Rattus_norvegicus Locus Gnl3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Gnl3
Rattus_norvegicus
Gnl3
16
SNORD19, SNORD19, SNORD69
3490..3566, 4581..4653, 5403..5482
7994
AATATTTTTGTCCCCTCTTTCAAATCAAATTTTCTTAAAATATTAAGGCACGTTTCTTC
GGAAAACAAAACTTTGAAGCATAAAATACTTTTAAAACCAGAAAACACAGTTTAAAAACA
CTCGATTCGTCGTGACGTTACAAATGAGAAGCTTAAGTACCTAGCCTGTAAATAAGTCTC
TCTAACAAAAAAAAATATTCCGTTTGGGCAATCATTGGGAAAGAGGAAAAACAAAAACAA
AAACAAAAAAAACTCAATAGGGAGTTTTTGCCGAACGCACAAGAAAAAAAAAAACAAACA
ACAACAACAACAACAAAAAAGAGGCCTTGAGAGTCTGAAGAAAGAAGAGTTTGCCCGACC
TGTCACTGGTTCTGGGGCTAAAGGAAACGTTGACAGCTTTGAAGCCGCCCCGAGACGGGC
GGGAAAGCAGCGAGGGGAGTTTCCGGACCCCGGCTAGCCTTTGTCCCGGCGGCAGGTGCG
GCCAGGCTGCTGGGCCTGTCCGGAGGCCCCGCCGCCGTGCCCCGCCCCGCGCCCAGCCCG
ACCAGCGCGTCCGCACCGCGGGGAGATTATGCTATGGTGGATGCAAACTTTCCAGCCTCT
TGCGTTATCCTTTATGTACCGGATTATGGCGCGTGCCACGGCCGACACACAATAGTTCTG
AATAGCTCTAGGAAAACTCCAGGGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNAACCGCCCCGGGCCCGGCCTTACCCCGCCGCTCCGCCGCCTGCAG
CCCCGGCCGCGGTCCCCGACCGCCGAGCCCCACCCCGTGGCCGCCACGGCTGCTATTGCT
CCTCTGGCCGCGGCCCTCTCTCCGGCACCCGTCGCCCTTACCGCCCTCACCCCTCCCAGT
GCTGCCGTAAATCCAACCCGTAGCCGCCAAGCGATCCCGACTCTGTGCGACAGTGTGTGT
GCGCGCGCACGCTGCCGAGCCCCAGCACACTTTCCGGCAGCTTCTTGAGCGCGTGACGTT
GGCCCGCAGTTCCAGTTCGCACGTGGCGCCCGAGACGGGAAGGTGTACCTGAGACCTCTT
CTGCTCCAGACGCGTCCGCGGCCAGGATGAAGAGGCCGAGTGAGTGGGGTCGAGAGCGAA
ATGGGCAGGCGGCGCTTTCTGGCTGTAGGGAGAAGACTATCCGGAGGCCATTGCTCAGTT
CCGCGTAGATCTGGCGCTTGGAAGGCCCAGGCCGGAACTGGGCCTGTTGTGTATGAGGAA
AGCTAGGCCTTTAAAGGGTAGACTGGGCCAGACTTGTGTGGTTAGCTTGTTTGAGCCTAT
TTTCGGCCCTGGAGTTTTCCTAGAACTATTCAGAACTATTGTGTGTCGGCCGTGGCACGC
GCCCTAATCCGGTACATAAAGGATAACGCAAGAGGCTCGAAAGTTTGCATCCAGCATAAC
ATAATTTTTCAGGGAAGGTTGAGGCAAGATTTCTGCTGCCCAGGCTAGCCTTATTTTTGT
AGGCCCCAGGGCCTGATAAAACAGTCTCTTGAGAGCCAGGAATATGGCTAATGTCATAAA
GGCCCTTGCCACTAAGCCTTACTGTCGAGTTCAAACTCACATGATGAATAGAACTGACTC
CTGTAGATTACTTTCTGACTGGCCTACACACAAAATAAAGCATTTTGGGGGTGGAGTGAA
GACCCAGGATTGAGTCCCAGCACCCACATGGCAGCTCAGTGCTGTCTATGGAGGGACTAG
TAATGAAGCCCTCCTTTGGCTTCCTGTGCAGGAACACTGCATTTACATCATTGGTGTGCT
TGCTGGCAAGAGAGAGCAAAACATCCATTTAGGTGATTTAAGAAACTTAAAGGAATGCTA
CTCGTGTGTACAGTTTTTCTCTGTTTGTTTTGGCAGAGTTAAAGAAAGCAAGTAAACGTA
TGACCTGTCATAAGCGGTATAAAATCCAGAAAAAGGTAAGTGTTCCCGGGAGACCCGTGC
CAATGGATTGCTAAAGTGGCCTTTTCCATCCTCTCTCCTTCATGGCTAAGGCTCTGTTAA
TGATTTATGGTTGGACAGGCTGCAGCTGTGGGAACATGCAGAGTAAGAGAAAGCCTAAAG
TTTGCACAGTGACATTGTTACAAAAAGCTTCTGAGGGACATTTTTCTGTTTTATGTATGC
GTATTAATTCTCTGTATAGTTTCAATTGGAGTTCTGCTTTTTTAGAGTGCTCCGAGTGCA
TTATGAACTGTCGCTAGACTGACTTATCCCTAAATTTTAAGTGGTTAAGTATTTTTATAG
GGTGAGTTTCTTTTGTACAACACTGAGGATTGAATAGCGCTGTTTACAATAGGTTCGAGA
ACATCATCGAAAATTAAGGAAGGAAGCTAAAAAGCGGGGTCACAAGAAGCCTAAGAAGGA
CCCAGGAGTTCCAAATAGTGCTCCCTTTAAAGAGGCTCTTCTTCGTGAAGCTGAGCTAAG
GAAACAGCAGGTAATTTTTGCTGGCCGAAAGTTCTAGTGGAATAGTTTATGTGGTTTCCA
AAGTAACATACTGCCACTAGTCACCTGTTCATTTCTGTCATGGCTCTGACACAGCTTGAA
GAACTAAAACAGCAGCAGAAACTTGACAGGCAAAAAGAACAAGAACGAAAAAGAAAACTT
GAAATTAGCCCTGATGATGAGCAATCTAATGTGGAAACTCAGGAGGTGAGGCTACCTTTC
CTTAAAAGTTAGTGGGCTTATGGCAGTAACAAAATGTAGGTTATCTCAACCATTTAAATC
TGTTGCCTGTTGACACCTGTGGAGAGTGGTAACAGCTGCTCTTTCTAATTTTTTCTTCCT
TTTAGGAATCTGATGAGCCCAAAATAAAGAAAGCTAAATCAGGCAAACAGAATCCAAAGA
AGTTACATTGTCAGGAACTTAAAAAGGTACCTTAGTATAGGTTAGTGTCAAAAATGGTAA
TGAGATTTTGAAAACGTAAGAGTCCTTCCTTGACAGCAGCTTTGTAAAGTGGACTTGCTT
CCTGCAGCTCCCCAGCCCTGGCATTCATTTCCCAGGCTAAGCTACCGCCTTCTAAAGAGG
CTTGTTACACTGCACAGCTCCGCTGGGGTAGACTGTGTGTTCTGACCTAACGGGTTGGAG
GCCAGTGTCCAGTCGGAAGCTGCTGGGTGAGGTTCTTTGTTCAACTTTGATGTATAGTAA
CTCATGAACATGTCAGCATTTGTCATAGGAAAGTGAAAACATGGGATCTGCCTTCTACAC
TCACTGTCAAAGGTGAGTGCTACTCAACGAGGGATGCTGTTCTGATGGTTCTTGTTTGAC
AGGTGATTGAAGCCTCAGACATTGTGTTAGAAGTTTTGGATGCCAGAGATCCTCTTGGTT
GCAGGTGTCCTCAAGTAGAAGAAGCTGTTATCCAAAGTGGATGTAAAAAACTAGTACTTG
TATTAAATAAGTCAGGTGAGTACAGAGTCCTCTTTATCTTTGTGCGTGTGTGTGCATGTG
CGAGCGCTCTGAGGTATGAGGAAAATATCGGAACAGTCTGATTATCACTGGAGACTGATA
AGATCCAACTCTGACCTCAGCAAAGCCAATGAATGTGCGCTCTGGTGGCCAAGACCTGGG
GGAGGTAGTCTCTGCAAGTGATTATTCACCTGGATTTTTCTGTTCTGCTTTTCGGTATTT
AGCCTCCTTTAGTTTTAAGAGTTTCCGTAACCACTGCATTTCATATAGAAACTGGTGTGA
GCATTCGCCACATATACGCCCACACAGAAACGCAACTAAACTAGGATACAAGATAAGTTA
CTATGTGAGATAAAATATTTAAATGAAATGATTAGGCATCTGGGTGGGTTTGAGCACCAG
GAAGAGAACCCAGAAGGAAAATTTGGATAACTGGCTAAATTGCCAGCAGTGGTGTTCAAG
CCTCTAGATATGAGGGGCAGAGGAAAGAGATTTTGTAGAGAATGAATATAAGAATGTGCC
TTACAGTCACTGTTAAGCGTAGAAAGTTGGTGCCGCTCAGGTAGCAGTAAATTCTGAAAA
CTGGCATGAGCTGACTTAGTACCCGGACTGAGCGAGCGAGCAGTACTGGGGGTGCTGAGA
CTCACACGTGGGGTAGTGCCTGCCTGGTACTCAGAAAAGGTGGTTGTTCCCTGTCACCAC
ATAAAGCCAAGCATGGTGGTACCCCTCTGTGATCCCATCCATGGGGCGGATATAAGGAGG
TTCCAAAGGTGAAGGTCATTCAGTTCCAGCCTGGAATACATGGGACTGGGGATTGAGAGT
AGAGATGTGGCATCTCAAGACACAAGCAGCAGGGGAGCAAGTTTACTTTGTTTCCGTTTA
ATTCCTTTCAAAACATTAGGGAAATACAGATCAATACAATCAACAGCTAACCCTAGTCTT
AAATCACTGAATTGAAGTGTCTTTTCCCAATTCAGATCTAGTACCAAAAGAGAATCTAGA
GAACTGGCTAACTTACTTGAATAAGGAATTGCCAACAGTGGTGTTCAAAGCCTCAACAAA
CTTAAAGAACAGAAAGAAGACATTCAAGGTATGCTGTATTAGTGGGAGGAATTAATGGGT
TTCTTCATATTTGTGATGATTGAAATATGATGAGCATACAAAATGTTGATTACAGTGAAA
AACAGTAAGATCCAACTCTGATTTCATTAAAGATCATCTCAAAGGCAGTAGAGGCCAGCA
GTTTTTCTGGGAGCTGGACTCTGGTGCCATACTTTCTGGATCCCACCCGGTGATATTTAC
CAGAATTTAAATTGCCGTATTTTTTTTTTTTTTTTAATGTTTAAAGATAAAGAAGAAAGT
TGTTCCATTCCAAAGTAAACTCTGCTGTGGCAAGGAAGCACTGTGGAAGCTCCTTGGAGG
TTTTCAGCAGTCCTGTGGAAAAGGAGTTCAGGTTGGAGTGGTTGGTGCGTCTCATTCAGC
CTCTCCCACTTCAGTGCTGGGCGGGACTTCACATTGTGAATGTGAATGGGTTTGTTAAAT
CAAACTCTGGCTCACCTCACCAAAACATGGCGTCTAAAAGAGCCCAATGCTAAAACACTT
GCTGGTATGGGCAAGGCAACTACTAGAAAATAAGTTTATAAACATAACCTGAGTTTATGT
TTCCTTGTAGGTTTCCCAAATGTGGGAAAAAGCAGCATCATTAATAGTTTAAAACAAGAA
AGGATTTGCAGTGTTGGAGTTTCCATGGGACTTACAAGGTAAATGAACTGTCCGTGATCA
GAAAGAAATGAGTAGTGGGTGCTGGGTTACGAGAATTCATTGAAAAGGCCCAGGTACCTT
ACAGCTGAGTTTGAAAAGTTAAAGAAAGCTCCCTCAGAGAAAGTAGTGTTGGACCTTGTC
TTGGAAAAATGAGGAAATGGCATTATTATGTATCTTGCAGCGTTCATTCTGAGGTTTCGA
GGAAACATGAAGCAATGATGACAGATTGGATCTGACTTTACTGCTATGCTGAGTTTGTTC
AATCCAACCCTGAGCTTCATGTTGTCTTGCCCTCAGATGTACAATGTCCCTGCTAACTCC
ATGGCTTTTTTCCCCCAGGAGTATGCAGATTGTCCCTTTAGACAAACAGATCACAATCAT
AGATAGTCCGTGCTTCATTATCTCACCTTGTAACTCCCCTGCTGCACTTGCCCTCCGAAG
TCCAGCAAGTATTGAAGTTCTAAGACCATTGGAGGCTGCCAGTGCCATCCTGTCTCAGGC
TGATAGTCAACAGGTAAAAGAATTCCCTTGAGCTCTTTACCACTGTTCTTTATACAGATT
AAGGACTGACGGTTCATGTTTTGCTTTTAAGGTGGTGTTAAAATATACTGTCCCGGGGTA
TAAGGATTCTCTGGATTTTTTTACTAAACTTGCTCAGAGAAGAGGTCTGCACCAAAAAGG
TGGAAGCCCAAATGTCGAAAGTGCTGCTAAGCTGCTATGGTCTGAGTGGACAGGGTAAGG
TGTCTCTGTATTGGTATCTTGGAAGACAGCTTAGAGTAAAGGGATTGGCCTATGTTTGAC
AGATCTTGTCTTTAATGCCAGTGCCTCATTAGGTTACTACTGCCATCCCCCTGCATCCTG
GAATCATTCTCCTCATTTTAATGAGAATATTACAGCAATCATGAAGAGGGGCTTTAATCT
AGAAGAACTAGAAAAGAATAATGCACACAGCATACAAGGTAAAATTGTTACATGAATGAA
CGTATCATGATAGTTAATAAGAATGACAATGCTGGAGGGCTTCTCTATTAACATGAGTTC
TATTCCTTTCCACTAGTCCTCAAGGGCCCTCATTTAACTAATAAAATCCTTTTCCGGTCT
TCGGGCCTGACAAATGGAATACTAGAAGAAAAGGACATCCCCGAAGAGTCACCAAAACAG
ACAGAAGACCAACAGGATGGTGATGATCAAGAACATGTTACTGGTGAAAAAAATGTAAGT
TTTGTTTCTTGAGTTAATGCTGAAGTTTTTTAGCATTGCGGTATGGAAAGAATAAGGGGT
CAAAGGTAGAACAAAACATTTTGACAAGAAGCAAAGCCAGCCCCTGTACGTTTAGGTATC
TAAAACAGAACTGTTAACAAATCCCTAGACACCTCTATCTCTATAGGGTTAATGAAAAAC
TACCTGTTATTTCATGCTAATTTCTCGGCCCACAGGCAGAGATCTCAGATGTGACTCCTG
TAGAAGAGACCAGGGAGATGTCACCTGGGCAATCAACAGCAAGTGAGTTGGGGAATAGCA
CTCCTAACAAAGCAGTTTGAGAACAATTGCTTTATTCTCTTGTAAAAAACTTCACTTTTC
TTTTTCTCTGATACAGGTAAACCATCTGACAGATCCTTTATCTTGGATAAAATGAGTGAA
GAAGACGATGCCTATGACTTTACCACAGATTATATATAGCCTTCTAAATGTTCAAGTGTG
CTCTGTACAGTGTTTCTAGATTGCTTTGGTATGATATAAAGTGTAAATCTTGTGAATATG
TATCATGTTCTAAATTAAAAACAAAATAAAAAGTGTTTGTATATATGTGTTTAAGATTTA
TTCATGGCCAGGTGTGGTGGTGCCCAGAACTCAGGAGGAAGTTCTCTTTGGAAATAGGTT
TCCCTGGAATGATAAAAATTTTCACCTGATGTGGGGGAAATTGAACTTTGGAAGAGCAGC
AGTGTTTACATTCTTAAAATATGGGCAAGCAAAGGTCTATTGGAAAGTTTTATTTTATTT
ACAAACCAGGCCACAGGTTACAAAACTAAAACCAAACAGCAGTTCCTACCTACAGCAGCT
TAATGAACTTAGGCTGGTGTCCTCATTCTGTCCTTCAGGTCAGTCAGCAGTATAGTAAGT
AAGCAAACATTTGGTAAGGCAGATGGAGACATTGGTAGTCATCTGGAGATCTGTGATCTC
TACCCAGCTGACATGTTTTCTGTGGTTGGTACAGAGAAGACTCTCAAGCCCTACAACTGT
TATCTTCCCACATAGTGTGTCTTCCAGGATTTCCTGAGTGTCATGTTTAGCTTAGATTGT
AGTTCACTTTATGTTTGAGGTATCCATATGTCTTCGGATTAAACTAAATTTGCCTGTTGG
GTCTGGAATATACCATTTCTCCCAAACGTCAGCATATGAAGCAGCTCTTCCCCAAGGCTT
GAAGTGACCATTCCAGTGAAGTAACTTGGCAGCCTTTACAAACTGGGGTGAATACCGTTT
TCCAGCACTGGAACCTTAAATAAGAAAGTGCCAAATAAGACAGAATGCCAGGCTAGGCTG
AAGAAACAAAGGAAGACGCTGGTTATCGTCCAGGATATGAGGAGTCAGTCCAGGATAGGT
CAGTGAAGCCGGTGGGTATTTATTTTGATGTAGGGTCTGCTAGGTGGCTCTGGCTAACCT
CAGAACTCACGGTACTCCTTGGCTCCCAAGTGCTAGGATTACTAGCATCAACCATTATTC
CCAGCTTGACTTGATACTTACCAAGGTGGCGGACATTCCACATAGGGTCAATGGTGGAAT
GCTGCTGATAAAATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1118, 1896..1954, 2332..2469, 2574..2684, 2825..2905, 3302..3434, 4415..4527, 4786..4903, 5110..5197, 5538..5712, 5791..5933, 6021..6157, 6256..6413, 6635..6701, 6796..6994
1106..1118, 1896..1954, 2332..2469, 2574..2684, 2825..2905, 3302..3434, 4415..4527, 4786..4903, 5110..5197, 5538..5712, 5791..5933, 6021..6157, 6256..6413, 6635..6701, 6796..6875
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved