Rattus_norvegicus Locus MGC72957
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus MGC72957
Rattus_norvegicus
MGC72957
16
SNORA68
1428..1556
2899
GGCCAGAAGCGCGGCGTTGGCGGCGGGGCCGCTCAGGTTGACTGTGTCCTCCGGGATGA
TAGTGCGTTCGGCCGCCAGGGTCCCTCACCGGTCACGGGCTGCTCTCTTCGCCCACAGAC
TCCCCAGGCCAATATGGCGGCCGCCTCGTGCTGGGCGGCCGGCGAGAGAGCGGGTTAGAT
CAAGGATTCCCCGGAAGGCGCTCTCCGTACTTTTGAGTCTGTCAGTATTTCACTCTTTTT
CACTGTCAAGTCTTATTTCATGGTTGCTTAGTTTCAAAATCAAAGCTAACCTGGGCTACT
TAGATCGAATGGAGGCACGGCTCCATCTCGGTTTTAGAGAGCATTTGATAAGCAAGCGTT
GCGGCCTACTCCCACCACCGGTGCCACACACTTATCGCAGTACTTGAGAGAGACAGATCG
TCACTTGAGTCATCCTTAGCTCGTTCTAAAGACTAGCTGACACTTGTGAAGGACGTAGAG
CAAACAGCACCCTAGAGCGCCATATCATACTGGCCCTGTGAGCAGGAGGAATGCTTTTGA
AAGGCCCAGGGCTAGTGTGTTGGGGACATATGAGATCCTTCTGGCTCTTCGTGAGAAGCG
AGTTTGGAATCTTCCATTGGTCCCCCCACCTACAGACAGTTTCTCTGTGTAGACCAGACT
GGTCTTTAAACTCAAGAGATTTTCCTGCTCTGGGATTAAAAGGCATGAGCCTCCACTGCC
ATCTTGGCCTGGAATTTTCTGGGAGAGCACAGCAGCCTGTATGTGAACTAGTATATGAAC
TAGGCTCTGGAACTGGAGAAATTGAGGCAGCTTCAGAGCGGGATGCATGCGTTCTGACAT
ACGTGCCACTGGGCTCTTGGAAGGTGAAGTGTGTGAACCCAGCTTTGGTCAGGGGAAGTG
GGGGTGCCAGGTTGGGACACCCAGCCTGTTGGAATTACTAGATCTTGGGCAGACTTCACC
TCCCATCACATATACAGCTTATCTCCTGGCATTTCTTTCAGCTTCGGGAGTACAAGGTGG
TGGGGCGTTGCTTGCCAACCCCAAAATGCCACACACCGCCACTGTACCGAATGCGAATCT
TTGCACCCAACCATGTGGTGGCCAAGTCCCGCTTCTGGTACTTTGTGTCGCAGCTGAAGA
AGATGAAGAAGTCATCCGGGGAAATTGTGTACTGTGGGCAGGTGAGCCTTGGGGCCCCAC
CGGATGACGGTCCCTGGGTACCATCAGAGCCAGGGCAGTACACAAGCCTCACATCCTCCT
TACTCCCCACAGGTGTTTGAGAAGTCACCCCTGCGTGTGAAGAACTTCGGCATCTGGCTG
CGCTATGATTCCCGAAGTGGCACTCACAACATGTACCGAGAGTACCGGGACCTGACCACT
GCCGGCGCGGTCACACAGTGCTGTGAGTCACCAACCCTCTGTCAACCCTTGGCACCCAAC
CCAAGAACTGCCGCTACTATAGCGGCTGTTTAAACAGTGGTGCACACAGCAAAGTGCTTC
GTCGCCTTTGGGGGGCTGTGCAGTGCCCTCCAGAGTGAATCAGGAGGTTCTACAGTTCTG
TGGGTGTTCTGGGTGGCTGGGGCTGACTTTCTTCTCTTTCCACAGACCGAGACATGGGTG
CCCGACACCGTGCCCGTGCGCACTCCATCCAGATCATGAAGGTGGAAGAGATTGCAGCTG
GCAAGTGCCGCCGGCCAGCTGTCAAGCAGTTCCACGTGAGTGAACCTGAGTGTGGGGCTG
ACGCAGGGCTGCAGGGGGTGGTTGCGCATGGACAGTCCCTGGACATGCATCTCCTCCCTC
CCCACAGGACTCCAAGATCAAGTTCCCATTGCCCCACCGTGTGTTGCGGCGCCAGCACAA
ACCACGCTTCACCACCAAGAGGCCAAACACCTTCTTCTAGACACAGAGACCCACTGAATA
AAAGCTTCAGACTGTCCTTGCTTGTTTGCCTCTGTGTCCCTGACAGGGTCCCAAGTGGAC
CCTAACAACAACAGGCTTGCCCCACCTGCCTGCCAGCCTTGGTTCAGTGGCATCTTTCTA
TAGTTGTGTATCCTACTGAGTTAACTCAACCCCACTGCAGTTTGTGTGGGACATAGCCTG
AGCCCTGTGTGTGACACCGAAGGGTGGCAGGCTGTTTCTGCAGTCTCCAGGGTGCTGGCT
TGGGCCTGAGAATTCCAGACATGAACATAATCCAGGCCTGGGGACCTGGTTGAGCTCTTT
ATCCTGCTGGCTCTAAGCCTCTGCTAGGTGGGAATGAGGCCAGCCAAACTCCGGGGACCT
TGAGCCACCAAGCTTTAGGTGAGGACTACACTGTGGATCATGGAAACACGGGGTTGCTTT
TGTTGGGTGTGGCCAGCACCATCACGGTGCCTGGTTTTGAAGGAGTATAGCCTGAAGCCT
CCGTGGCTGTCTTGTCACTGCTCTCAAGTCTCTACTGGCCACAGAGAGGAACACTGCACT
TGCTTCTAGCCCCTTGCAGATATTTCCATACGTGTATGCACATAGCCCAGGGTAATTTTG
AGTTTCAACCATCCAGTGCCAGCTAGAGTAAAAGCCTGTGTCTATACTATGAAGGCCATA
AGAGGGCACCGTGTCGAAGAGAAGTCTTCCCACTGAGTCCATTGGCCCCACATCAAAGGA
ATGGGTGATCCCTCTGACTATGCAGTGTTTCCCTGTGCATTGTGGGGCCAGTGGCTGCTA
CTTTAAAGTCATGAGGAATCTGGACACTCTGAGGACCTGGGTTTGTCCCTGTATTAAGAT
ACTGCTCCAGGGCATCGGATGCCACTGGCCTCTGCAGGCACCCGTATTCATGCAACTATC
CTTCACCCACATACATAATTGTGGTTTTTTTGGGAGTTTGGGGAAATGATGTGTGTGACT
AAGCCACTAGGAGTCAAAAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1180, 1272..1401, 1605..1714, 1807..1899
1001..1180, 1272..1401, 1605..1714, 1807..1896
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved