Rattus_norvegicus Locus Rpl5
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rpl5
Rattus_norvegicus
Rpl5
14
SNORD21, SNORA66, SNORA66
4012..4105, 4652..4783, 6735..6866
8381
tgccatgatgcacaccaacccaaaaatacaaatatttttaaggagttctgctgcccctg
caaaatcagagtaccagagtcataaaatgctattgccaaaataattgggtacacaaaatt
tgtttggggaagcaattttcaaaattgcattctcattgactttataaagctctcgacctt
tcatgtgtttaaataattgtttgcatttattttcccccctcaggtatcatacagcccagc
ctggcttccagttcactatgtagcccaggctagccttgcactttgtgatccttcttcctc
tttcttttaagtgttgaggctgcagtactgagccgcgcacccagccctaaaaggaagcca
cctgaggaaggagactttaaaaagctaactaagagtgatggaggtagtggtggggcgcac
tgataatgtcgggaatcccggggacaatggaaacataaggcaacaggagagtgcagtggg
ttttgttttgtttttttatcatgtaaactaagaacttactggaggtcagaagtgctggag
aatgaaaagtatgcgtgaagcagatgccaagatgctatgtaaaggcggcggagactctcc
taactcatgcctgaggctctgaggctgatcttcctagcagccctgtgtgctaggaattcc
gatatatatatattccagaagtgagtcaagacatggagaaggcatgatttcagcataggc
aaattcattttattaaacttaatcttaccccttcttgcttagaaaaaaaaaatatattcg
tgtgtgtgttcgtacgcgtgcgcgtttaaaaatgtcctagcaacaagcctgcatttcctt
ttctcatcttgcttgcgtgttgagatgacaaaatctgacattcgtcctccgaccggcagg
gggcgataggctgcgcaccctgatgcctccagccactctctttcccacgtcgcttgcgtc
ctggaggtgctacatactgcgcatgcgtacgcgactccggtCTTTTTCCCCCTAGCGCGG
CCGACTCTGCAGGTCTGCGTGGAGCCGCAGTTGCGGGTCTCTGTTCCGCAGGATGgtgag
tgggcatctgggtctcagacccgcgcgtgcacgggggcgccccctcctctcgcggatgcc
cattcggggcccgctcgtgcgacccggggggcagatggcgttcgattccctgctctgcgg
ccgccgctccagcgtggcctaatggctgccgggtgcgagccgggggaggggccgcggcgg
agggtgcccgggacgtggcttccgaggctggccgctggccgcagactcctccgggatcgt
caggagtcggtgctgcggaggcccgagtccctcggccgcgcacagggccctgaagccggg
agtgtctgttgaggtcgtggcgccgcagcgtccgggaagggagtccgtgtcatttggggt
gtggctgcccttggctctacctggccagtgtctggtcctgttttcagtgttttgctggaa
ccggactgagttggggtgcggttctttatgagcggggagtaattgcagatcgtactggcc
tgctgagcccagtttaggcaggaagtcagcgtagtgcggttgtcggcacagattgggtgc
ggtgtaggtgatacatcccagagggctggcgtggggatcggttggtacaggacgtggagg
attgtttaaagacagtacgagaatgtgtttgtgcctgtgagtgtagcgaggagcctgcag
ttgtggaagggagagggctgaggcttgcttgggccatctttatgtgtttttagacgcttc
gttgggtgtacttggcgaagagaaccactgcaacagcagttctcaatctggttcgcgacc
catctgtcagatatttgcattacgattaataactacgaaattacagttaacgaagcagca
acgagatgtatagttggggctcgccacagcatgaggaactaaacgtgttaaaggttgaga
agcacctcactacagcgatacttgttaacagtcagcttagaaacatgctgtaaaagttga
cggtcgtaatgatttgcttctgaaacttaggcattgtaatttagtgctcaaacgctacca
aatgctaggtcatcttgggctacatagtgacagactgtctcaaaagaaaagtcagggaat
gaaacagtcaccaaagcactgatctttttttttttccttcaaagGGGTTCGTGAAAGTTG
TCAAGAATAAGGCCTACTTTAAAAGATACCAAGTGAGATTTAGAAGGCGGCGAGgtatga
ccaacttttcctgtttgagttcctgaaggatcagcttcggggtggaacattttcttgttc
aaatctttttttccttgcagAGGGTAAAACTGACTACTATGCACGGAAACGATTGGTGAT
CCAGGACAAAAATAAGTACAACACACCGAAATACAGGATGATAGTTCGTGTAACGAACAG
AGACATCATCTGCCAGgtgagctgtgttctaggcttaagcagcgcgatcagacccacaac
tcatattaactatggtagagatgattttcttgtagtagatttaaagatttaaagattgca
gttgtgggggtgagatttggaaaacccagcttatgtgaatactctcccaattaccataat
ctgtcatgtgctgtcttatgttatgggcttgtgtgacattttattgatttaaaagggctg
gtaattgtgaggctcatctgtaatccaagctgtttctgtttactgtttaaataggtttta
aaatgtacagaaacatctcctgtgaaagtcctttaaaaaatggcaattcctgtattcagg
gctcttacagttaagggcgatgcttagctgaaatttgctgaccgggagacagatgcagtt
gctttctgtgcaaatttgttgactacaacggtggggttgtctgacgttctgataatgaag
ggtgaagtgtcagagacttggtcagatttagctcaaaaggtacttttagtaaatgattat
ttgctttggtggggaggttcagatcattgtaaccaaccttggctggccttgaattcacag
ctctgcctgcctctgcctcctcggtgctaggattaaaggtgccctgttttgagatggggt
cccagtgtatgaccgaggctgatctgtactttttgtaggacaggctaaccttgagcttaa
agatctacttgactttgacattttttggaatcttgcaatatagccatgagctcaggctct
attccaagatatccccctccccagtttgtttacttttaaaggcacctatgatttcaccag
cttatcagccttaaatagtttcagtatttagaaatagctattataattggttctgacatg
ctgtatgtattttagccatacttttccccctaaaccactatgtagtgacaccacacagat
taatgttcattgagttgtctcttctccccacatcttgttaaaaggtgggacaagtactgt
agaattgaaagcaacacattaatctgatttttctcactgcagATTGCATATGCCCGTATA
GAAGGGGATATGATCGTCTGTGCAGCATATGCACATGAACTTCCAAAATACGGTGTGAAA
GTTGGCCTGACAAACTATGCTGCAGCCTATTGCACTGGCCTGCTGCTGGCCCGCAGGCTT
CTGAATAGGTTTGGCATGGACAAGATCTATGAAGGCCAAGTGGAGGTGAATGGAGACGAG
TACAATGTGGAAAGCATAGACGGTCAGCCTGGTGCCTTCACTTGCTATCTGGATGCGGGT
CTTGCCCGAACTACAACTGGCAATAAAGTTTTTGGCGCCCTGAAGGGAGCTGTGGATGGA
GGCTTATCTATCCCCCATAGgtaataaatagtattaaggtttctgtcttgattccctcca
tgttgagatagaaagcactggcagcagcctatccttctgagatgccgatgcctgggcagt
gtagactctagaggggggaagcgagtgtgtctgtggaattcagagaggagctgctaatga
tgataccgcactaactgagcagttagtagttggtcctttgattgcatatgatgtaatcat
tgtttcaagacgggactgatggcagctcctgaagtgaattcctgggagtgttgtaatttc
ttgtctgtatactaaggtgaacttttcattttagTACCAAACGATTCCCTGGCTATGACT
CTGAAAGCAAGGAGTTCAATGCAGAGGTGCACCGGAAGCACATCATGGGTCAGAATGTGG
CAGACTACATGCGCTACCTGATGGAGGAGGATGAGGATGCGTATAAGAAACAGTTCTCTC
AGTACATCAAGAACAACGTGACTCCAGACATGgtaaacatttacctgaacacgctgctcg
cttacagaaaaaactgcttattctgtttaataaggggttgtagtcttaacatgtgtttat
ttcacgttgtagaacaggttagatgtggctttgtgggtaggtaaaggtggctactgagct
gctgctgctgcgttggagtgaggttgtgtactggtcaggtgggaaagggttttagatgct
catgtacacgggcttttagcatttaaagtctgggcaaatgggtggtcggagcagctcctg
cattgcctgctgcatcttgctggtcaaattctgtgcaaactcgatcactagctctgcatg
atgtggcagcagctaagggaaccaggtttgctagagtaactgtggtgatagcaatgtacc
aacctcaggagctactgaggtgcccattctgtcccagtacagtcttccctctcttttaat
aagagactttttgttttgtgggacaggatttctctgtgtagtccagtcttggaaatcaga
gatctgtctgctgctgggattaaaggtgtgcgccaccaccacccagctttgggggttgag
ctgggggcatggggggaatctagggactttattaccagggccacctttgaatttaagatc
ctgacttaaaggcttgatttaccgtacctactgcactttggttttgggatggtatgaaaa
cttcattttaaagtttattgaaatccttgggagctgtactagttgtttgcaaaaaagtag
gggtgggggaagtaattcgagtttgatactggaatctatcggctctacagtttcctatct
aaagtggaaatacgtcctgtggtctggtctgtgtgtgctctgggcatcacctacactaga
ctcagcttgacctcttatgaaaggaagggagccatggacagactgcttcactgccgtctt
ccgggatcttgtgctgactcctcatgtcatgcttgctcagaaggttctcgggcttcacat
cttttttttttttttggttcttttttttttggagctggggaccgaacccagggccttgcg
cttcctaggcaagcgctctaccactgagctagggcttcacatcttatcacatgctcatga
ctgcttttcagctaatgctttttatttcgtggtactggggattaaatccagggttttcta
tggaatgaagcatcagtgctcaacctctgtagttcattttatctggtgtattctgtgtag
ctcctgaaacctcctgtttctcagcagagtgaataaatccacggcctcatctgcatatgc
aaagctatcatcctttcctctctgttaggaagaactgggatgttaaatttttgcagtttt
cagactataatagtgggttgaaggaacattctgtcttactgagtgccggggtcactgttg
tgagagtgtgaggaaatctgcacttcgtggggacttgtctcttagggcatggaagggggt
tgaaatagttggggcctgcagtgcagtagacgtttctgcattatttcctcttttccacct
ccatgttgaaatgaatcgatttagaaagctggggtatagacactttaataagagcttgcc
aggtatcaagctcttggcactcctgttcttgagcacctatatacttcagggggttacagc
cttgaattttattttttaaaaacaaactttagaaccaagattccagaaaaacaatctagt
caatggggagagaggtggctttgtcagtttagagatcatacaagctgccacatactaaat
ttggcagcgctagagtatggagtatgtctctagtgctgggaattgctttaaaaggcctgt
cacataagagggattgtaaatcttggatatatgggatgacaaaagaaatagctgttgccc
agtttggtgagatacccccttatgcccttgccctcagtggtcagtgtgtccttatgtcca
tatagttcatgtcttttgggcatgcaccttctcttgaaagaatttaggtcgttcagtaga
ctagagagtgtggtgtagttgtacataaatgggcttgtagacaccaggagtggttgcctt
ccttaggaatacatgtaggttactcatcccaagcagtgaaatctaaggagagggtggact
ctacttgggcttagttagggtcttggagaactgacagcaggtgaactgtaccttactaat
agggcaggtgagatgaaggcaaatactgtttgctttgctttgttccagATGGAGGAGATG
TATAAGAAAGCTCATGCTGCTATCCGAGAGAATCCAGTCTACGAGAAGAAGCCCAAGAGA
GAAGTGAAGAAGAAGAGgtgtgtggttaaccattctctgggaaagaaacctgctgcatct
tgctggtcaaattctgtgcaaactcgatcactagctctgcatgatgtggcagcagctaag
ggaaccaggtttgctagagtaactgtggtgatagcaatgtaccaacctcaggagctactg
aggtgcccattctgtcccagaacagtcctacataagctacctacatgggaatctttcttt
gcctgcattcataacatttctgcctctgcctgactgtgaatactgagcttatggtgtggg
ccatcatgctcagctgaggtggcttttgagtttgatggagtaaacagaatagccagtgca
gttgagtacctggattagaacttaatacgggcactcaggaggttgaggcatgattgtcac
aagttcaaagccacctaaaggatatctaggagaaccaggtcttcagataatgagagtttt
agcctctatccaattacaaaggtcttgtcattttctttttcagctgaacttgagagatac
tcctgtcttactccttactttgttttgtagGTGGAATCGTCCCAAAATGTCTCTTGCCCA
GAAGAAAGACCGGGTTGCTCAAAAGAAGGCAAGCTTCCTCAGAGCTCAGGAACGGGCTGC
TGAAAGCTAAAGCCATTTTCTATGAAGATTTTTTCATAAAGACAATAAACATTGATCAAA
GCagctttttctgtgttaagctgttattatgagactaggaaatagtgtgaaattacaaaa
gcaaaggagtaaatagtttaatttattttaccttttttttttttgttgttgtttttgcac
catggcatgcctctgctgggagtaagggcaagtatcaccacacctagctgagattgtttt
gtttctcctctaaaagtttttttttgttttgttttgttttgttttttaactgggaaaggc
cagcttacatgggttcctgtaaagctcacgagtgtttcttgggattctagtatttctgga
aggagtccttgtctttcagactttcagatttgataattagcagcatgatcatcaggacat
agttcttcatttattacaaccagttgattagtgggaagaaagtacctcaaggtcaatctt
gaaagtgaacaacggggctggggatttagctcagtggtagagcgcttacctaggaagcgc
aaggccctgggttcggtctccagctccgaaaaaaaaaaaagtgaacaactggtgctaatc
cttggctttaaagatttgagaacaacagtggagtttatgtcgtggggagaaagggaggac
tggggctttttgtttttgttttttgttttgtttcatctttattgtacatgccagacccga
atgtacataagaaaataacttgaaagggtcaaatattaaaccttgcctatcaggttcatg
tgggaaaaagtactaggtgatatatttatgcctcttaagaaatagcccttcaaccacaag
gagcaagaactcttgctgatttattccagtcttccttggtctgtctcagctgaggcagtc
tgcatctgtagcctctgccttacagtgtcaggtaaacagttgactgctggtctacatccc
cagcctaagataatgtgcatcacttgttgacactatcagagcttcaggataatgaatttc
agttgcagtggtaactgcatgtagaatatatgcttgaagcta
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1074, 2204..2273, 2360..2475, 3522..3859, 4174..4351, 6588..6676, 7230..7381
1072..1074, 2204..2273, 2360..2475, 3522..3859, 4174..4351, 6588..6676, 7230..7329
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved