAGAGTGA
GTTTCAGGACAGCCATGGCTACACAGAGAAAAAGAGGGCTGGAGAGAGGGCTCAGCAGTT
AAGAGCACTATCTGCTCTTCCAGAGGTCCAGAGTTCAATTCCCAGCAACCACAACCATCT
GTGATGGGATCTGATGCCTTCTGGTGTGCAGGCATAACACTATACAAAATAATTAATCTT
TAAAAGAAAAAGAAAAAAATCAGAATAAACGTGGGGAGAATAATGTCTGTTCTTTCTTCA
AACTGTTTATCCCCAACCAGAAACTCCCCTTCTCACTACCAGAGATAGCCTAGAGATAGA
GATTCTTTGTACGTTTTCCACTCCTGACTTATCCTCTCTCGTAGCCATGACTTTGGTGGA
TGTCCTGCTAACCTTGTAATGTCTATTTACAGATAGGAGAGAGAATCCGAGTCATCTTGG
ACATGGAAGATAAGACTTTAGCCTTTGAGCGTGGGTATGAGTTCCTGGGGGTTGCCTTCC
GAGGACTTCCAAAAGCCTGCTTATACCCAGCAGTTTCTGCAGTATATGGCAACACAGAAG
TGACTTTGGTTTATCTTGGAAAACCTTTGGATGGATGACAGTGGCTTTCTGGAAAGGACA
GTGGAGAAGAGATCTATGTGTGGAAAGTAGAACCACGAAGTGAAGTATCATGTGTGCATG
CCCAAGAAACATCCTGAAGACACATGAAGTTGAGAACTAGAGAAGCAACTCTACAACAGA
GATGGTCATAGTGTTTCCTCTTTCCACTGGGCCAGAAAATCCTCAGGGTTGCAGTTGGTT
GAGTGGGCAGTTGACAGACATATGCATGTTGTCACAGAGTCTTCTCTAAGTTAGCAGTGT
GTGACTTCCAGCTTAAAGGTGAGCGTGTAGAGACGCTGTAGGAGGGAATCGCAGGAGTTT
ATGTAGAGTTCATGGAGAAGGCTCGGTCCCATCTTACATCTGCCTGTCCCTCCTCCAGTC
CCTTTATTTCTAGCCAGCTTGACTTAGAAAGTATGAAACTGGCTGGGTTTTATTTAATAT
TTTTAATATATTGAGAAGCATGGTCTGCCTGGACTGCACTTCTCTAGCAATGAGAAATAA
AATCGTGCAGCTATTTTAAAAGTTGTATATATAATGTATATAAAACTGTAAAAAAAGGGG
GGCAAAGGCATTGCTTTGTTCTACTTCAATTTCTTAAAAATCACTACATGGTACAACATT
AGAGTGACATTAGGGGACAGTAGGGTAGGAGAGAGAAGAGGAGACATGTGCTGGCTCATT
TGGTAGTGTTTGGGCTCATAGTCCATGGCTAGAAGAGAATTATGATAAAGGTTCCTCAGT
TGGTTAAAGGCGGGAAGCAGGTCTACTTACAATTATGCATATGCCCAGGGCTGATTCAGA
AGTATAGGAATGTGCCTCCTGGCATCTGGCTTCAGTGTTTGGCCTTCTGAGAACTGGTCT
CCACACAGAACAGTCTCAGCTGCTCTTACAGTACTCAGTATGAGCACTGTTAGTATAAAC
CCTAGCAGAACACATGGTCAGCGGTTCTTTTATTTCTTAACTTTATAATGCTGTAGATGT
TATGAAGAATTTTTAATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1523..1567, 1572..1631, 9442..9798, 13352..13537
1526..1567, 1572..1631, 9442..9798, 13352..13534
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved