Rattus_norvegicus Locus Tbrg4
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tbrg4
Rattus_norvegicus
Tbrg4
14
SNORA5, SNORA5
4375..4511, 4883..5011
9906
TTATTTTTTATTTTTTACAAAATTAAGGCCAGCAAGATAACTTAGTGGGACCCTGTCGG
TGGTGGCCCATGCCTTTAGTCCTGCACTCTGGAGGCAGGAGAGGAATATCTGTGAGTTCA
AAGCCAGCCTGATCTACACAGTGAGACAACCCAGGCTGCATGGAGAAACCCTGTCTAGAA
CAGTTTAGGGATAAAGGCATTTGCCCTGAGTTTAATTCCCAGACCCCACATGATGGAAGA
AACAAATTTCCTCAAGTCTTCCTGTGATCTCCTCATGCACACATACACATTTGTCCCAGA
GATTTAGTCTCTACTTTCCTATCACAGGGATTACAAGGGAAATTCACCGCCCTACATTTT
GTAGTTTGTTTCTTTTGGGCAAAGCTATCTCCTCAGTCCTGCCGGTGGTGTGCTGAGACA
GGGTCTCTCTAGATGGCCCCGGCTGTCCTGCCACGGTATGTAGACCAAGCTAGCCTCGAC
AGTAGTACAGGCTAGCCCTCAGACCCCTACCTCCATTACTGAGATTACAGGAATTTATAG
ATGTGCCGTTGTATATGGTATGTTCTTTAGTTGTTTAATCTCGACAAACTGCTTGCATTT
CCACAAAGAACTTCAAATGGAGCTATAATTTGCCACTTGGCAACCCCTTCCAGCCCCAAC
TCACGCCCCTCCTACAGGACCTGTGAAAGGCCCAAGGGAATGGGGCAGGACGGACGGACA
TTAGAGTCGCTACCCAAACACCGCACAAGTAGGAGATTCTGGCCCGACGTACCCTGCCTT
CCAGAATTCACCTTCTCCCTTCCGTCTAAGTTTCCCACTACGAGCCTCTCACCAAGCTTC
CCAATACCGGAAGGCTGGGCTCAGCAAAGATGGCGCCTGCCCGGAAAGGGCGGAGGGCGT
GGCCTCCGTCCGAGAGCACTTGACTACCTAGCTTCCGGCGGCGCGCCAGTGACGTAGTGA
GCGCGCCGGGCCGCGTGGAGGCGGTACGGCTGATGGAGGTCAGTGAGGGTGATCGCTGCA
CCCGTCTGGCGTCATGGAGAGACTGGGTTTCTAAGCGTAGGTATCCGAGACGGGAAGGGT
GGCTAGGAAGGGCAACAGTTAGTAAGAACCGGCGGGGCTATTGTGGGGAGAGCCAGGAAA
GGGGCTTTTGACACTGCGACCCAAGGGCGCTGGCCGGTTGCAAATTCGTTTCCGGCCTGC
GATTGTGCACGCGCCCCTCGGCCCGCGTTGGACGAGGCCTAGCCGAGGAAGCTACGCTAC
CTGCAGTGACTCTTGGCGTCCCCTGCCAGTCGCTTTTCGTGTCTCTGCATTTTAGGTTTC
AGGGTTGATGCTTACTTAATCGCAGGTTTGGCTTAAATTGCTTTAAAGTTGTCTTGAAAA
TCGATAATGTTTGCCAGCGCTTCTTTACTGTCGGGTTCAGTAAATGATGGATATTGGGGT
TTGGGCAGATGCCCCCCTTCTGAGCCATATTTTGTTTCCTTTTAAGTATAATTAAGCCAA
TCTTTTTCCCACTGCAGTAATGTGCTCATGTAACAATAAAATAAGCTAGCCATACACCCG
GTTCCCGGAAGCAGGAAAAAATTTTAAGGCGCTTTCTGCTTTGGTTTAAGCAAAGTCCAA
GTAACTTGTCCCACCTGGTTCCTGTCTCTTCTTAGGGAACAAGACTGGCAGAATCGTTGA
AAGGAGCGTCATGTGGATATGTAGCATCTCGAAGAAGGTAACATTTTGCAGGACTTAGAA
AAAGGAAGTGTGTTTTGCCATACCCTGTGGTTGGCAGGGAACTGTGGGATAAAAGTGCAA
AGAGTAATTGAAATGGAGCCTGTACGGTAGGGATTGGGTTAAAATTGGCAAGATGGTGAC
TCTGGGTGGTGTTAGGGCTTGTTTGCCATCGATTTTTGCTTTTAAGGGTGCTGGGGTGTG
GCTCAGTCGGAATTGCTTGCCTAGCTCAAATGAAGACCTAGATTTGATCCTTAGCAGGGC
ATAAAACCAGGAGTGGTTGGATAGCTATAATCTTAGCACTCGGAGGTGGAGGCAAGAGGA
GTTAAAAGTTCAAGGTCATTCTTAGCTACATAAAGTAATTGTAGTCTTTTTTTTTTTTTT
TAACTAAGTAAATTTTTTTTTCTTTATTTGTATGTCTGTGTATGTGAGCCCAGAGAGAGT
CAGATCCCTGGAGCTGGAGTTACAGACAGTTGTGAGTCACTTGATGGGGTGCTAGGGACT
GAATTTTGGTTATCTGGAAGAACGGCAAATACAATTAACTGCTGAGCCATCTCTACCCCC
TCCCACCAGAGAGAGAGAATCCAAAAGTTAAGAAAGGGTGACTTTTTTCAGGTTGTTCAG
TGAGGCAGCCTACTGCATTTAGAGAGTCTCACTCCCGTGTCAGCAGTGTTCCATGTTTTC
CCAGAAGTTTCAGGAACGTGAGTTATAGATCCTAAGTTTCCCCAAATCATTCTGACTTAG
AATATTTAAGCCAGTCGTTTTTTGATCCTGGATACCTTTGAAATTAGAAACAAAATAACC
TAGTACTGTGTAAGGTGCATGTGCCCAGATTTGCATCATGGAAGCCTTGAGGAGGACCTG
GGGAGTTTGAAAGTGCAGCTAGGCCTGGTGCCTCCCAGGCCGAGTGCTGAGCGGTGATAC
CTGACCACTGTCCTGAAGCAGAAGTTCCTAGGACTTCTGCTTCAGAAAGTGCTCTTTCAC
ATGTAATGGGTGTTAAAACAGGAAAGACTGAGACCAGTTGTTTAAAATTGCCATATCTTG
GGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCGCAAGGCCCTGGGTTCG
GTCCCCAGCTCCGAAAAAAAAGAACCAAAAAAAAAAAATTGCCATATCTTCTAAGTTCAT
GTAATACTCCCTTTTCTTTTCAGGACTTTGGAATCACTTACTAGGAGTCTTAACCTCCCT
CCCTCTTCCCTGTGCCCACCATCATGGCAGTTCGCCTGATGAAGCAGTGCACATGCCTAC
TTAGAGAAGCCACCCGCCTAGTTCCTACCGTTGCTCCAGTTGGCCGACTGAGACTTGCTG
GGGTGGCCTGTAAGACTTTGACTTCCTCCGTCAGTTCCCCCTCTTCAGGTTCCTTGACGG
AGTTGTTGGGAAAAGAGCAGGTGTTTACTCCCTACCCAGAGCACCAAGAGGTGGACTACC
TCATTGAGAAAGCCACCAGGCCAGAGGAGCTGCTGGAACTGCTAGGTGGTGATCATAGTC
TGCACCACAATCATGCAGCCCTCATTCTCATCCGGCTGTCCTACCTGCTGTCTGAGAAGC
CAAAGGAAAAGGCCTTGCTTGTAGAGGATGCTCGCTTTCAGCAACTTGTCAGGCTAGTTG
ACAGTCAGGTGAGCAGTTACCGTGTACATGGGGAGAAAGTAGCCACTGATGACTGACAGC
TATAGACAGGGCTCCTAGCATTTGGGCTGGGGTAGGAGGTTGGTTTTTGAAGACAGAATT
TCTCTGTGTAACCCTGGCTGTCCTAGAACTCACTTTGTAGACCAGGCTGGCCACAAATTC
ACAGAAATCCACCTTCCTCTGCCTCCGGAGTGTTGAGATTGAAAGTGTACACTGCCATCC
CCGGTCCTTCTCTAGACATTTCTTATTCTAGTTTTCAAGAACATGGCTGTGCTTCCTATT
AGTCCTCTCAGGAGGCACTAGTGTGTCCAGGAGCCGCTAGCTGAGCCTCCAGGACCTCAG
ACGTGCTCAGCTAGCGGGTCCTGCGAGGCTAGGGTAGGAGGAGCTGCTAAATACCTGTGG
GGCTGGCTTCGTACTGACCTGTCCTCCTTGGTGCAGATAACTTCTGTCTGGCATGGGACC
CTCGTGAAGCTGCTGCGAAGTCTGTACACACTAGTGCTTCCTCAGGGCTCCAAGGAGCTG
CGGTCCGTGGAACAGGAAGTACGCTGGCGTCTGCGGAGGCTAAAGTATAAGCACTTGGTC
TTCCTGGCTGAGTCCTGTGCCCCCTTCATGAAAGAGCAGCACTCAAAGGAGCTGCTGGCT
GAGCTGCTAAGGCACCTGGAGAGGCGCTGGACAGAGATCAGCGACAGCCGCACATTGGTG
TCCATGATGACCATGGCAGGGCACTTGTCAGAGTCACTGATGAACCGCTTGGAAGACAAG
GTATGGGGCTGAGAACAGGCCTCCTGTGCACTTGGGGCCTGTTCCTTGGGTGAAGGGAAA
TGGGATTGGAGCCCTGAAAGCCGCTCGGTCTCAGGCATCTCGTGGGAAAGGGTGAGTGTG
GCGGGCAGCTTCTGAAGTTAACACAGGGGTCCTGGTTAGGCCCGAGCTGTCTCATGCACA
GCTTGGCTACTAGCTAGAACAGATGGCTCTGTCCACTCCTTCCATGTTACTCCGCTGCAG
TCAAGTCAAATTCAGTTCCTATCCTCTCATGATGGGAGCTGGCCCAAATGACTGCGACAG
CAAACTCTGCTGCTCATGGGCCCTGTGTCCCCAGCCCTTGGGACCTAGGGATAAGTTTGG
TTGCAGACATTGCACTCCAGGCCTAGGAGTCCCTGGGGCAGGCAAGAAGGCTGATTCTGT
GCAGCCGGGCCTGTGTTGAGTCAGCTCAGGCCTAGTTGCTGTCTCACAGGGGCTGCACTG
GATGGGACCCCTGCCCCCAGCTCATCCCAACCACCTCAGCTGATCCCTGCGCGGCTGTGG
TTGACAGTGCCTGGAGCTGGTGGAGCAGTTTGGCCCTGATGAGCTGCGGAAGGTGCTAAT
GACGCTGGCAGCCCAGAGCCGGCGGTCGGTGCCCTTGCTGCGGGCCATTTCCTACCACCT
GGTACAGAAGCCCTTCCCCATGACGAAAGGCATGCTCCTGGACCTGGCCTACGCCTATGG
TAAGAGCCCCGGCCACAGGCACTTGCAGCTGTGTCAAATTCAGTGCCTGTCCTAACGATG
GCACGCACTGGCCCAGAAGGCTGCCATAGAAACTGTGACTGCTGAGCCCTGTCCCCATGC
CAGGTTCAGGATGAATTTAGTCACAGACATCAAGCCCTTAGATATGAAGTCGAGGGTGGG
GCAGAGCGGTGGGTGTGGGACACTGACCTCCCCCATTGATGTCTGGTGCCTGCTCCACCC
CACAGGTAAGCTCAGTTTCCACCAAACCCAAGTGGCCCAGCGCCTCGCTGCTGACCTCCT
GCCCTTCATTCCCAGCATGACGCCTGGAGAGGTGGCCCGCTGCGCCAAGTCCTTTGCCTT
CCTCAAGTGGCTCAACCTGCCTTTGTTTGAAGCCTTTACTCAGGTGAGTTAGGACCTCAG
GGTTATCTGTAGAGGCCTCCGTTGGGAACTGCTGCTTTATTATGGACGCAAAGCCAAGCT
GAAATGCTCATTTGTGGGCTGTAAATAGAGATTTCTCTCTTACTTTGATTTGGAGGGCAA
TGTCTAATGGTAAGGGAAATGTCTGAGAGCAGTTGCCTGTTTGGTTCCTGAGTGTCCTGT
TTCCATTCACCTTGGGGCAGCCATGACTATACACAGGAAGGGAAGGCACCTTTGCGGTTT
TTTTGTTTGTTTATTTGTTTTTGTTATTCTGTTCGTTTATATCTCAAATGATATCCCACT
TCCCGGTTACCCCTCCACAACCCCCATATCCACCCTCTCCTCACTTCCCTTTGCCCCTAT
AAAGCTGTTCCCCTACCTACCCTCTCCTACCCCACCACTCCGTCATCCCCCTATGCTGGG
ACATCAGACCTCCACAGGACCAAGGGCTGCCCATTGCTGTCAGGCAAGGCCATCCTCTGC
TGCATATGTATCCAGAGTCATGGGTCCTCCCTGTACACTCCTTGGTTGGTGGTCTAGTCT
TTGGGAGGACTGGGGGGTCCAGCTGGCCAATGTTCTTTCTATGGGGTTGCAATCCCCCTC
TGCTTTTCCAGTCCTTCTGCCAGCTCCCCCATGGGATCCCTGAGCTCAGTCTGATGGTTG
GCTCTGAGCATCCACATCTGCCTTGGTCAGTTCTGGACCTCCCAAGGAGCAGCCATAGCA
AGTGGGGAGACACCCCTGTATTTCCGACTACTGACCACTCTGAGTAGAATTGTATGAGTA
CATGATGCCTGTGTGCGCATGTCCTGTGGCCAGCAGACAATTTCTAAAGCCACTGTCAGG
GAGTTGAACTCTGAAGCTGCTACTGGGTGAACAGTTTTGAGCTCTAGACAGGGAGAAAAT
GGCTGCTGGGCCCTTACTTTGTCCCTCTAATGTCTTAGCACCTCCTGAACAGCGCTCAGG
ATGTCTCCCTGTCCCATCTGTGCAGCGTTCTTCTTGCCTTTGCCCGGCTGAACTTTCATC
CTGAACAAGAGGATCAGTTTTTCAACTTGGTACGAGCACCAAACACTGCTTCTGACACAC
TGACTTAGGGCTCGGGCTACTGCCTAGAGTGGGGGTTGGGAGTGGGCACAACATTTGACT
TGGAGAAATAGGCAGCATCCCAGAGACCACTGGAGAACATGCAAACTACTGGGACATTGC
CTGGGGTGATTTTGAGGGCAGCCAGCCAGGGGCAGCAGCTATGTGGACACCTAGGTGACC
TGCCCAGACATTCTTCCTTCATCACAGTGCCCACTAGGGACTATCACGAGGGATTTGAGA
CCTTGGGTCCCTGCTCGTGGGCAGGGTGTGAGTGAAATAGCTAAACAAACAGCTCCGGGC
TTGAGGAAGATTCCTATACCTCAGCCTGGGTTGGTGTGGGCTTTACCAAGTCAGGACTTT
GGTCTTGCTTTCCAGTAGCTGTCCCTCGCTCCAGTATGGCAGGTCAAGAACACAGGTTGG
CTTCAGACTTTCCTAGGGTGTTGTGGTCGCTGGCTGACCCTGCTTTCTTCTCTGTGCTCC
TTGCTCAGGTGCATGAGAAGCTGGACTCCGTGCTGGGGAGCCTGGAGCCAGCCCTGCAGG
TGGACCTGGTGTGGGCCCTGTGTGTGCTACAGCAAGTGCAGGTAGCAGAGCTGCAAACAG
TTCTCCATCCTGGGCTCCACACACGCTTTCTAGGTGAGACTGCTCTCCTGCACACAGCAT
GGGCATGCACTCCCATGGAACATGGAGGCCTTCTGCTCTACCAGCCAGGGAAGACACTAG
AGCAGAGACAGAGGGCAGAGCACACAAAGCACAGCCTCGTGATTTGTGATTTTTTTTTTT
CCGACCACTCCCTGCAGTTGGCCTACAAGCTTAACTGTGGGACACCAGCCTAAGACGGGG
TGGGAGCTCCCAATGCTACTCTATGTCTTGTGGTCCCCCTTTCTGTACCCAGTACTGTAC
ATCAGCCTACCTTCTCTCCTCCCCCAGAGAGCAAGTCTCCAAAGGACCAGAGTACCTTCC
AGAAATTGGTCCACATCAACAGCACTGCCCTGCTGGAGTACCCTGAATATAAAGGCCCTT
TCCTGCCAGCCTCAGCTGTAGCCCCCAGTCCCTCACCCTCCAACAAGAAGATGACACCCC
TACAGAAGGAGCTGCAAGACGCACTGAAGGCACTGCTGGGGAACAATGACACAGGCAGCC
TGGAGGTGGCCACACAGTATGGCTGGGTGCTGGGTAAGGGCTCCCTTCCGCTGGGAGAGG
GTCTAGTCTAACAGGCCCTTTGTAACCCTGCATGGTATAGCAAGAAGCAGCACAGAGAAC
AGCGGGTACCTCCCTCTAATGCCTGCTTGTGGGTACACTGTGGGGTGTCTGAGGCCTCAC
CTCCAGGCTCATCCTGTTCCCCTGCAGATGCAGAGGTGCTGCTGGATGCTGAGGGCCACT
TCCTGCCCCTGAGAGATTTTGTTGCTCCTCACCTTGCCCAGCCAGTTGGGAACCAGCCAC
TACCCCCGGGAGCTAAAAGGTATGTGGCCAGAGATCCCTGGTCATGCCCTCGGAAGGGAT
TCAGCAGCACTGCTGTTCTTAAATGCCTTTTAACTCCTCGGCCTTAGTCCGGGAACGCGC
TTTATAAGTACCCTTGTCTCCTGCTAGAATCGCTTTCCTACGCTGGGAGTTCCCCAACTT
CAACAGCAGAAGCAAGGACTTGTTGGGGCGTTTTGTCCTGGCCCGTCGACATGTGCTGGC
TGCAGGCTTCCTAGTGGTGGATGTGAGTACCTGGAGAACAAGGGTCACTGCAGAGGGAGA
AGCCCCTAGAGCTAGAAGGATATGGGTGGATACTCAGCTCTCAGGCCTAAGCTAGGCACC
TCTCCCCTACCCCACCCCACTCTACGCACACAAAAGCTTAGCTTGCCTCCTGTGAGCACA
TCACACTGAAAGTTCAGTACAGCCACGGGATCCCTTGCTCTGCCATTAGAGCTAGGGCTT
GGACCTGTAACTGTGCTGCTGTGTGGCTATGTGTGGCTTCAGATCACATGTGCCGTGTTG
AGTCTCCTGCAAAGAGAAACTTCATAGCTTTGCCACATTTTCTTCAGTAGCCTTGCTGGG
ACCTATCTGGTTTGCAATCTCTTTGCCCTGCCAGCCAGCATCTTTCCATGTGCATAGCCT
TACACTCTGCACTCTTCCTGAGGACTTTGAGGCCAAGACCTGGGTGTTTAAAGCTGTCAG
TCAACAGCTCTGTCAGAGTGGGAGGGGCCCCTGGACATGTAAAGGCGGGAAAGGATTCCA
CAGTCCATGTGACTGTCTGTACTACCTTCTTCCAGGTCCCATATTATGAGTGGCTGGATT
TGAAGTCTGAATGGCAGAAAACCGCCTACCTCAAGGACAAGATGCGAAAAGCAGTGGCTG
AGGAGCTGGCCAAGTGACCTTTCCCATCTGTTCAGACTGCATCTCAAGACCTGAGGGCTC
AGGGACCCAGACCCAGCAGTGAGTGCTGGGCCGGCCAGAGTTGTCACCCATCAGCGAGAT
GAACTCTCTGTAGGACCTTGGCCACAGTAGGGGGTGCTCAGCAGCTCCCAGGGCAGGCGG
TCCTAATAAATCACTTGTTTTGGTGGATGCCGGGTCTCTTCCCAGGCTCTGTAGTATCTG
TCTCCTCGTTCCCTTATTTTGGACACACACACACACACACACACACACACACACACACAC
ACACACACACACCTCCACTTCCCTGGCTCTCCAGGATTCTACCGAGTGTACTCTCCTCCT
CCACTTCCCCAATAATAGGCTGGTGTGGCACAGCAGAGGGGGGACTTGAGAGACAGAAAA
CCTAGGCCTTAAATGGGTAGGGTCCTAGACACTTGGGCTTCCCAGGAAGTGTGTGTACTT
GAGTGTATAGCAGAGTTGCAGTTACTGTCCTGCAAGGTTCCCTCCCTTACCATGTCACTA
AGAGAGTATCTGAAGGGAACAGGTGCTGTGAAGGCATTTGGAAGACCCTAGTTCTGGGAC
AAGAGTAAAGTCCACTTGGCTGAAAACAAGATCCTTGGCCAGACTGTCACTCTCAGGACT
ACCACAGCCTACTCCGAGACCGCCCTTCCAGTGGAGCCCTGGGTCCTCTGCAGCTGTGGC
AACAGGATGTCTGCCTTCTATCCTCTGCAGGAGATGCTTATAAGCTTGCCCGAAGGGGAG
TCTTACAACAAAGAGGGTTCTTACCTTCCCAAAAAGAGGGTTCTTCCTCCCAAAGCACCA
CTCCAAGTCCTCTGTGTGACCTAGTACTTCTCTTGTCCTGCACAGACTGTTGGTTTCTAC
AGAGGTGAAGGAAAAGCAGAAAAACAGCTAGAACTGGCTTACAGGAAGGAACAGCTGGCC
ACAGCTTGTCTAGGTTGAGGTGGGGTGGGTGGGTAGTGCTGAAAAGCCAGTTGAAGTCTG
GTGTATAAGGAAATAAAAATCTGCTGCTCGCCATGTGGGCCACTGGCTTTTCTTTTGAGC
TAACTGGAGATCTCCAGTGGTAGGACTGCTGCAAAGCCATGCTGGTGCCTACATCAGAAG
TCAGCTGTGAGATACTGCTGTCACCACAGGATCCATAGGGCAGCTGGCCCATATTAACTG
CCTATAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 1655..1716, 2903..3367, 3816..4139, 4687..4858, 5105..5262, 6218..6328, 6848..6992, 7287..7532, 7707..7818, 7947..8061, 8615..8906
2963..3367, 3816..4139, 4687..4858, 5105..5262, 6218..6328, 6848..6992, 7287..7532, 7707..7818, 7947..8061, 8615..8713
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved