Rattus_norvegicus Locus Rpl17
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rpl17
Rattus_norvegicus
Rpl17
18
SNORD58, SNORD58, SNORD58
1721..1786, 2115..2179, 2548..2612
5107
ctccccacctcacctcacccctgtcgtttctcccccactcccaccctacttccttagcc
tcccaaggactggttttgtaaactagtctttcatctttttgtgaagacagggtttcatgt
actgctggctggcctcaaatttttttattttattaaattaattaatttaaaaattagatt
ttatgtgtatgcatatcttgcctgccaagtgtgtgcaccacgggtgtgcctggctagaag
aagacatctcattgcctggaactggagttacatatgtgagctaccttgtggatgctggga
accgaacttggtcttactcaagagcaacaaatgctattcactgccgagccatctctccgg
ccctggtctccattctaactaacaagactaacatttcaggtatgaggcaccaggacatat
gtccttaggctgtttatttaagagaggatctcactatatagccctggctggcttcaaact
tggtaaggtccactgcctctacctggaatttaaaggctagcacagccattcctggctctg
ccctttcatctttttttttctttttctttttttttttcggagctggggaccgaacccagg
gccttgcgcttgctaggcaagcgctctaccactgagctaaatccccaacccctctggcct
ttcatcttaaccgttcatttacagaccactttcagagggtacatattgacaataatcaaa
tctaacaacgaccatggctacatttctcgttcacttctaataattcgtgtcctatgcttc
gagattctatttatttactgacacctaaacccatacactttaatttcggagttaaagaga
gagaaagtccctaaagactcacttcttctcaaactttctaaaaacttcccacacttcctt
ccttctccgccctcctactcctcggatctcgttccttgggcaggaagtctcgcgagaggt
cgaggtctcatgaattctcccagtagccttcgcgcttcctcTTCCTGTTAGCGGCCAGAG
gtgagtgttactcggcgtcgggctctcggggcgaatcctccgccatctcggccttgggag
cgctggcgtcgcggtcccggcatctgagctcgaagggccatgggtcctcatcacaagcgg
ccgtgctctgtgtggaggagcgggggcgcgtccgacttagagcccgggggcgcgcaggcc
tctgcaggccgcggaacagcgtgaggggcgggcatgggtgaccgggccggcggaggtgct
cggatcagaccgggacgcccgaggcttggcttctgcgtggaggggcagcctaggcccggg
tgagagtgctgagatgagcgccgggtggaggctcagtgctgtcccttgggctgctcggga
cgtgggtatgtagggaggctgcgaagtcggggggaaggaggggtctgcagagcgctgtgg
ctccactgtgccacgctgctgctaagtcccagtctggagaggcacggggttgagaacagc
cttagtcccgagggcaaggcgacatcctcgtgctcccaccttcatgaagaaaggaagtgg
gcattaagaaaatactccgtgcagggtcagggtggtgcactcctttaatgccagcattga
ggaggcagaagcaggcgggtctgcgagttccaggaaagccaggcacttaacacagagacc
atgtcccgtacctccctcccccccaaaaaagaaaaagatggctgcgatgatgtcatttct
taggacacctttggattaatcatgaaaatagctcttctctgagcagctgtcggtagttta
aacctcttgggttactagctgatttgtgttagttactagccgttgcgttcacAGGTGACC
TGTGAAGATGGTTCGCTACTCCCTTGACCCAGAAAACCCCACGAAATgtaagtgactgaa
aagggcatgcttctgttttgacttgtgggtttttttattgtgtgcttggcctgttcgtaa
atagaaaaaaaatggatgtttttcttttgcagCATGCAAGTCAAGAGGCTCAAACCTTCG
TGTTCACTTTAAGgtaaggaaaatgtgttgatgttaaagaatcctaatttgctcctgagt
atctttgaaaggtagctgcagtgatgactttcttaggacacctttggatttaccgtgaaa
ataagtaaaatctgagcagccaccttttatatgagtagggcatgaggtgggggtgcttga
gtaaaacctgccactctagtgtggagcacaggtataacaatacaagaaggtagagcttaa
ctaaattcctctcggaaaatttaatgctgttaaccaaacctttctggcttctcttagAAC
ACCCGGGAAACTGCCCAGGCCATCAAGGGTATGCATATCCGCAAAGCCACCAAGTATCTG
AAGGATGTCACTTTAAAGAAGCAGTGTGTGCCATTCCGGCGGTATAATGGTGGAGTTGGT
AGGTGCGCCCAGgtgagaaatctttgaagatgttgtaaagattgtaaaggagtgggagag
tagggtaaagtctttatagtcagttgggttgctgtgatgactatcttaggacacctttgg
attaaccgtgaaataaaacatgttctgagcaaccttggtgttggcatggttctcaattgg
gtctcatttgattcatcaaggaaagtaacaaactgcttacctgcttttctttcagGCCAA
ACAGTGGGGCTGGACACAGGGACGGTGGCCAAAAAAGAGTGCTGAATTTTTGCTGCACAT
GCTTAAAAATGCAGAGAGTAATGCTGAACTTAAGgtacctgggccattgctgtcctttcg
gtctatcctgaggtcagtctggtttactagtaagaaactgtcttagaaaaaggagccaag
atgactacctttatgtcttgtgcctctatctagtgtcccagaattctgcttaaagaggtt
tagggtcatggtgtgcttatgtcctaatagttcctccatccccggtcctatagaagaagc
atttcctttggtctaggggtttatagcttattgagtgtaaatcagggtgtggcaccccaa
aagaaaaattttcatttacttcatgctgttgaccttgtaattgctagcattagcaatggt
gtagctgttgacagctgtgtctagtggtaggataattatactctataatatgagaagttt
aaaacaatgaggttgagccttttttacaaaaggaaaatttcgtactgttagggaagtgtg
acagccccaatggctactgacagcatgtgttaaactacattttatggtagctgaatgtct
taataatgccttagaaataagagttgcctttcataaatgatttcacttgaaaatcactac
ctaaagtgcaaagtaacattgcactcaggaagttgaagcaggataagcaagaagttaagg
acatccaagttagaggctggccgttgggtgctgaagttttattgacaaacatgtttttgt
ctgatttttcttttccccctttcagGGTTTGGATGTAGACTCTCTGGTCATTGAACACAT
CCAGGTGAACAAGGCTCCTAAGATGCGCAGACGGACCTACAGAGCTCACGGCCGGATTAA
CCCATACATGAGCTCCCCCTGCCACATCGAGATGATCCTCACTGAGAAGGAACAGATTGT
TCCAAAGCCAGAAGAGGAGGTTGCACAGAAGAAAAAGgtaagttgctcagtttgctggtg
tatactgctagtgagagacgggtagtgacacagaccctagtaataactgaaggggaagct
gtactggcagccctttaccactttagtgtgacatagcactgcagaacctgtgtcccatgg
gactagtcagtcattgcatttggtgtctctacagctaaataatttaaccttggcgcgtgg
ccatttgtccttgatcttatgtagtcttcaacaattgagcttttcctgttaccttagatg
tggatttgagtcattctaagatttaatgttctagtctggaaacttaaatggttcctttgt
ttgtcttctcagATATCCCAGAAGAAATTGAAGAAACAAAAGCTCATGGCACGGGAATAA
ATTCAGCATAAATAAATGCGGATAAAGTaaaggtcttctgtggtctttataagccgatcg
tcttagattacctgttaataagccctgttaggagagatgcgctttagcatgcagaagaac
tttttactaattaagcagtgaaatagacatctcaaccacaggactgtgtaaatatgactg
tctagcttttttgagttagcatttactgaggagctcttatgcagaagactataggtataa
agtaaaaatgggcagtatttttatgtttcatttgttttatgtagtgtagtcttggctgtc
cttgaccttaactctggctttagattatgtccacctgcctttacctcccagtttcacagc
atcaccactaggtatcttagtctgtgatttttaaggtagtctgcaagtgcccccttaaac
atgagaccatcttactgatttgggggggaaggcaccgacacatgaaaaagctttctatac
tctcagacttggagatgagctgtttttttttttttttttttttttaaatattttatttat
tatatatttgagtacactgtagctgtcttcagacacaccagaagagggcatcagatctca
ttacagatggttgtgagccaccatgtggttgctgggattgttttttttttttaaagattt
atttattatatataagtacacactgtagctgtcttcagatacaccagaagagggcatcag
atcccatcacagatggttgtgagccaccatgtggttgctgggaattgaactcataacctc
tggaagagcagtcaggtgctcttaaccgctgagccatctctccagcccgagattagctgt
tttaagtgccatatctttgcctgttagggagacacccaaacagatgtgcatactcttgaa
tgggtttataaaggctgcagagaagggtcaactgcagactacatacatacatgcagtgaa
cctattaaattccaggggctgataaccattctctgactgcctcagccatacagtacaaga
aacattcc
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1019, 1852..1906, 2012..2052, 2337..2471, 2695..2793, 3505..3696, 4032..4107
1867..1906, 2012..2052, 2337..2471, 2695..2793, 3505..3696, 4032..4079
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved