Rattus_norvegicus Locus Rabggtb
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rabggtb
Rattus_norvegicus
Rabggtb
2
SNORD45, SNORD45
1335..1415, 2331..2401
7269
GTGGGCTGCCGGGCGGGCGCCTGTGCGCAGGCGCGCAGACCCTGACTTTCCGTGCTCCC
GCGCTCTTCAGTCTTTCGGCGGTCGGACATGGTGAGAGCGACATCGCTTTGGTGCGCGGA
AGTTGGGGAGGCCTGGGCGGTGGGTCAAGCTGCTCCGCATCGTGGGCTGGCGCAGCACGG
GGAGCGGGCGGGCATGCAAGGCTAGCATTCTTCTTGCATTCTTCTTGTGAGCTCTCAGCA
ATGCTCCTGCCTCGGCCTTCTGAGGCCGGTCTTAGACCGCTCCTTGAGCAATGGCTCAGC
GTTTTCTGCAGTTCTCGAGGGTTGTGATGTTATCCGCGGCCCGTAGGCGAGCCTCTCTGG
ATTGAGCCGCCTTTTTTTTTTTTCCCTTTGCATCGGAGACTTGTGTGTGCCTGTTTTTTT
CAGGGTTCAATGATCATTTACGAATATTGTTTCAAAGTTAAATATTCTAATTGGGATGGA
AGAAGGCCGGCCTTGGCCCACGCCTTTTAATCGTATCACTCCTGAAGCAGTAGCAGGCAG
CCTGGTCTACACGGGGAGTTCCAGACCACACAGGGCTTCATAGCCGAGACTCTGAACAAA
ATAGAAAAATAACTTATTTGGCAGTGGATTTGCTTTGACCTACTTAATGGGTGATGGCGA
ATATCTTAGATCCGAAGGTGAAATTTGGAGCTAATGGGCCTGATCGTTTAGTAAAGGAGA
TAATATTTGAGGACTGTTGAACAGTGCACTGAAGCTTCAAATTCACCGATCGAGAGTGTG
TATTGCACTTGGTCGGCAAAAAGGTGAGCGGCAGAATTCGGGTCAATGATGAGCTGGCAT
GTATTCTGAATCTAAAGTTGATTAATAACCACTTTAGCTCTAGAATTACTCTGAGACCCG
AAAAAAAAAGTGCCGTCATCTGGTCATACGAGTCTGGGCTGTCAAGTTTTCAGGATGTCG
AAAGGAAAACGTAATGATCCAGTCTCTGTTTTTCTTCGAAGGGCACACAGCAGAAGGACG
TCACCATCAAGTCAGATGCGCCTGACACCCTGCTGCTCGAGAAGCATGCTGATTATATCG
CCTCGTACGGCTCAAAGAAAGATGATTATGTGTGTATGAGTTTCTTGTTAGTTTAATACT
AATGGACAGGCCTGTTTCTTAAAGCGTTGTCTGTTGGCAGAGGCCTGATTTAAAGTCCAT
TAGGATAGATGGGCCTGGTATACTAGAGGTTGATACTGGATAGCATTAGCCTTGCATACC
GGTACACAAAGGGCCAGAATACAGGGATGCAGGTAGAAGGGGTTTACTCCTTTCTGTCTG
GGGTATAACCTTGAAGGTCAATGATGTGTTGGCATGTATTATCTGAATTTGCTGATGTGT
CCTAACATTTGAGCTCTAGAATTACGCTGAGACCTTGAAAAGGTTTTACCTAAACAGTAT
AATAGGGAGGTTACCACACCCCTGTGATAATCTCCAGCAAGGGGTAGAGCTGGAAACCCC
GGGCTTTGTGGGGAGACCCTCTCCAAAGAGGAATCACATGGGTAATCAGACCCTTATTTT
GGGAGGGGGGGAATCATAGGCCTAAATGGTCCTTATGTCAACTGTCCGCCTGGCCCTTTA
GGCGTTTGGTTTGGCTTGGCAGCACACCAATGACACCTGTACCTGAGTGAACGCTTGTGA
AATGATGCTTGATTTGGTTTCCATCTCCAGCACCATTTATCTCTCCGTATTCATAGACCT
TGTAAAATGCAGTAATTGGTGTTTGGTAGACTGAAGGAGTGAATGTTGCCTACTAAATTC
ACCTGAAGTTGGCACTTGGAAACTATTAAAGTTTGTTCTCAATCTTCCTGATGCTGCAAC
CCTGTCGTACCATACAGTTCTGCATGTTGTGGTGAGCCCCAACCATAAGATAGTTTCATT
AGTTCAAGACTTAATTTTGCTGTAATGTCGGACCCAAAGGGGTGAGAACCGATGCTCTTA
AAGTTGTTCACAGCTGACCTAGGTAAAGGTGGGTTTTGTAGTCAAGAGTGACAAATTTAA
GACACTTCTCCCAGGAATACTGCATGTCCGAATACTTGAGAATGAGCGGCGTCTACTGGG
GCCTGACAGTGATGGACCTCATGGGGCAGCTTCATCGGATGAATAAAGAGGAGATACTGG
TGTTTATCAAGTCGTGCCAGCATGAGTGTGGGGGAGTCAGTGCCAGCATCGGGCATGACC
CCCACCTTCTCTACACGCTCAGTGCTGTCCAGGTAAGCCCTTGTGAAACATTGACCCTAT
GTGACGACCCAAATGTTAATTGCCCGCCTTTAGAGTGAATTCTCTCCTACAGGTCAGTGA
TGTCATGGCATGTATTAGCTGAATGCTAACTTGATGCAAGTTACAAATGGCACTGAGACC
TGGGAGGGTAAAATGCATCTGTGTCAGTCCAGGTTAGAGTTGGTTTTAGTGAGGAGCGAG
AGGGCGGGTAAAGCCTACCTCTGTCAAATTATCAAAGGAATAAGAAATTGTAATGAAATG
AGTAACAGCCGGCGCGTGTGAGCCATTTATAGTAATGGGGAAGGGCATGGTGGTTGGCCC
AGGACAAATTCCTGCGATGCTTGTCTTTCAGATTCTCACTCTGTATGATAGCATCCATGT
AATCAACGTAGACAAAGTGGTAGCCTATGTTCAGAGTCTACAGAAAGAAGATGGTTCCTT
TGCTGGAGACATCTGGGGTAAGATCGGCTTTCACTTTTTTTAGTCAAGCTACTCCACTCG
GAGCATCTTTTGTCTTGGTGTAGTAATCATAAGATTTCAAGTTGTTCATCTTTTCAGGTC
CCACTAAGCAGTTGGTCTAACTGGAGTAAAATGGCCTGCTGGAAGTCCCAGCATGCCCCG
TGCTGGCTTGTCAGCACGCCACACTAAAAGATAAGGTAGGTCCAAGTCTTACCCCCAGTG
TTGGTAGTTTTGAAGGGCTAACCTCCCTGAAGGTAAAGACCTGAGGAGGTCTTTAAAACT
AGACTGTCAAGGTAGTAAATACCTGAGTTGGGAGATGGAAAATTTTTCCTTCGATTAACT
TTAATCTGTTTTGGGGTGGAGCAAAATGCAGTCCTGAGACCAGCTGCTTTGTGGGATGTG
AACCTTTTATAAAGTAGGGTATTAATGGCGTTACTAAATTACTAACCTGAATTTCTCAGG
GCATATAATCCTTCATTTTGTAGGTTACTTTTCTGGGTCTGTTGCAAGCTAATTCGGAAG
GCTATTGCTTTCTGTTTGTCTAGCTGGGTTTCCTTACCTTGGGGGACTGTCTCCTAGTGA
ACATGGTCTTGGCTTTGGGAACTTTAATGTGCTGTATATATAGGTTTTGTTCTTGGGTGA
CTTGGTAGCATTTACATGTCTGTCCTGCCTTGGTTCTCTTTGTCTTTAGGAGAAATCGAT
ACAAGATTCTCATTTTGTGCAGTGGCAACTTTGGCTCTCTTGGTAAGCTTTGAATGTTGG
GTCAAAGGGCCGGATTAAACACTGCGGATGTCTAGGTAGTTGTAATAGGCTTCATTTCTT
TTTATAGGGCAAACTTGATGCTATTAATGTGGAAAAGGCCATTGAATTTGTTTTGTCCTG
TATGAACTTTGATGGTGGATTTGGGTGCAGACCAGGCTCTGAATCTCACGCCGGACAGGT
AATTCTGCAGTTAAAATCTATAGGGGTTTTGTGTTGGGAGTTTTCTGTATATGCCATGCC
AGTCTACACAATTTCGTCCTCATAAGTAGACCTCACCAGTGTTCCTTACTGGCATTTGTC
TGTTTATGTGGGGTCCACATTCTGTGCTGTTAACTGACTTGAGGTTTGCTACATAGTCCA
GGCTGTCACACGTTGGGAATGGAGGCACAAGCTTGACTTGATTCATTCAAATGAACTAAC
CCCAGTATGTCCATCTGAGCACGTTTCTGCTTGTGCCAGAGAATACTGTATGTAAACACG
CAAGTGTAGCATCTCATTGTGGTATTGAAACTAGTGGCACAGCCTGGGGTAGGAAGATGG
AGCTTTGGTGATTTTGGTAGTGTCTGCCATTTACTATTAAACTATACCTGCGTACTTTAT
GTCTGTAATTTTAGATCTATTGTTGCACAGGATTCCTGGCCATAACTAGTCAGTTGCATC
AAGTGAACTCCGACCTACTTGGTTGGTGGCTTTGTGAACGACAGTTGCCCTCTGGCGGAC
TCAATGGAAGACCCGAGAAGGTATTATTTGTAGTGGTTCTTCCTGCTGTGGGCTTAAAAC
TGCACTGTGTTTCTTGGGTGATTTTAAGATGATACCTTAAGGAGAGAACTTGGGGTCTCA
CTGACCTGAATTCATTTCTGCCTTGGGACGTGGATAGGTGCTGTCTTTCTACCACAGCAT
GCTCAAAAGCCCAGCTTGTAATTTAACCACATCACCTGGGAGGCACAGGCAAGAAGTCTT
TTGAGTTTGAAGCTAGCCTACTCTATTTAGGGGGACCCAATCAATTAATAAATAAAAATG
GGTGGTGAACACTTCAAGTGTTGCTAATCTGAGCTCCAGATCTATATAGTTAGTTTCTGT
GTAGAGCTTGCTTTGTGAGAGGGTCAGAGAACGCGAATTTTCCTTGTGGGGATGCCCCCA
CAGATAGTATCTGAACAGGACTGGAGTCTTAAGCTAGTAACTGAACAGTTGGGCTAAAAC
CTAGAAACTTCATGTGCCTGCTAGTCATTCTCGGGCTCAGTAGGTTGTTGAGGCTGATCT
GTAGGAACTGAGGCCTCTGTGCCGTCTCAGCCAGCTGATGAGCTTCTACCTGGTTGGAAA
TGGCCCCGCCTAGGACTTAAGCCCTGGGTTTCACCCGTGACCTCAGCTGTGCATGGAGTG
AAGATGTTCTTTACAAAGACAAGTAAATTGATTGCCAGCCTACAGTCCTGGCGTGCGTTG
AGAAACAATGCATGGGAGCTGGTCTCAGTCCTTTCTGTGTTTTCAGTTACCATCCTATGC
ATGGCTGAAGCTGTTCTAAACTGTAGTGATTGTGCTGCCCCAGACTATTGTCCACTATAC
CCCTGACCTTGTTTGCCTTGTTTACTTCTCTGCGTTTGGAACACGGGATTAGACATTTTT
TAAAATCTATCAAATCTGAGAGTAGAGTGGTGGAGTAAGGCAGCTGTCTGACTGGTTCCC
CCTTCTAGTTACCAGATGTGTGCTATTCCTGGTGGGTGTTGGCCTCCTTAAAGATAATCG
GGAGACTTCATTGGATTGACAGAGAAAAGCTTCGAAGCTTCATCTTGGCATGTCAAGATG
AAGAGACAGGAGGGTTTGCAGACAGGCCAGGAGACATGGTAAGTATAATGCTACATTGCA
GTTTTTCATGGTTACAGAACATTTCCTTTTTTTTAAAGATTTATTCATTTATTATATATA
AGTACACTGTAGCTGTCTTCAAATACACCAGAAGGGGTTATCGGATCTCTTTACAGATGG
TTGTGACCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGTAGTCGGG
TGCTCTTAAACTGCTGAGCCATCTGTCCAGCCCTACAGAACTTTTCTAGTGTACTAGAAA
TAGTGTCTTGTAAGAAATAGTCCAAGGGTTGCTCTGGATGTTTTTTAAAATGCATAACAG
GGTAGAGTTTATAGAAATTTCTTGTTAGTGATATTATGAGGTCTAGTATTAGTCTTCAGA
AAACTTTTAAAGCTAAAGTGGTAATGGTATTGAAAGCAGCAAACTTCCCTATGGGCAGAT
GGTTGAGTATTTATTTACGTGTCTGTGGACTTTCCGCAGGTGGATCCCTTTCACACCTTG
TTTGGCATTGCTGGATTGTCACTTCTGGGGGAAGAGCAGATCAAGCCTGTCAGCCCTGTC
TTTTGCATGCCTGAAGACGTGCTGCAGAGGGTGAATGTCCAGCCTGAACTAGTGAGCTAG
TCCGAGGGGAAGAGCCTTCGGTGTGCAGTATCAGTTACTGTGGTTATCAAACCCAGAAGT
GACTTAATATTTTGTATATCATATGTCAATGATAAAATTATATAAGTATTGTAAAATAAA
TGTCGTATTTAGATCTTTAGTGTTCTGAGTACAGTTTCTGTCAATACTGTTTGTTAATGT
CTAACAGCAACAAACTTAAAAAGCTAGTATTTAACTGCCACCTCCCTGTGTCCTTTTGAC
CTGTAACAATGACGGGAAATGATTTCTGTTAATAAAGATGATCAAAGTGAGTGAAACTCA
TGATTTAAATAAAAGATGCATAAAATTGAGTGAGTGGCTGTTGTGTGCATAGCTTTTTAA
AACCAAAACACCTCTCTGTAACCAAGAATACCTTATTTATAGGCGGGGCTGAGGGTACAT
TTTTCAGGGAACACCAGTCTCTGCTGTTTGGACTCCTCAGGCAGACTCGGCCAGGATGCT
GGAAGTCCTCCCCAAAGAATGTGAGGTTTGCTCACTTCACAATGGCTTTAGGTGGAGTTA
TTCTTGATGGGGGACCCTGTGTGAGGTTAGGTCTCAAGGGTTTGACTGTGATTACAATGG
GTGGGTTGCAGGTTGGGTGAATATAGTAATGGTACTTACTCAGTATGTGGGTGCCTCTTG
GTCAGAGATACCTTTTCCTATTGGGGACCTTTGCCCCTTAACATTTAAAGGGGGGGGGGC
ATCTTCCCTCTGAGATAGTCCTACATTGCACTAGAACTCACCTTTTTAATACAGATTTCC
AAGTGTGTTTTGTGACTTTTTTTAAGCTTTTCAATCAAGGGCTACACACAGCCAATACAG
TCCACATGTCTTGGTGTTCTATTTCTGTGAAGACATCCTGTAATCAGGTCTTGAGATTTA
GGGCTTACTTAGAGTTTCAAAAGGTTTGGTTCATTATGATGGCAGGCAGACAGGCATGCC
CTTGAAGACCACACCTACTTCAAGCTGCTCCCCACTTTTGAAGCCTTCAAATGTATGGGT
CTATTTTACTCAAAAACTACATAATGGTTTGCATGTACTAGTAAGAATGCCCTGTTATTT
GGAGAACATCCTCAGTTCTGTCACCCAGAAGTTGCTATGTGTGTTGATTAAAAAGCTTCC
TGAGGGTTACAAGCAAGGCTGTAGTTTTAAACCCTATGTCCAAAACTGCAATACTAGAAA
TAGGACGGTTGGGAAAAGCTGTATTTAACGGTACATGTGGTCTCACCCGTGTTCTGTCTG
GTACTAGGTCATGTGTACAACTGTTGAGTGAAGACTTCATGTTTAGACATTGGGTACCAG
GCCCATGATG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1108, 2054..2251, 2611..2716, 3409..3461, 3547..3657, 4094..4219, 5168..5317, 5799..6269
1001..1108, 2054..2251, 2611..2716, 3409..3461, 3547..3657, 4094..4219, 5168..5317, 5799..5939
AC_000070.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved