Rattus_norvegicus Locus Tomm20
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tomm20
Rattus_norvegicus
Tomm20
19
SNORA14
1831..1964
14317
TGGCGTATATGCAGATAGAGCACTTGTATGCATAAATAAATCTGGGGGGAAAAAGCATT
CTTGCACCGGCTACCTCTTATCTCATCACTGTACCCAATTCCCAGAGACTACAGCATAGC
TTGTTACTGTCCCAGGCTTTCATGTTTCCTCAGTGAAGGGAGCAGTGCTGTACCAGACTG
TCTTTCCTTCAAATGCTGGCCACAAGTGCGTGGTGGGTAGGTCTCGCGATTAATGAGCTT
GTGGGGAATCTTGCTCAGATGGGTAAGGGGAGGCCGAAGAGACTGCAGTTTAATGATGGA
ACAAATCAGAGCCACCCGGAGACTTTTTTGCCCCTCTAAAACCCTCACAGGTTAAAAATG
TTTGAACGAATTACATTTTTCTTATCCGAAACTTATGACAGGGTTACAACATAATTAATT
TGAAGTCAATCGCCGTGTCTAAGCTCAGCCACAACCCAATTTACAAAGCAAATACTGCCA
GGTCAGGTGGTTCAGGCCTTCCTTTAATACCACTGCAAAGAGGCAGGAAGACTGCAGGTT
TGAGGCCAGGGCAGACTACACACCAAGTTCCAGACCCTACTATGTTCCAGACACTATTAT
GCTACAAAGGGGAGAGCCCATCTCAAAAAATCTAAAAAGTAAACGCATGCACTTCAAGTC
ACAGGTTTCCTGAAGGACACAAGGAAATGAGATGCTGTTCTGAGAGGGCTCCCACCTTCG
TCTTTCATAAGCAAGGACGGTGGATTAGAGGATCTGACTCAGCGTGCCACAAACACATGC
AGCTCCCAACCACTAGGTCGTGAGGGAGGGCGGGAGGCGCGGGATGACGCACAAACCCCT
CCGCAGTGCACGCCTCGCCCCCAGCATGGCGCCTCCGCCGCGCAGACAGGGTTATCTGCG
CGTGCGCACCAGGCGCTTCCGCTCAGGCACTGCCGCGGACACCCCGCCGCGGACGCCCAG
GGGTCCTCGCGCACCGGAAGTCCTCACACTCGGCCTTTTCCGTCTGGACTGCAGACAGGC
GGCAGCGAGAGACCGGCGAGCTCCGATCGGTCGGAGCTAACCGCTGCCAGGCGGGCTGCC
GCGGCCCCGCACACGCCCCAGTCGAGCGAAGATGGTGGGCCGGAACAGCGCCATCGCCGC
GGGCGTGTGCGGTGCCCTCTTCATAGGGTACTGCATCTACTTTGACCGCAAAAGGCGGAG
TGACCCCAACTTCAAGAACAGGCTTCGAGAACGTGAGTGGGCCCGTGCGTCTCCTGTTCC
CCTCAGGCTTGCGCGTCCCCGAGTGCTCCCCGGCGTCGTGTGCTGCGGCCGGGGTCCCGC
CTGTGCCCGCGGGCCTCCATCTTGGAGGCGACCTGGTTCCATCTTGCTGTTGGTGGAATG
CATGCTGGTTTGGGGGGAGGGGTAGCACTTTTTGCCTTCCACCTCTGTAATTTTATTTTC
CGAGACGGGTCTTTAGCTCATGCTAAAGTGGTAATCCTCCAGCCTCAGCGTTCCACCTCG
CTCAGCTCCATCCTCCCCATTAATCTTGGGGCGTGCGTGCGTGCGTGTTGGAGAATAGGG
TCCTCCTGTGTAGGTCAAGTTGGTCTAATAGGTTGTAGCTCATGCTAACCTCGACCTCGT
GGTAGCCCTTGCCCCCGCCCCCCACATCTCCGCTTCAGCCTAGTGCTGTGATAACAGGCA
CGAGCCTTTCCTTCCCTACAACCAGTGTTGAAAATCATCCTTTATGTGTGTTTAGGACAA
GGGCTTTCTGTAATTGGTAGGCCGACTTCGAACTCTTGTTGCCTACCCCGAAGGTGGTGC
CCCAACCCGCTTACTAAGTGCGGTGTCATCCTTGCATTCTTAAACCCTCTTGGCGGCTTT
GCTCTGGTGCTTCCAAGATATGAGTGAATGCTAGACAAAGTGCGGGGGAGTCCAAAGGGC
TGTGCTCCTCACGTGGCTCAGTCTTATTTCATACCTGCGACATCTTTTAAGAGGTTAACC
GGAGGGAAATCTTGGCATGCCTTTAACCAGTGTGTTCCGCCCGTGAATTTCAAGGGACTC
TTAATCGTTTTCAGTAGTCTGAAAACATATTTGTTGTAATGTTAAGCTAGCTTTTTTTTT
CTCCCCTTCGTTTTCGGGGGCGGGGGTGCCAGTAGTTCCATTCTCTAGTATTTCTAAATC
ATTTTTAACTTTTTCGTAGTTAATATGTGGTCGGAGACTGATAAAATAGACTTTATCATT
TACTGTAGGAGTTCGATGTCTTTCTGAGCCTGTGGGCCCCGAGTAGCCACATCATTTTCA
TCATGGGAGATGCAGAGAATTTTTGTCCCTTGGCTAGGTAGAGTAGTGCAAAGAATGCTG
CTGGAATTCATAGACTGCGTTTTGGGGACCAGATTGCTTAACACCAGCATTCATTAAAAA
TCTTCTTAGCTGCAAAGTAAGGTAGTACAAGCTGCCGCCTCTTGTTGGTTTGGTGGGATA
AATGCTTGACATTCCGAAGACTTCATAAATGAGGGCTGTGACTCTTGGGTTCACCAGTCT
ACACAGTGGGTTGGGGCTGTGGATCTACACATTTGGAGAAAGCTAAGCAGGCTGATGCCT
TCGGAAAGCCTTGTTGGAAATCTTGAGAAAGTCGGTTTGGGTTGGAGAAATCATAAGTTG
TCGTTTCAGGAAGATTGTGGTTTTGTTTTAATTTTGAGACAAGGTCTCACTCTTTAGACC
TGTCTGGCCTGGAACTCAGAGATAACCTGCCTCTGCCTTCCAAATGGTAGGATTAAAGGC
GTGGCCATCACGCCCTGCTAGGGTTCTTCTCTAATCTTTCCAGCGGTCCACCCCCTCCTT
TTTTTTTTTTTTTCCTTCCTGTGATTGAATCCATGGCCTTGTGCAGGCCAGGCCTTCCAC
CTCTGCTCCTACCTGTCACTTTCTGTGCTAGCCTGCTTGTTTTTCCCTCGTAGCTTTAGT
TAGAACCAGTTGATGTCAGGGAATTACTAAAGGCAGCAGTGACAAGAAAGCAGAAGCAAA
GCCACACGGTAGAAGTCCTTGGCCCTGATGCTGACAGCAGTAATTAATGAATGCTAGCAG
TAATTAATGAATGCTAGCAGTAATTAATAAATGCTAGAAGTTTTGTTTGTTTTGGCAAAT
TTTTGCTACCAAGTAGCACTCAATTCAGTCTCTAGATTGTGTAGTTGGGTGATTGTTAAG
AATTTGAGTCATTTACCTGATGTGCGGTACATCTTCAGTGGAAGGATACTTTCCGAAGTC
ATTTTGTTTTTTAATGGAAAGGGGTTTAAGTTTAGGATTTGAAATTAGGTTAAATATCTT
AATTCAGACTTTCTGACTTGTGTCAATGGGTGATCATTACTCCTACCCCACCTCCATTGG
TGTTAGGCATGACCTGGGGTATCTAAATAGTTAACTGCCCACTGCAGGTGCATTTCATTT
GTACTGCACACTACCAAAGACACTTTATTTAGGAGTTCATTAAATAGATGATTTATCTTA
AACAGTGGCTTGGGTTTGGAGTGGCTCTGACCTCAGGCTTTGCATGCTTTTGTTGTTTTG
AGACAAAAATCTCTAATCCTGGCTCTTCTTGAACTCAGATTTCCCCTGCCTCTGTCTCTC
ATGTACTAGGATTAAAGGCATTCACTTGGCTTTCAGGTTTTTGTTTTTGTTTAGTGGATA
TAGTCGTTTAAACTTGGTAGATTTACAAGTCTCTGAAGCTAATACCAGCACATAATCAAA
CCTTGACTCTTGCAGCCTGTTAGCATTTGTGCCTTTATTGCAGAGGTAGTCTAGCCTTAG
GAAACTGAAGGCTAAAAGTGAAGCACAGTAAGGATCTTCTCTCTCCTACGCCTGCGCACT
GTGTTAATTACTTAGATGGTTATGGAGATTAGGTTCATTGCCCTTTATTATTTTCTCAAA
ATTCTGGTTTAGCACCTTATGTTTTTCATTGCTTGTTACACAGTTATGCTTCTTGAGGTG
GTTTTCATCTGAATGATGTGTCTTTGGTCATACAGAGGAAGGAATGCAGGGGGCTTGAGT
AGGTGTCCATCACTTATTTTAAGCATTAGCCGAAAGGTCCTTCAGTCACAAGTTGACTCA
GATTCATACATAGACTAAGGTTTTTAGAGATAGATGTTTTGCTTGGTTGGTGACTTTTGC
CTTTCTTGGCAACACTGATCTTGGAGAGTTAAATTTTCTTGCTTACAGTTGCCTATCTAG
TGCATGGGGAGAATGAATGCCCTTCACTTGTCCACCTGGTTGTTGTCCGGGTCATAGGAC
TGAATAACTTACTTTCTAGGTTTGGGTATTTACTGTGGGAGGCCAGAATGGCGGAGTATG
AGCCCAGGCACTCGCACCACATGTTTTACATCTGCCGACTCAGAAGTCTGCTACAACCCT
CATGGTTATTAGATGAGTTTTATCAAGGACAGGTTCAGTCTAGTGTAAGCGTAAGGCATT
GCGTACAAAACTGGCAGGTGGTCCCCATAAGCTAACTCTTTCTTAGGACGTACTGTTACA
GAGCACTGAGGTGGTTTTTTTACCCCTCTTTCTCTTGCCGGTGTTTCTCTTGCCCCTGTC
TTTTGGTGAAATGTGTAAATGCTGGACTAGTTGCCTGCTTGCCTGTAATACCTGCACTTG
GGAGCTGGAACTGCAGGATACAGAGGTCAGGAGTCTCAGCGCTGTTGCAGTTGTAAGCCA
GCCTGAGTCACAGAGCTTTCAAATATTTTATTTTTACAGAACCACTTGGCCTAAGAAGAG
ATGATTTTTAATAGTAAAGCTGAAATCCGTACATTTCAGTAATAATCGCTTAATTCTTTT
ATTTGGAAAGGGAGCATTGTTCTGCTGCACAGCTGTTGGGGCAGTCCATCTTGTGAATTG
CTGGACCTAGGGAGGCAAAAGAAAAGAGAAAGCTCCTATTTGAAAGCATTAGTTCACTTA
ACCAGGGAGGCGGGGATTCTGGAATCAGGAATGCTTTGTAGAATTAATGATGGTTGTAGC
ATTAGATGTCTTGATCCTTATGATAGCCAAATTTTTATTTTATTTTTCTTGTAGGAAGAA
AGAAACAGAAGCTTGCTAAGGAGAGAGCTGGGCTTTCCAAGGTAATAAAAATAGTCTTGT
GTTTTTTGTGTGTAGACTGCATGCTCTCCAGGCCTCCTTTATTTTCTTTTGGTGGTAACC
AAAATAGGTGGTAACCAAAATAGCAAATAGGTTAACTGGACAAGCAGCAAGGTGAGGGCT
CCAGAGATGGACACCACGAGTTAACTCTCAGCTACTTGAAAATGGTTTTTAAAAAAGCAG
CATTTAATTGGATTTTCCTTCCTTCTTCTCACAGTAACCTTTCAAAGATCCATGCCTTTA
ATACTAGTTTGGGAAACTCTGCTAGAGGCATCCTGGGCAGCATTGTTTACTGTCTTCAGT
AGCAAAAAGAACGAAGTGTGTTTAGTCCCAAGTATCTTTAATGTTTAACCTATGGACCAG
AATTATTATCAGGTTCAGACAAATTTAAAAACAAGTTGTAATTTGTGGGATATAAATTTT
CATTTTTTCTTTTTATAGGACCCGAGTTTATAATTTTTAGTAACAGTAGGTTTTTTATCT
ACTTGATTTAAAAATAAATCGTTTAAATAATTAAGCAAATGCTACTCATTGTACATATCA
ACTTTCCCTCTTGCTGATACTCTTTCTGGATTTGTAGATGAACTAATGATCACTAATGGT
TCTGTTAAAAGCACACTCAGGCAAGCAAAAATGATATTGATAAATGCTACACATTTTGCT
ATTTTGAGCCAGTTGAGTGATTAACATAGCTGGTGGGAAATGGTTCTAGTGACGTGAAGC
TGGGAACTACTGTTTTTCTAGTGTGTGCAGACTTCCTTTCCAAGATGTGAGCTGTAAGGG
CATAACATAGGATCTATATTCATGTGAGTCTTACAGGAGGTGTATTATTTAGGATTTTAG
AGGCAGAAATGGACTTTGTGTGCTAGGTAAGCTCTGTACCTCTCGGGCCAGCCTACAAGA
TCCTGTCAAAAAGAGGCCTGGTGATCTAGCTTAGTGATGGGATGCTTTCCTAGTATAGCA
TGCAAAGGGCCCTAGGTTCAATCCCAAATCCACCAATAAAACAAGTTGTACATGTGTGTG
AATATGTACATATGCGTGCACTCATGTAACAAATACAGAGAAATCCTATCCTCGGTGCAC
GTGACAATGTGTGTGAAATACTGTTAAAAGAATGAATGGGTAATAGTTTAATATTCTATA
ATGGCAAATAGAGGTATATAGGTAATAATACCAAGGCTTCTATAGACTATAGATAATTGT
ACGCTTTAGCTTTTTCCGTTTTCTTGATTCAAGGGTTTTGTTTTGTTTTTTGTAGATAAA
TCCTCAGCTTAATTTCTGTATGTTCCATTTCTAGTTACCTGATTTAAAAGATGCTGAAGC
TGTTCAGAAATTCTTCCTTGAAGAGATACAGCTTGGTGAAGAGTTATTAGCACAAGGTAA
TAGTCATTTCAGGATTTAGAAACACATAGAATTAATTCTATTGATAAATATTTTTGACAG
GATTTTCTTCTAAACACTTCAAGGTAGTTTTTTGGTTATGTTAGACTGAAACTGGCTTCA
GAAGACAAACTAGGTTGCTGTTGTCAGGCCCTGTGATTGAAGTGAGCTTTAGAGTTTCTT
GTTCTGTCATAGGATGTAGAAGTTAAGGTAACAGTTGAATGAAATCAGGAGAGAACTTCA
TTTTTGCAGTGGAGATGACTCTCAAGTTATTCGGGGTGTTTGGGTGTCGACATAGTGCAG
AATAAATAGTAACAGTGAATAGGAGGTTATGACCGGAGTCTGCCAATACTCACCTAGTCC
AGGTTTTTCCAGGGTTGTAGGAAGGAGTGGCTAATAAGCCTAAAATAAAGTTAGTTTACC
TAATCAGAGTCCAGGGTGTACTAGGATCCTCTAAGAACAGAATTCGTAGTGTGAGCAGGT
TTGTGTGAAGCATTTATTGCAGTGGCTTACGGGCTATGGTCTGACTGGTCCTACAGAAAG
GCCAAGGACCTGGCAGCTTACAGCTCACAGGCTGGTGCTGGAGTCCCGAGAGGCCCCGGA
GAGCTGCAGCACTTCAGTCAGCATTGAAGTCCTAAAGAAGCTTGTTGTGACACCATCCGA
CGGGTGACTTGGGATAGATGAGCTTGTCAGTAAGAGTGAGGACAAGCAGACGGAAAGGCA
CAACTCTTTTTGTTGTGGCGATCTCCAGAAGGTATGGCCTGGATTTTGGAGGCTCTCCGG
CCTAAAAAAGTACAACCAAGAAACACCTCATAGATGCACTCCGCTGCTTGAGTTTTGGCT
ACTCTAAGATGTAATCAAATGTTAGCACCAGGCCAGGTATTGCCAGCTCGTCTCAGATCT
GATCAGTTACGTGGTCCAGTTACTTTGGGCCTCATTTAGTCAAGTACTTGTAATGAAAAG
TGATTTTGTTTTAGAATTGGGCAACACTTTGTTCCATACAGTAGGATGGTCCCATTGTTT
ATTAGCTTTTATCTAAAAGTAGTTTTGAAGTTGTCGCTGTCATTAATAAAATTGGAATTG
TGTTTCTAGGCAGTGGTGGCCTAGGCCTTCAAACCCAACACTTGAGGCAGAGGCAGGTGG
ATCTCTGAGTTCAAGGTCAGCCTAGTCCACAGAGCAAGTTTCAGGATAGCCAGGGCTATA
GAGAAACCATGGCTCAAGAAACAAAAAAAATTGGTATTGTCTTAATGTTGTTTTTTTTTT
TTGTTTTGTTTTTTTGTTTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCTTGAAAGATTGTTCAGTGGTTAAAGCACCGGCCGCTCTTGGAGAAGGACCCA
GGGTCAATTCCCGGCACCCACATGGTGGCTCACAACTGTCTAACTTTAGTTATAAGGTAT
TCAACATCTTTTTTTTTTTTTTTTTAGATTTATTCCTTTATTATAGAAGTACACTGTAGC
TGTCTTCAGATACACCAGAAGGGGGCATCGGATCTCATTACAGATGGTTGTGAGACACCA
TGTGGTTGCTGGGATTTGAACTCAGGACCTCTGGAAGAGCAATCAGTGCTCTTAACCACT
GAGCCATCTCTCCAGCCCGGTATTCAACATCTTCATACAGACACGAATGCAAACAAAACA
CCAAAGCACATAAATTTTAAAAATTAAAAAAAAATGTATGTGAGATATTTACAAATTCCT
AAGGGAGTGGAAGTTAGAGGAAATCTCACAAACATTTCTCTTCCACCTTTATGTGAATCT
GGGGATTGAACTAAGGCATCCAAGTGAGCACCTTTACTTGCTGGGCCACCTCACTGGCCC
CAGATTACTTACGTTTCTTTCCTAAGAGAAAATTTCTCTTGACTTTGTTCAATTGGTTTC
ACTAAGAGTCAGAGGTAGTTCTTGTATTCAAGTAACTAGCAAACTTCTTAGTGTCCAAGC
TTTTCCTAGATTAAGAACAATTGAGTAGGAAAACTAGTCAGGAAGTGTTAAGTGCAGGAG
ATAGATACTATTCAGGAAGCTTTTCCAAGACGCCCTACGGAGGGCCAGGCATTGTGTGTT
CTCAGAGTCAGCTGGTGTTCAGCCTGCTGGTTCCTCGGACAGTTTGAGCAGCAGCAGCAG
CACTGTCGGCTCAGCAGGAAGAGACCTGGTGTCTTGTGCATCAGTGCCTGTCCCTCAGCA
GGTTCTTCCATGGGCGTCATATCTTAGTACCCCAGGAAAGGGATTGGGCACCTATGTCAC
CGTGAGGTGGCAGGCAGTGTCTGATTTGTATAAATGGCACAAACGTAATTCCTGCAGGGA
CAGCAGAGATTTGGCTATTTCTGATGATGCATAACAGCCCATGAAAGCCGTGGGTGCTGG
CGCCTCAGTTTTTCCACAGCTGCCAGTTGGTAAAATGTGCTCTTTTCCATGGGTGCAAGG
AAATTCTCTACCAATTTTTACTTGCCAGTGATTTGGGCTAGGAACAATTAGTTGGTGACA
AAATCTTGATGGCGTCAGATAACATGCAGTGTATGTCTGGCAGGTGACTATGAGAAGGGT
GTGGACCACCTGACAAATGCAATCGCTGTGTGTGGACAGCCTCAGCAGTTGCTGCAAGTG
TTACAACAGACTCTTCCACCACCAGTGTTCCAGATGCTTCTGACCAAGCTTCCAACCATT
AGTCAGGTAAGGAGGTGAAGTGTTTCAGAGTAACACATGATTTGATCTAAGAACTCTATG
CTTAAGGACAAGTTTGCCAAGTATGTAATACTGGATACATTGTCCGGTGAGCTAGCAAAG
GTCCATACTTGGGTCAGATGTGAATCAGAAGTGTGAGTACTCGTGTCAACTATAAGAATG
AGGAGTGCAAAGTCAGTCTCAGAATACCTACTGCATGTGCCAGTTTTCACTTTGAAGTGC
TCATTAAACTGCCTTACTTGTGTGAGTCACATTCCTCCCTTGATGCTGGTTTGTACCTCA
GCTAGATTGGAAGAGGCCTGGGGAAAAATTAAATTTCCCCCCAAAGATTTGAAGAAGACT
TAGAAAACCAAGAACTTGAACCAAATCTTTTAACATTAGACTAAAATAATTATGTTCCGT
TCATGCCTCGACTGTGATGCTATAATCAAAATTCTGGCTGCTGTGGCTATAATGTGACTA
AGAGTCACCTGGCTGTGTGACAGAATTGGAAAGAGAACCAGCCATGTGCATAATGGGCAG
TGAAGAGCTGGGAGTAAGCCGTTAATTGCTTGGTTCAGGAGGGTTTTTCTGCTGTGAACA
GACCCCATGACCAGATATTTAACTGGGGCTGGCTTACGGGTTCAGATGTTATCAAGGCCG
GAGCATGGAGAGAACCAGGCAGACCTGGGCTGGCTTCCATGCAGCTAGAATGAGGGTCTT
AAAGCCCACACCCAAAGTGATAAACCCACTTCAACAAGACCACACCTCCTAGGAGTGCCA
CTCTGTGAGCCAGTCATACACAAACCGTCACAGGTACCTTCCCATAGGTCTTCAAAGACC
TCAGATTCTCAACACTGCCACCCTAGTGCCTGAGCCTCCAGCACAGGGAGGCTCTGCTGA
GAACAAAGCTTGTAAGTCGTGCACAGATTGTGGTGAATGTTATTTTGGCGTGCGGTGTTC
TCTCCGTGGTGGTTGTAGGCTGGCATGGGAGATGACGGACGCACAGCTGACAGATGTGTG
AGCACACCCCTCCCTCACCACCACCACCTGTCCGATCCCCTCTCCCTAAGCTCAGCGTCT
CTAATGCTGAGGGTCCAGGACTGTGTCACCACGCCCAGCTGACCTTTTATCTTCTGTATG
AGACAGGAGTGTGAAATATGGGAGAATTTTAGCAAGAACTGGTTCTTTGAATATGAAAAG
CAATTTAAGTTGAAACTAAAATTGAGACACTTCTCAAAATTAATTTTTCTTTTTCTTTCA
GAGAATTGTCAGTGCTCAGAGCTTGGCTGAGGATGATGTGGAATGAGCCAGACACCAACA
TGATAAAATCTCAGTAAAATGATAACAGTTAGCTGCAGGCTGCTCTGCTCGGGGGGATAA
GGGCAAACTGTGCTTGTCATGAACTGTCTCACACTGACATCTCCAAAGTGAACCTGAACT
TTGGTAGAGCCATTGTCTGTTCTATTTATTTTTCCAGTGAGAAGTATTTTGATAGCTTTT
CATTTTATAAATACACTGCGTTAACCAAAAGATCATGGATTTCGTTTGTTCTTGACATGC
AGTTCAATGTAAATACAGTAGTATTAGGTAGAGACTCCTGGTGATTTTAAAGGATTGGAA
AAGACTGAGGAATAGTTGAATAATGCACATTTTAAAGACTAGAACATTTTATTGTACGTT
GTAAAATTGAGTAGAAACTTGTGTTTGTGAAAACTGAGCATTAAAACCTTACAGAGACTG
TCTCTTGTTTACTTTTAAACATGTGTGGAGTGTTGTCTGTTAGCAATTCCATTCCCTCCC
TGTGTTTCCATAAAAGCTTCTGTCTACATCAGTGGCCTCGTGCTCTGGGCGCTTGCTCCT
AATCTTCAAGCACCTGGATGTAGACCTGCGTGCGCCTCCTCACCTGGCTCTTTAGTCTGC
CTGTCTCTGGGGCGTCCCATCTCGGCATTAGGTCATTTGGTTCTGCTGAGTTGTCTTCAG
GTCCATCTCCAGCTGATGACTATTTCAGAATAACCAGGCCTCGCACTTGCTTATATCCTG
AATTGCATGTTTGCCTGACTTAGTGTTCCTCAAAACCTATAAGTGGAATAATTTCTTTGT
CAGTTGCTACTGATGTAAAGTGATTCTGTTACTGCTGTGTAAATTAGTCAGAAACTCCTT
TTTTTTTTTTTTTTTTTTTTTTTTGGTTCTTTTTTTCGGAGCTGGGGACCGAACCCAGGG
CCTTGCGCTTCCTAGGTAAGCGCTCTACCACTGAGCTAAATCCCCAGCCCCCAGAAACTC
CCTTTTTGAGGAAGGTCTGGTAGTCTACTTGTGCAAGTGTTGATTACCCTCTTTCTTTTA
GCAGAATTTTGCTTCAGTCTTACTGTGGATTAATTTATCTTGTGCAGTGACAGTGGAGTG
CCATCTTAACTGGAGACTTGGCTGCAGCAAGTGGGAGACAGACCTTCTTAGATGGTGGCC
GCACTGGCCATTGAACCTGTTTCTGAATCAAGTATCAAGACCTTGTGGTCTGCTAGTATC
TGTCCACCGAGCAGCATTCTCCTGGGACAGCTCCCTTACATCTGTGCTATAGACTTGTTT
TGGCTCTCCTCACCTTTTCTGGGGTAGTGTAGTGGGGAGAATCTGGAAGGGGGCTTTAGT
TCCCTTCTGCCTCTGGTTGGTGTTTGGATAACAGCTTTGGACAACTCCTCTCACTCAAGA
GCCTTTCTCTAGTGTTTTCTGATGAAATGTCAGACTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1231, 5034..5080, 6394..6475, 11443..11585, 12841..13317
1111..1231, 5034..5080, 6394..6475, 11443..11585, 12841..12882
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved