Rattus_norvegicus Locus Tacc3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tacc3
Rattus_norvegicus
Tacc3
14
SNORA18
10003..10131
16405
CAACCACCGACCCGCAAACAGGAGGCTCACCCAACGGCAGCAGTGAGTGGCACAGTAGT
GTGGCGGAAGTACGACGAAGGTGGTAAGGCACGAAGGCGGCGTCCTCGCTGCCCAGCCAG
CCCGACAACAGATTCTGCACTGTGAGCCCGGCCGAGTAGAACTCGTTGGGCGTGAACACG
AAGCACACTGCGAAGACCAGGTAGGCCAACGTGAAGGTCACCTCAGGGCTGTCCATCCCG
CCGCCGCTCACCGGGCCAGGCAGGGGTAGCAGCTTCTACTTCTGGACAGTTGGTAGGTTG
CCGCAGCCACCGCCAGACCGGCCCAAAGGCACTCTGGGAAACAGAGTCCTAGTCAGGCTA
GCCGTGAGGCATTCTGGGAGACTGAGAGACTCCTGTCAAGACACCCGCAAAGCATTCTAG
GAAATGGAGTCCCTTCGCAGGCTACCCGCGGGGCCCTGTGGGAGACTATTTTCCTATCAG
GTAACCCGAAGGGCATCCTGGGAGACAGAGTCTCGTGAGGCCGCACCCGGCGTTCTGAAT
GGGTAATTCTCGGAATCCTGTGCGGATCCACAAGTTGTGAGCCACCCAGACACCCTGGTA
TGGGTTTAGCTTCTTCCTTACAAACAGTTCGGAGGAGACACTGCAGCTGGTTCCATTTAA
CAGCTGAGAAAAGCCAAGCCAGGGCGAACTGCTCTCTAACCGCATTCGCGGCCGACTCTG
AGATTGTCTGTCCCGTGGTGGATCTCACAGTCACTAGCTACCAACAAGCCCACTGGGCCC
GAGATGCTAGACGACAATTCCCATATGCCCCCACGCTCCCACTGTGCCCTCAATCCCGGA
AGCGGAACTGCCTGCGCATGAAGGGCGGGACTGGTATGGCCTGCTATTGGCTGCCGCCAG
CTATACAGAGGCCTCTTCTGCAGCGCGCTGATTGGCTGCAGAACGTCAACTCTCGGTATT
TGAATCTGGGGCGGGCGTAGCGGACGACGTTCACGGACCGAGAGAGCAGAGCTTGTTCGG
ATTCCTTTGGCTCGGTTTCTCTAGCTCGTTTTTCTGTTGCGGAGCAAATACGGCTCTCCT
CCCTTGCGGTTGGCGTCCGCGCGGGCCCAGGGCTCCGCAGCCGTAGGCAGGAAAGGTAAA
CGGCGCTTTCTTACTTCCCTTGGGCGCGGGGTGGGGATCAGCCCCTCGGAACTGGATTCT
TCAAGCTGAGTTGCTGTTCTTTTGTTCCGCAGCTTCGCTCCTTTGTTAAGCAACCACCCC
TCATCCCTCTTTTCTGAGCTAAGGGATGGGCCTAGCCTCCTAGACAGGACTGGAACCGGC
GTACTGGGCATTGCAGGCCGGCCTGCCCGTGGTCTCGGTCTGACCTAGTTGATGTCGGTC
CTCCAAAGAGGCCGCGCCAGGTTCCTGTTTAGTCGAGGGTCTCCTGTATGAAACTCTCGT
CCCAGAGCCAGGACATCTTTCGCCCCAAGTCTCTTTCTCCACCTTTTCTGCGAAACTGTG
CTATCTGTCTACTGTCTTCCTGAACCAACTCTCACAGGGGATATTTCTTGTTCCTGGGTC
TGTGCCTCTAAGTCCTGCTTCTTTTTTTTTTTTTAAAGATTTATTTATTACTTTATGTAT
ATGAGTACACTGTAGCTATCTTCAGACACAACAGAAGAGGGCATCAAATCCCATTACAGA
TGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTC
AGTGCTCTTATCCGCTGAGCCATCTCTCCAGCCCTAAGTCCTGCTTCTGTACGGCCTGGC
CACAACCTCAGAATAAATGGCTTCTCTTGGAAACGCTTTCTTCCAGATGGTCGTGATAAG
TTTCTCTTCTCTATGGCATCCTTCTCTGAACAGAGTCCTTTAAGGCTAAGGCCTTTTTCC
ACAACTCTAGCTACCAGGATGACCTCATGCCTATACCTATACAATTTATTCAGAAATGCA
TGTTTCCAGGCATTGATTGTACACACCTGCCAACTCATTGTTCCAGGTGGGATGTGTTTC
ATCTTCCTCCTTCAACCCCCAAACTCCACCTGGGAGACCATTAGTCAACTTCAGTTTTAT
CATCTCCCGTAGGTGCCTTGACCCCATATTTGATCTCAGAACGACAGGTGCAGCAGCAGC
AACAAAACTTCATATGCTCCCTGTCCCACCCCATAGTCACTCCTGCACCAAGAAGACATC
AGAACCCAAACCTAGCTTGTCAAGTTTCGTCCCCAGGAACTCCCTCCAGGAGCTGGGGAC
ATGGCTTAGACAGTAACGTGCTTGCCAAACAAGCCTGAGGACTTGACTTTGGATCCTCAT
TACCCACCTAGAAATTGGGTGGTATAGCCTCACCTGTCTGCAATCCCAGCACTGGGCAGG
CCGACTGGAGGATCCCTGGAGCCCACTGGCCACAGAGTCTTGCTGATTTAGTAAGCTCCA
GGTTCAGTTAGTCTAACAAGGTGGAGGACAACTGAAGAGAACACCTCATGCCAACCTTTG
ACCTCCCCTTTACAAGCGCCAACACTCCCCACCCCACCCCCCAAAATCCAATCCCAAACA
AAGGCCGAGCCAACTGTTCTTCTGCCTTCTTGCCTGAAAGACTTCATCTAATGCCGTACA
GCCCAGAGGCCGATGCTTGCAAATCCCACAGCCATTGCAGTGCCCTTTCCCCAAGCTTTC
TGGCCAAAAAGCCTAAAACTTGCTCTTGATTTGTTTCCCCTTTATCTCATGACCTGTGCA
CCTTGCTGAGCAACTTAGTCTAATTCTCTTTTTGCTAAGGGAACCTCTGGTTCTTTCCCT
CTCCCATTTTTCCTCAAGGGCTCCTAAAGGAAAGTCAGCAATAGCTTCTCTTTTGATGCC
CTCCCTCCCCAGTGCCTCTCCTTACTCCTCAACCTGAGCTCCCAAGGTTTTGCCCCCAAG
AATCCATGGTTCTCTGCCTCTGCTTCCCAAGTGCCGAGATGAAAGGTGCTCTCCTCTACC
ACCCTGCTTCTGTAGTCGTCTTCAAACCAAAATTGTGTTCCTCTGTTCTTGCCTTAAGTG
TAATACATTAATGGGAGTCATTCTGAACTCCTGGTTCTCTTTCCTTCCCTGCCTGAACCC
TTTTAGCAATTTAGCACAAGGGAGCAGTGTCTCCAATGCTGTAGGCANGACTCTAGAGTC
CTCTGGAAGACCTCATCTACCTTATGTATTACCTATCCGTTTAAAAAGTACTATTTCGGG
GGCTGGAGAGATGGCTCAGTGGTTAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTC
AATTCCCAGCAACCACATGGTGGCTCACAGCCATCTGTAATGAGATCTGATGCCCTCTTC
TGGTGTGTCCGAAGATAGTGAGAGTGTCATATACATTAAATAAATAAATCTTNNAAAAAA
AAAAAAAAAAANNNNNAGCTTCGACTCCTCTTCCTGAGGACCCAGGTTCTGTTTCCAGCA
CTCCTGGGGTGACTCACAACTGTCTGTTAATTCCAATTCCAGGAGATTGGCCTCCTCTGG
CCTCTGCAGGTACCACACACATGGTGCAGGGACATACATGTAGGCCAAACATTCATACAC
ATAAAACCAATACAATTTTTTTTCCCCTTTTTTTCGGAGCTGGGGACCGAACCCAGGGCC
TTGCACTTGCTAGGCAAGTGCTCTACCACTGAGCTAAATCCCCAACCCCAAACCAATACA
ATTTTAAAGTTTAATTTTTACACAAGTTACCAAAGCACTACTCAAATGATCATCATACAA
CAAACACATCAATAAAATGTGCTAAGAGACTACTCAGGAAGATAATNNNNNATATACATG
AGTGAGCCTNCTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNACCTGTCCGGAAGTAGGATACCTCCCTGCCATACCTGTGGGGGATTCCTGTACATAC
ACTGCAGCATCATTGACCTCCCAGTGACTACAACATACTGTTTTCCCAGGATGAGTCTGC
ATATCTTAACTGACGAAAATGTCCCCAACGAGAAGAGTTCAGAAAGCCGTGACTTCCTGT
TTTCAGCACCAGAACTTACCGGAAGATCCTCTGTTCTTCGCCTGTCACAGAAAGAAAATG
TACCTCCCAAGAACCAGGCTAAAGCCGCAAAGGTAAGTGTGGGCTGTAATGCATGTCCTC
AGCGGGTACCTGGGATTGACTCTCTGAGGACCCTCACGGCAGCACTCGGGCTCACTTGTG
AGGGCTTGTGTCACAGCATGTGCACTTTCCACCGTTCACTAGGTGACTTTTCAGACACCT
CTTCGGGATCCACAGACACACAGGATCTTAAGTCCTAATATGACCAGCAAACTTGAGGCT
CCTTTTGCTCTGGATGACAGTGTTGGATTACAAAATGACCACTGTGTCTTCTTACAGAAA
GAGAAGTAAGTGTTGATGCCTTTTAACTCTTCTGCAGTTCTGTCCTCTCTGAGGGTTGTT
GCCAAAGCTTTCGGTCCTGTCCTATCTAGACGTCTTCTTCTCTTGAGCACTGCCCTTAAA
TGGAGTATCTGGCACAGTTGTTAGTTGAGAGTTAGTCATCAGATAATTGGACTGTTTTAA
CTCCATCCCTCACTCTTGCTGGGTCCCTAACCAGCCCCAGTGAGCCCATATAAAAAACAC
ACAATCCAGTTATAAGCTAAGAGCCTAGATTGTGCAGATCTGTCACTGTACAAACTTGTT
CCCAGCTATGAGACTCTTGCTACTTGCCGTTGGTTCTGCTTCACTGTAGCTTCCACCTCC
TCTCCTTCCCCCCTCGTCCTCTTCTCCCCTCTCTCTATCTGTCCCCACTCTGAAACCTCC
AGTCCTATCTTTCCCCTCCACTGCCCGATCAAGGCTCTAGTCTTTATTGACCAGTTAAAA
TGGGGAGAAGATTCACATGAGATCACCAGAGTACATGATAGGTTGCTTGTCGGGGACAGC
CCCTCTTGAGGAAGCAGATTTGACATCAGAATATAAACAGCATCAGGACAACCCACAAAA
CCTACCACCCATTCTTTATTTCTATAACTTGATGGAATAATTAGATCTTATTTCCAAAAA
AGATTATTTGTAGTTTCCTTCCTAGTGAGTTCTGTTCATCTCTCCCTGCTGCTTAAAATT
ATCATTTGGCTTCCCGTGCTCAAAACTTGGAAAGGGCAGATAGACTGATAAACAGAGAAA
TTACCATAGGATTGATTAATTGGGGCCTCAGAGTGGCACCCTTGGTATTGTTGGCTATAC
AAACATGAGGACTTGAGTTTAATCCTCACTATCTAGATCAAAAAAGCTAGCAGGGTGCAC
ATCTAATTCCAGCCCTAGTTAGGTGGAGATAGAATCTGTCAAGCTTTCTAGCCAACTCTG
TGCTCCAAGATACAAAGTAAAGAATGGTTGAGCAAGATATCAAGTGTTGACTTCCGGCTT
CTTATACATTTACATGCGCACATACACAGTGGTCATACACCATGCATGTACTGTGTGCAT
GTGTACCCACACATCTGCATGCAAATATACACAAAGGAGGAACTATTAAGAATGGTGTAG
CTAAAAGGACAGGGGAAAGCTTCATCCATAGGTACATTAGACATTTCCTTGGTGGAAGTC
AGACAAGCAGATGCTGACCTTTTACCTAGAGAGGAGGGCCTTGGAGTTAGAACTTCACCA
ATCTGGCACCAAGAGCACATCTTTAGGGCTGGAAATTCTTTCCAGAGGACTTGAGTTCAA
TTCCCAGCTCCCACATGGCAGCTCACAACTGATCTCCAATTCCGGTTCCTGGGGATCTAA
CACCCTCACACAGACATGAATACAGGAAGGACACCAATGAATGTTAAGCAGAAAATTATT
AAAAACACATCCAGAGCAGGAAGGGACTTTGGTATGGGTTTGTTCCAGTTTTACTAATTC
AGCTGTTGAAGCTTTTTTCTAATTTACAAGAGAGGTGGGGTGGGGGGAGGCATGAGAAAT
AAAGCATCACTCCTATGCTCTTTAATGTTACAACTCTCTGGGCTCTGTGCTATCTCTGTC
CTATCAAAACACCCCCAAGTCTGTTTCTTTTTTAGGGTGTCCTTGTTACTTTACAACTTC
ATTTTGGTTTTGTTTTTTTTTGGGGGGGGGGTTCTTTTGTTTTTTTTTTACTGAAATTCA
GTCCAGTGAGATTGAGTGAGATTGGTGTCAAACACTGTTGGTCTATAACAACCTCAGAAA
CACAGAGCCAGCAGTTGGCGCTTGGCTGCTGTAAATCCAGCCTACTTTGAGACCAAGAAG
TTGTCTCTTCCTGTGCTGCTGGAAGGGCAGCTCTGAGTGGTAGCAGTTATGTCACTTGTA
AGCTTATCCTTGGGGCCTAGGCATGCATGGACCATATTGCCATTCACCAACTTAAAACAC
TCTGCCGATCCTGTGTCCAAAGAAGCAGGCTGCCCCGGTGGTAGCTCTTCGAGTGAGTTT
GGTAGAGGGTGGGGGGATGACCAGAGCGATTGGATAGGTATTTGATTCTTCAGGGCTTAT
TTCTAGTATATCTGAGGTCCTAGCCTAGGAGGTGGTATAGCAATCTTGCAGTTCTTATCT
TATGAAAGAATGGATTCTATCGAGAGAGAAGAGACATGGGCAGTTTAAATAGTTTACAAA
AGCAGTTTAGTAGTAAAGTGGAACACTGGAGACCTGACTGATAAGGCCTCCGCCTATCCC
AAGATTGTAGGCACCCGAGCCAGCAGCAGGCACTGACACCCCTTCTAGTTTGTGTTCATC
TAGTCCTAAGAACTCAATCCCAACTGGCCCTCTTGAGACAGATGGGGCCACAGACCCGAG
TACTCAGGAAGCCGCCACTAGCCAAATGGTCATCCATTCAAGTCATGATTCTATGAGTCT
AGAATTTGACTTCTCTGATGGTACAACCAGCACAAAGGTATCTTCACCAAGGAGACTGGC
AGAGAGACCTGGCCTCCAGCCTCTCCTGAAGAAATCAGAGACCAGCCAGGAGCAGTGCCC
CAAAGAAACAGAAGAAAGAGATGGGACCAGAGAGAGAAATGAATGTCCCCAGCCTACACC
CTGGGGCTCTTATCACCTTAACTGGGAGAAGTTGGATGACCCAAACTTCAACCCATTTGG
AAGTGACTCCAAGTATAATGGCCAAAAGGCTAAGCTCCCTGAAAGTCCCAAGAACAGGTT
GTCCTTGCCTGTGGCTGAGCAGCTGAGTGCTGGGCCTACAGACGTGGAGTCTTCTCCAAG
CCAGTAAGTAGGAAAGGGGAACGTTGTCATCTCAGGGCAGCTTATTTAATGTGTGTGTGA
TCTGGGGCCTAAATGCCACCTCTTTATGTAGCCAACATACTACTATCCTTTTTAGTTCAA
GACAAACAGGTCTTGGGTTAGTCCAAAAGAGGCACAGCTCCAGAGTCCCTATCCCCAGAC
GCTGGGAGAGGCGCTCCAGAGTTCTTACAGCGTACGTGCAGCATCACTAGCAAATCAGTG
CGGGTAGCTCCCAGAAATCCCAGCACCCTGGCTGAGAAGTCAGATCAAGAGTTCTCTATG
GGGTTGGGGTTTTAGCTCAGTGGTAGAGCGCTTGCCTAGCAAGCGCAAGGCCCTGGGTTC
AGTCCCCAGCTCCGGAAAAAAGAAAAAAAAAAAAAAAAGAGGTTCTCTATGTGGTAAGAA
CATCTCTTTTATAAGAAAGCATAGGCTACCAATCAGGTGAAAACTGGTTGGTACCACAAG
CCACTGTCCTTGGGTACTCCAGAGGCAGCTGTGACCTGAAACTAGCTTTCCAGCAGCCAG
ATAAACTGTTACCTCCAGAGAAACCTCCTCATAATTTTCATGTACTTTTTAGCATGAGCA
GTTTTCACGTGATCAGCGTAGGAGGGAGGTAAATAATAGTTCAGTGCAGGATCAGGAACA
TGGGGAAGGCCCAGCTCTGATGACCCTGTCTCTCCAGCCAGCTGCCGGTAGCCCCAGTGG
ACGATGTACCTGTGGTTCAGATGGCAGCCGAGATCCTGAAAGCAGAGGACGAGTTACAGG
TATGTGTGCTGTCAACACTATTATACACTGCATAGCAGAGGAACAGCATTGAGGTACAGT
GGTGCATACTTTTAATCCCAGCACATGGAGCCCAGAGGCAGGCAGATTCTGAGTTCTAGG
CCAGCCCAGTCAACATAGTGAGTTCCAGGACAAGCAGGGCTTCAGAGTGAGACCTTGTCT
CAGAAAAATAACATAGTAGAAGAGGCTACCAGCTCTCTTCTATGAACAGGGTGGGATACA
ACACTATCTCCCATCCCCTAAAGCTGCCTCCCTGTCTGGGTTTACTTTAAGGAAAGAGTG
AGCGGGGCTCTCCCTCACCCAGAACCTCACTACAAGGTGATGCTGACTTTCTCTCCAGGA
GGGAATTTTGAATTCCTTGAGCCCTTCAGCTTTCACAAGTTTTCCAGACGGTGAGCTGGT
AACCCCTCCAATCGAGCCGATGCCGGAGCCTTCCCCTCAGGGGCCAGAGCCTCTCTTGGA
CAGCGAGCCAGTGACCCCTCCAGTCAAGCCAGTGCTGGAACCTACTCCTCAGGGGCCAGA
GCCTCTCTTGGACAGTGAGCCGGTGACCCCTCCAGTCAAGCCAGTACTGGAACCTACCCC
TCAGGGATCAGAGCCTCTCTTGGACAGTGAGCCAGTGACCCTTCCTGTTGAACCAGTGCC
AGAGTCTTCCCATCAGGGACCAGAACCTCTCTTGGACAGTGAGCCAGTGACCCTTCCTGT
TGAACCAGTGCCAGAGTCTTCCCATCAGGGACCAGAACCTCTCTTGGACCCAAAGGAAGA
GAGCTTTAGAGACCCAGCAGAAGGTATGTGGCATAAATGCATTTTTAAAAGTGATAATCT
TTTCTCTGTACTGGCTAGCTCTCAAATAAATGAAACAGACTATAAGATTTATAAGCTTTA
TAGTACAGTAGCTGAGCAGTTATTAATCTGTTTTATTACTCTAAACTAATCTGGCTACTT
CCCAGCCAAAACACTTGCATTTTAGTATCAGTCTGGCCCCTTGGTGTCTCTTTTTCGCCT
GTGGAATCTAGTCCCTCTTTCACTCCCTCCCCCAATCCTCGGTCTTGGAAGTTCAACCCT
ATTAGCCGATCAGCTTTTATTGACAAGTCTGAGAGTAAGTGGGGAGCAATATTTACACAA
AATTCAGGCAGGAGATACTTAAAATGATCATTACAGTGTCTTGTCCAGATTGCAGCCAAA
TATGGGGGGGGGAGAGGGAGGTTCGTCAGCACTTGAATAAAGGATCAAGGATAATCTTTA
CAGATTACAATAGCATTATGCCTACACTGTGGCCCCAAGGTGTCACCATAGGTTTCTCTG
AAAGTCCCTGTGGACACTTACGTACCTGCAGGTTCCAGGCAGTTATTCCACAGGCTTTTC
CCTGACAAACTTTTGCTCCCAGCCAAGCATGGTGACACCTTTAATCCCAGCATTGGGTAG
GCAGATGCAGAAGGATCTCTTGAGTTTGGGGCCAGCCTGGTCTACAAAGCCAATTCCAAG
CCCCGGCTGTCACACAGAGAAACCCTGTCTCTAGAAGGGGAAGGTGGGAGAATCAGCTTT
TGGTCCTTAAAAGATGGGGCAGTGTCTTAGGGTTGCTATTGCTGTGATGAAACACTATGG
CCAGCCTGCTAGTGGTGACACAGGCTTTAATTCCAGCACAGGTAGGCAGATCTCTGTGAG
TTCAAGGCCAGTCTGGTCTACACAGTGAGTTCCAGACAGCCAGGGTTTCACAAAGAAATT
CTGTCTCAAAAAAACACAAAAAGAAATTCAGGGTCCTCTTGAGAGTTCAAGGCCAGCCAG
ACTAGAGAGCCAGTCAGTCCCCAGAATGAAAAAGTCGGGTCTTTATCCATGGATTTCACA
TCTTCTCATTCAGTCAACGTTGGGTAGAATTTTTAAGTGTCTTTATTGAATACGAAAAGG
GAAAGAAAGTACTTTTTCTTCCTGTATAAAATTGGGGGCTCCTTTTGAGGTCTATCCCGA
TGGGGCTTCTCTGGTAGCCACACATCGTTGGAAACGCCTCGTATAGTAACTTGTGGTTTT
ACTTGACTCATGACTATTCGTTAGGTCTGTGGGAAGGAACTACAAGACAGCAAACAAAAA
AACAATTGGGGGCTCACCTAGGGCTTTCTTCATAGAAGCAGAGAAGCTGCTAGTTTGGGT
GCTGGAACCAATCTCGGAATTTATTTCAAAGAACAGTGATCCCACTCTGTTGAATACTTT
GGGCATGTGGCCCTCAGAACCTGCGGTACTTGGGGGAATGGCTAATACCACTCATTGTTT
CAGTTCTAGGTGCTGGTGCTGAAGTGGATTATCTGGAGCAATTTGGAACTTCCTCGGTAG
GTACTTGCCCGTTATGACAGCCTCGACTGCAATGTGTAAATCAGTCAGCCTAGGCCACTT
ATCCTTGGCTCCTGGAGCATCCTTTAGTTCCTGTACTGTGTCTGGTCAAGGCTGCATGTA
AGAGCCCTTGCCTTACAACAGTGTCCTGACCCAGGTGTCCCCTCACTCCCAGATAATCCT
GGACCTATCGGGGTGTGTTGTGGTCTCCCCAGCCCACTTTGCTCAACAAGGTCATCCTGG
CTTCTGGTATCTGTTAAATCAATGATGAATCCTGTTACTTTTCCTTGTCCCATCTCCAAC
TCTCAGTTCAAGGAGTCAGCCTGGAGGAAGCAGTCTTTGTACTTGAAATTTGACCCCCTT
CTGAAAGAGAGCCCTTTGCGGTCAATGCCAGTGCCAGTGGCCCCAGTGACAAATAGGTAT
GTTCCTCCTTTGAAGCTGTTAGCATGAGCCAAGGAATCTAGTGGCTGTTACTAAATGTAC
TGATTGAAAACTTGTGGGAAAAGGCTAATCTCAGCTAAAATGAGTGATGGTAATAGACAA
ACAGGACTCTGAGCCTAGAGCCAGCCTCATCGATCAGGTAGTCCGTGTTTTAGTAAGGTA
CTCTGCCATGCTCTTCACACAGCCACACAAGCAATGATTGCACAGGAGGGCACGAGCCTG
GGCCAGGCCAGACAGTCTGTTTGTATGAGTGGACTTCAAAGGCCTGTTCCTTCATGCATC
GTCTATGACGACTTGTATTATAAAGGCAGATCCGGGGGTTGGGGATTTAGCTCAGTGGTA
GAGCAGGTCCTGGGTTGGGTCCTCAGCTCTGGGGGGGGAAAAAAAAGGTAGATCCGAATT
GTTGTGACAGAAACCATAGGGCCTTCAAATCTGACATCTGTGGAAAACCCAGGCTGATAA
CTAGTACTTTAGAAGAAAATATAATCAAATATTACTGAGAATTATGTGCTAAATCTAACA
CAAGACCCTTGAGCCCAGGGAAGGAAAGATTTGTCCCCTCTAACTAGGTATTAACCCTGT
ACATTCTGAGGACTCCGCAGTAGGGCATCTGCACTGTCTGCACAGCTTGCTATGAGCCAG
GGAAGCACGGCATTGCCTCACAGGGACAGTGAGGGGCAGGTGGCAGAGGGGGCTGGAGGC
AGCAACTGCCAGGCCTAGTTCTCCAGTCCCAACTCCTAGTCTCTGTCTTGTTTGTATTTG
TTTTTAGACCAAGACCCAAACACAAAGCTTGTTAAGACAACACTACTGACTTTTATGCCC
TATTGAGTACTCAGCACGAGGTGATCTTGCTGCCTGTTTGGTTTCAGTACACAGGATACA
GAGGAGTCTGGCTCCGGAAATCCAACAGAAGCCAAGCTCGTCGACTTAGATTTCTTGGGA
GGTCTGGATGTTCCTGTAAGCACTTTGGTATCTTTGGTGCGATTTTTGTGATCCAAAGAG
AGGAGATCTTGAGAACCTATGTTTTATCCACACAGGTGTCGGCCCCACCCCTGTGTGTCC
TTGAGCCTCGAGGTCTCCTTCCTGCCGAGCCTATTGTGGACGTGCTGAAATACAGTCAGA
AAGACCTGGATGCAGTGGTGAGACCAGGCAGCTGCTTTGTAACACTGCCTACCGGAATTG
CCTGCATCCTTTTCTCTATCTCAGACAGTCCGAGGGCCCTCACCTGGGCCTGTGGTACTT
GCTTTTATACAGACAACTGAATGGGTTTGGGGAGCCCCCTTGTGGGTAATGTAAGTTAAT
ACATTAAGAGATAGTCCTCGAGTGCCTGCTGGGTTCCCCTCAGGAGCATGGCCAGCATCC
CCACGTGACTTCATACGGCAGTATGTTAGCATAGCTCAGGAACATATCTCAGAGACTGAG
GAAACCGTCCCTGTGGGAAGATTCCCCACAGCCCTGTGACTGGTCCATCTCTGACCCAGG
CGTGTGGCTTTTGTAGGTGAACGTGATGCAGCAGGAGAACTTGGAGCTGAGAAACAAATA
TGAGGACCTCAACACGAAGTATCTGGAGATGGGGTAAGAGTACAGACACCAGTGCTGACC
AGGTCTGCTCATATCACGAGCCACAGATGCTCATCCTCTCTCCTCCTATAGGAAGATCGT
TGATGGATTTGAGAAGATCGTGTATAAATCAATGGGTGAGTGCCAGCTGCGTCTCCCCTT
GTGTTGGAGGTAACATATTGTTTATTTCTTCTCCTAACCCATGCTCTGTGCAGCTGTCAC
ACTGTACCCTGTCCTGCCTTCCCCTCCCCAGAGATAATTAATTGCAGGCATCAGAGCAGA
AACACAGGTGTCCCTGAGGAACCTCTAGCCAGCAGTGGCTCCGATAGGTCTCCCTGCTCT
CCTTTCCCCAAGACCCATAAACCACGTATGATGGTGTTAATCTAAGCCTCTCACTGCTGG
GTCATGAGGCAAGCTCCTTAGAGGCTGACATGGAAAACCAGCTGCGTTCTGGGCCTGGGC
TACATCCCAGAGAGTCTTGTTATGGGACACTCAGTAGTGTCCATACCTGCTGTTCCTGGA
TGCCTGTCTCTTTCCTGCTGCTCTGCCTCAGCCCTTGTGTCACTGCTGTTTCTGGCATCC
AGTGGGGTGGTTACTTCTAATCCCAGGTGCTTTTTTTTTTTTTTTTTTTTAAGAGGAGGC
TGAGAAACAGAAGGAACTAGCTGAAGACAAAATTCAAAAGATTTTAAGAGAGAGAGACCA
ACTTACTGCGGATCTGAACTCTATGGAGAAGTCCTTCTCTGACCTCTTCAAGCGGTTTGA
GAAGCAGAAGGAAGTGATTGAAGGCTACCAGAAGGTGCGTTGTATCCCCTTTCGGTCCTT
GCTATGTTAATCCCTTTCTGGCTGAGCTGTGTTCCGTACATCTGGGTTCTTAACTGTGCT
GTTCCTTGGCACCAGGGACGTGATAGCCTATCTATCAGCAGGACAAGCTGCACCACGAGA
CTCTGGTAGGAGAGCACGGCCGATCTGTGAGATGTGGTTTTAGAGGCTTTAGGAGCCTCA
GCAGAAGAGACTGAGGGTTTCCCTGCTTAGTGCTACTATGTCTGGCATGCACAAGGCCCT
TAGCTCACTCTCCATTAACTTTTCAACCCTCCTGTCCTCCCAAAAGAAAAAAAGAGGGGA
AAAAAAAACTTTGCAGTTATAGAGTTCTGTGAACAGACACCATGACCAAGGCAACTCTTA
CAAAGGAAAACATTTAATTGAGGCTGGGTTATAGGTTCAGAGGTTCAGTCCAGGATCAAG
GCAGTGTCTAGGCAGTCATGCTTCTGGAGGAGACAAGAGTTCTACATCTTGATTGGAAGG
AAGCCAGGAGAAGACTATCTTCTACATGGCTAGGAAGAGGGTCTCTAAGCCCACCCCCAC
AGTGACACACTTGCTCCAACTAGGTCACACCTAATAGTGCTATTCCCTGAACCAAGCATA
TTCAAGTCACCACACAGAGATTGGTATTTTTGGGCAATGGAGTTTGGGGAACAGCTAACA
GTGGGCTCAGGAATATCTTGCAAGAAAGGGGAAACTAGACTTCCCCATGGGGTCAAGTGG
AAAAAACAAGTCATGTCAGAAACCAGCTGCGGAGCTCTCGTATCTCCTGCTACATGGCCC
TCAGTAGTGGTTATGAGAGGCCCAGAGTGTGCTGAGAGGAGCAAGGCTGCATATATTATA
TTCCTCAGGACTGTGCTACCCCCAGTCACAATCTGTAGGAATCCTAGTCATGGTTTGCAC
TCGAGTAAGAACTGATGCCTGGTACTAAGGTCTGGGGGTTAGGCTCAGTTCCCAGAGGTG
ACAGTCCAGAAGCTCTCTTTACCTTGAAGGTGGGATAGACTGTTTTGGTTTTTCAAGACC
GGGTTTTTTTTGTGTAAGAGCCCTGGCTGTTGTAGAGCTCACTTCATAGACCAGACTGGC
CTCAAACTCATAGGTCTGCCTGCCTCTGCATCTCAAGTACTAGGATCAAAGGTATGTACA
GCCACACCCAGCTCAAGGGGTGCTTTTTTAAAATTTACATTCCAAATGTTGCCTCCCTTC
CCAGTCTCCCCTCCCCTAGCTCTTCACACACACCCTTTGTTTCTGAGAGGGTGATCAGCC
ACCCACTCACCCCCACCAGCATCTCTCTTCCCTGGGGCATCTTCTCCCATTGAGACCAGA
CAAGGCTTTTTCTAAAGAGAAAATGTCAAGTTGTGTATCACTAATGTCCCCCAAAACCTT
AAATGTCTACAGTCTGCACTTGACCCTGGGAGTCCCATATGCCAAGCCTGGACATAACCC
CAGCCTTGGTGGAACAATGTACTTTTAAGGTTTCCTATTTGTTCACTCTCTAGAATGAAG
ATTCACTGAAGAAGTGTGTTGAGGATTACATAGTGAAGATTGGAAAAGAAGGCCAGAGGT
ACCAGGCGCTGAAGGCCCACGCAGAAGAAAAACTCAAGATGTGAGTATCAGATCCCATCC
TGGGACGGAGGGCTGGCTAGCTTGTGACTGGGCCAGGCCTAGCCTGTGTCTCTACCTCAA
GGGCAAATGAAGAGATCGCCCAAGTGCGAAGCAAGGCCCAAGCAGAGGCACTGGCTCTCC
AGGCAAGCCTGAGGAAGGCACAGTTGCAGATCCAGTCACTGGAGAAGACTGTGGAGCAGA
AGGTAGGACACAGAGACCCCAAGGCCTGCTCAGGAGCTGGCTTTGATTCAGGGGTTCCTG
GACATTATCTTTCAGGAAGTCCAGGGCCAGCCTTTTCCTTTCTAGTCTCCTTTTCTGCTT
GAGACGGGTGGGATCTTTCTAGTCAGTAGCCACTCCCTCTGAAGCCAGCCTCGCCTGTTC
TCCTTCAGACTAAAGAGAACGATGAACTGAACAGGATCTGCGATGAACTCATTGCTAAGA
TGGAGAAGAAGATCTGACCACAGCTGACTGTCGCCAGCCCTCTTCTGTCTGTCTGTCTGT
CTGCCCATTTCCTTGTCTGTCTGACTTCTGTGTGGTTTATTTAAACCTCTATTCATTTCT
AAGTTACATTACTTTGAAAAGAGTAAAGTTTAATTTCAAACTCAAAGTCAAGCCAGGTCC
TGTTGTTTCTAACAAGCTCACGTGCCTTCTCCAGGTAGTTGAGCTTGTTTGAAAGTGTCT
CTGCAATCCTTATAACAGTGGTTCTCAGCCTTCCTCATGGCCCTCTAATACAGTTCCTCA
TGCTGTATTGACCCTCAGCCACAAAGTTTGCATTGCTATTTTATAACTATAATTTTGCTA
TTATGAATCATAGCGTAAATATTTATGTTTTCTGATAGTATTAGGGGACCCCAGTGAAAG
AGTCATTCAACACCAAAAAGGGTTTGAGAACTGCTATTATATAAACTTGGGGGGCTGGGG
ATTTAGCTCAGTGGTAGAGCGCTTACCTAGGAAGCACAAGGCCCTGGGTTCGATCCCCAG
CTCCGGAAAAAAGAACCAAAAAAAAAAAAAAAAAAAAAACTTGGGAAGGGAGAAAGGGTC
CAGAAAATGTGGTTGGTTTCAGAGACTTCCTGAAGCTATTGAGTTGTTTACGTACTGAGC
TTAAGGAGGTTCCCTGTAGAATGGGATGTTTTACTCCCTTTAGAACATCCTGTATCTTAA
GGAGCTTCACTCCAAGATGGAAAGTTAGCTCCTAGAAGAACTGGCTGTACAAAGCCCAGC
ACGCCTGAGGCTAAAGAAAGCAATTAACGGGCTGGAGAGATGGCTCAGCAGTTAAGAGCA
CAGACTTCCAGAGGTCCTGAAAACCATCTGTGATATGATCTTGGCACCCTCTTCTGGTGT
ACAGGCATATATGCAGACAGAACACTATACATAAGGAAGCAAGCAAGAAAGCCATTACCA
CTAGACCTTTCAGCCATCTTGGCTCCTTGGCTGTGGGAGCCTTTTATGAGCCTGATCTCT
ACCCACCAGGGAATGAAAAAATAGGAGATGGTGTGCTCAACTATCCAGTTTTCAGGCATC
TAGTCAGCCACATAGCTTGGGAGAGAGGTACCCAATCCCTGATACCTTCCAACTGTATAC
ATCAAAAGTCAGACTCAAGTTTTCAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1134, 4009..4171, 4302..4444, 7957..8038, 8398..8842, 10323..10375, 10686..10795, 11687..11774, 11855..11956, 12316..12392, 12471..12514, 13013..13173, 14693..14799, 14881..15001, 15188..15405
4010..4171, 4302..4444, 7957..8038, 8398..8842, 10323..10375, 10686..10795, 11687..11774, 11855..11956, 12316..12392, 12471..12514, 13013..13173, 14693..14799, 14881..15001, 15188..15253
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved