Rattus_norvegicus Locus LOC682478
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus LOC682478
Rattus_norvegicus
LOC682478
12
SNORD102, SNORA27
2957..3027, 3269..3397
5201
ACAGCAATCTCATCAGCTCGGTCCCAACACTATACAGTCCAGAGTAAAGATCAGAGATC
TCCTGGCTGAACCAGCACATTGGGGGGACTATTGCATAAGTGCAACGAGGATCCCAATAG
CTATTATAAAAACGTCCGTCTCTCAAAGTCCTCGTCTATTATCCGGGCGTTTCAAATATC
CAATTCGGTTTTGCCAATAAATTATTAGGAATACTGCGTCCAATATGACTGACTAAATAA
ACACCCTTATCTATAGCCAGTGAGGCAGTCAGGAAGGGAAGTGAGGCTAACGGGGGTGAA
TATGATGAGAGTATTTTACACACACACACGCCTGCCTTAACCTATCATTTTGTACAGTTA
ATATACACTAATCAAGATAGGCGAGTGTCTGGACAGGTTCAAACTACAGATACAAGAGGA
AGGGAAACCAAAATGAGGATTTTTTTGAGACAGGGTCTCAATTATATGGCTCAGGACAGT
TTCGAAATTTAGGAAGATGTTCTTGCCTCTGCCTCCCGAAGGCTGGGATTATGAGCATGC
GCACCATGCATGGCTTTTCAAACTTTAACATATCAGTAGGTGCGTTGTTTAACAACTTCT
GGAGAAAAACTTGAAATACACACAGACAAGGTTTTTGTCCACACGTAACTGTTTGCCTAC
GCGACTCACGCTACGAACACTAAGACGCAGCGCACCACAGAACGTAGGACAAGACAGAGG
AGAGGCGGTCCCTCACGTCACATGACGCAGGGTAACGTCAGCACGCTACGGAAGTCGCGT
CTGGCTCTAAGCCCGCGAGGGCCCCATTCTGGGCTGTTTAACACGATGCCTGTGTGAGTT
TCTGTTGGCCTGCTGTCTTCAATCTGTGCAAAGGAGAGCATGCTCACGGAGTCTCTAGGT
TATCGGGGCGATGGAGGTTCTCTCGAAGATCCTCTCAGGCCGGCCGTTTCTCTTCAGGCG
GCGCCGTGGGCAGCCCGCGGGCCTTGTAAGAGCGCGCAGCCCCTCCCTCTTCCTTTCCGC
CGGGGCAGCCATCTTCCAGGTTGGTGTGCGCGTGGCTCTCTGGTCTTAGGCGCCGCACAC
GCTGCGTGAGGAGCCCAGGCCGCGGAGACTGCCTGTTAGGGTCGTGGGGAGACTGTCTGG
AGGCCACTCCCCTGTGCGGCGTGTGCTAGGGGGCTTCTATCCGGGGTAACTGGGCCTGGC
CCAGTCTTGGTTGCCGGGCATCGGCCTAACTCCAAACTTGAGCATGTGCTGTTGGGTTAG
GACTTACGATTCTGGGTCTTAACGATATCTGGGTGTGTACAATCCTGGAATTGGCTCGGG
CGAGAAGGGTGCCCGCCGGGTCAGCCTGGTAATGATATAGATGTAATGGGGATCCCACCT
CCGGATGCATGAAACACTTAGCAATTTGCAAATTTTGGCCCTTAGAAGACGAGAGTAGGG
AAGGAAGGTAACATTAAGGCTGCAAGGTCAGTTGGTTACCTAGTACACCATGCTTTGGGG
CTTCCCATGTTGGTTAGGAATGGCAGGTATTTCTGCCCTGTATGACTGGAGTAATCCAAC
CTTGTTGGTTCGTGGGAAAACAAGATCTGGCTCTAAGTATGTGTAGTTGGTAAGTTCTTA
GACGGTGCTAAATTAGCTGCCAATTGAGTAGTCTTAGTCTTCCTGTGCCAAAAATCTGCG
GGTTCTGTGTTATCTTTGCTGCCTATAGAACTAGTCTATTTTCAGGGAGGAATGTGAGCT
TAAGTGTTCTTTGTAGCAGAGAGCATTGGGGCTTGCATTAAATTTAGTGGGAATCTGGTT
TTTCTCTACATGCTTCCTAATACATTAGCAAGTGGAAGTGTGGAATTAAGAGTTTTGATA
GAAAACTAGGTTGGTAAAAATGAAACTAGCATCGAAGATCAGGCTGAGTTTGGTGGTCTC
CAAGTTATCCTGGAGTTGTAGGCTTCATTGTCTTGGCATTCTAGACCCTTTTACATGAAG
ATAATGAGTATGTTGGCTTAAGTTTTAATATACAGCCCTGCTGGTTCTAATGACGGAATT
TGGGCTCTTCTGCTAAGAGGAATAGTGGGCACCCATCTTTAATTCTAGTGCTTCATGAGG
TTGAGGGAGCCTGCTCTGTGTGACATCCCCCTGATAAATTTAAAAGGCAATGTAAACACT
GGAAGGAGGTTAATGGGACAGTGCTAACATTAAATTTGAATTGTTATTTCTGGTTTCAGT
AACTCGCCAAAATGACGAACACAAAAGGAAAGAGGAGGGGTACTCGGTATATGTTCTCTA
GACCTTTTAGGAAACATGGTAAGTGGCACGATCCTCTTTGATACTTATGATTGCATTTAT
CTGTGTCCCAGCTTGTTAAATGGTGGCTTGTTAGCAGCATTCGCTTGTGTTCTGCCATAA
GGAGAAGTGCATCTCATAGTTCATAATTGTCTGCAGGCTCACCCTGCAAAGAAGTGGCAT
GTCTTACTTTGACTGGCTTTGCTTGTAGGAAAAAATCGTCCTTTACAGTGTATATAACTA
CTAAACGTATACTTTGTGTTGAAAATTGGTACCCTCATGAAAGTGTACATGTCTTTGTTC
TTTTTTTCCTGTTGCAGGAGTCGTTCCTTTGGCCACATACATGCGAATCTACAAGAAGGG
TGATATTGTAGACATCAAGGTAAGTTAGGAAAAGGCACCACAAGTTAGGAATGCTGATGT
AATTACTTGAAGTTAATAGCACAGAATGGGGGAGGGGTAGAAGATACCATTAAAAATAAC
ATTAGAAATTGAGAGTGGTAGCTCATGTATTTAAGCCTAGATGGCTCTCAGGTACAAGGG
AAGGCAGGTTTCTTGTTTTAAAGCCAGGTGGGTCTATACAGTTAGACCCCATCTGAAGAC
AAAATTCATTATTAAAGGAAAACCCCAGTGAAGTCTACATTCTGTGATGGGTAGTTGAAT
ATATTCTGGTGCTCTGGAACTTAATGATGATTGTCTATTTGATTGCTTGATGCAATGTGA
AAACCACATTTCACCGGCTCTGAGAGTTCTTGAGTTGACCTTGAAAGGGGGCCTTGGTTA
GTTACAAGGATTTGGAAGGAGGGATTGCTGCAGTAATGCTTTGTCTGTTGACTAGGGAAT
GGGCACTGTTCAAAAAGGAATGCCCCATAAGTGTTACCATGGCAAAACCGGAAGAGTCTA
CAATGTCACCCAGCATGCCGTGGGCATCATTGTGAACAAGCAAGTTAAGTGAGTACAACA
CCTTTCTTTGTAACTAAGGAGTTGGTCAAACACCCCCTTTCACTTTGCCAATTGGACTTA
ATGTCTTCATTGGCCATTCAAGTGGGGCAAAGGAAATAACCTTTTAAAACTCAGGCAAAC
TTAAGTGTTTGTCTTGTAACCTGTCAGGGGAAACATTGACATTGGGGAGGGAGGATTCTG
TGAGTGTGGTTGGTACTGGTTTTTATAGCATTAAAACTTCATTACAAGCTTAGCCTACTG
GGGCTAAGTTACTATGATTTTTGGGCTTGTTTTCATCAGAAAAGCAACTAAGGTATCCTC
TACGGTCCTCTAACTTTGGGTGAGAATGATTGACATGTCACCATGTTGGTCTTAAGTGAA
GTGTTAGTGTACGTTAGTGTACATTTTTGCTGTCTTTCTGAATGAAGCACTTAGAATTAA
TTGGTCTTTGGTCATTCCAGAGGCAAGATTCTGGCCAAGAGGATCAATGTGCGGATTGAG
CACATCAAGCACTCAAAGAGCAGAGACAGCTTCCTGAAGCGGGTGAAGGAGAACGATCAG
AAGAAAAAGGAAGCCAAAGAGAAGGGCACCTGGGTTCAGCTGAAGCGCCAGGTGAGAGCC
GGCTTGGCGGTATTTATTAATGTTGAAGTTGAGGAATCTATAAGACTTTGCTCACTTTGT
TAATAAGTTTAAGAATTGAATGCCTGTTAATTCCAAAGGACTCTAAACTTTACCATAATT
CCTTTACCAGCCTGCGCCACCCAGAGAAGCCCACTTTGTGAGGACTAACGGAAAGGAGCC
TGAGCTGCTGGAGCCCATTCCATACGAATTCATGGCCTAATGTATACAAAGGAAATAAAG
AACCTGAACTGCAAAGTCTTCTCCTTAGGTTGAAGTGTGGTGTCTTCTCCCTGAAAGAAA
ATGTTAAAGCAAATTTTCATTGTCTTTGCTGTTCAGATTTTACTAATTGTTCTTCTAAAT
GATACTGCTTAGTGTGCAGAAAGTATACTCTTGAATAGAAAGTAGTCTAGAATATTTACA
GAATATGTACCCTAGTTCTGAATCACCAGGGGAAAGCTGAGAGAAATTAGTTTGTGGCCA
GGCATGGTGGCGCAGCTCTAAACTAGCACCTGGAGGCCGAGGCAGGCGGCTCTAGCCCTG
CAGGACTTGCATAGTAGCATGTGAGGGTCCCAAGGTGGAGTATCAGAGAGTGCGTGCCTG
GTGTGGTTCCCACATCAAAGACTGAATTCTCCAGAGCGGGCAAACAAAACCAAGCCAAGG
ACAGGGCTGGCCACAGACATTTTGTACTACTTGCTGAAAAAGCATTGATTGTTTTCCTGA
CCTAAAGAGCAAGGACAAATTGGCATTGGGCTCACCTTTCTGGTGTTCTTTCAGGCTGTA
TATCACAGGTGCATTTAATAAATGTCACCACAGAGTGTTAAAGATGGAGTCTAATTGGCT
GCCTTTCTGCTTCTCTGATGGCCATTTTGGCAGTGCTTAGGTTGTAACCCAGGATTGGAA
TTTGCAGTGCCAAACTGGTAGCTCCTTATACTCTGGCAGCTATACTGAAACTGGACAGTG
AAGGTAAGGGTGGGTTCTCTAGAAGTACTCTTATTACCTTAGTGAAACACACGGCTGCTA
ACATCCTGTTCTAGAACAGCATGTGAAGTCCCGTTGACGACCTTCATAGGCAGTGGAACT
AACATTCTTGCTACCTGTCTGTGTACACATGGTGTGAGTGTGGGTACACAAATGTCCAGT
ACACAAACCACAGAACTGCCTTAGTTGTCTCTGTGGATGCCCACCCCAGTCCCTGGTTGT
GATTCTGTTAGAATTACTTAAATGCACTGAAAAGCTTCAACCCTTTTATTAGGGATGGTT
TTTAAGAGCCACTTTTTCCCTAGTTCCCAAGGGTAGTGCCTTGGTCTTTTGGTATGTTTT
TCTTTTTCACTCACAGACACTATGGTCTGTTACATTTATGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1038, 2219..2297, 2597..2658, 3115..3227, 3680..3830, 3970..4201
2231..2297, 2597..2658, 3115..3227, 3680..3830, 3970..4056
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved