Rattus_norvegicus Locus Cct3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Cct3
Rattus_norvegicus
Cct3
2
SNORA2
18417..18552
25496
AACACGACTTAGGATATTCGGGGTAAATGTAAGAGCTTCTCCTTTACGTCTTATTGCCT
TAAGATTCAAAGTAATTTTTCTAAGACGTAAAACATTAGGACAGGAGAGATAGCTCAACA
GTTAAGAGCACTAGATGGTCCCACAGAGGCCATGGGTTCACTTCCTAGCACCCACGTGGT
CCCACGAGGTGGTTCACAATCATCAATTCCAGTTCCAGAGGATCAGACTCCCTCCTGATC
TCCTCTCGCAAGTGGTGCACCTACATACGCATAGGCAAACCCACCATACACATAAAAATA
AAAAAAAAAATAGGTACATCTAAAACACCAAGATTTTTCTTTTCTTTTCTTTTAAAGAAA
AGCAGCGCGTCTAGAATAAACCACAACTCCCAGCATGCTCCGGGGTGGGGTGGGGGAGCC
GTTGCGGCCCCGCCTCATAGGAAAACCTCCACTTCTACACCGCCTCAATATTTCTGGCAA
CTACCGGTATTTCCGGCTCCTGTGCTCCTCCCTACTGCTAAAGCTGGAATAAAAAGTGGC
GAACTATTATGCCTTTCTTGGCCTTCACGGTCGGACGAGAACCGATGGACAAAATAGAGC
TTCATGATCTCACCTACAGCATTAATCCAAAGCCTCAACCCCAGCACCCACCCTCTAGCG
GGCACTCAAGCGCTGTAGCGAGCCAGCTAACCGCCCGTGCCTTGGCGCTTGCGCAGACAT
TCTGCCCGCACGCGGCCGGGAGCGGCCACGCTAGTGCGCAAGCGCTTGCGTCCCCCCACC
CATCATGCTCTCTCTAGCTAGCTTGCCGTGCCTTTCTTGCGTAGAGGGCGGGGCTAATAC
CTACGATTGGCCTATGTTTATGCCAATCAATGAAATGGGCTTAGTGATTGGCGGTACTTC
AGAGGTTAGCATGTTTCTGTGTCAGTCCTGAGGAGGCAGCGTTTCCTTCGCTGCTCTTCT
CTCCAGAAGGTTCTGCCGATTTCCCCCAGCTCTGGAAAGTCGGCTCTTCGTCGTGCCGCC
ATGATGGGCCACCGTCCAGTGCTCGTGCTCAGTGAGTTCAGGGAAGCGATGGCTCCCTCC
GCCCCTCTCTCCCCATGCTTGCCAGTGTTTCCCGGCCCCGTCCCGCCATGACTCGGCCCT
CGTGCTTTCCAGTCGTCTTTTCGCCTTAGAACCTCCTTCCTTAGTTTTTCTCCTCCTGCC
TTCTCCTGTCGCCCTCTTTTGACAAAATGACTTTCTGCTCTCGGAGTCGCTAGTTTTTAA
CGTGTGCTTTATCCCATTTGTGTTCCGTTCTTTAGTCGCCACCCTCCACGCCCCCGTGTC
CTTTACAGCATGATTTCCGTCTGGTAGTTAGTAATAGTGGTTCTTAACGTTAGGCCTTGC
TTCGTATCCTCGGTCCATCCCTTAGGAGAGGCGTGACTTACGGCAACTCGCTTGATTTAT
GCTTTAATAACAGTGTTTAGGAGACCGTAGTACTTCTCCAAAGAATTATGAGTTAAGTTG
GTAAGTAAAGCTTCCTTTACCGGCAGATCGGAAATGGCATCTTTTCAGTAGCGGTCATTC
AGCAACCCTTGTTCTGAAATGACATTCCTTGCGTTCCCGATCTTGAATGTGATCTTTCCC
ACCAGCCAGTTAAGTTCTCCCAGATTCCTCTCCTGTTTTCTTTAACTAACGCCTCTCATC
TCAGTAAAGAGCACCAGTTCCTTGTCAGTTACCCGAGCTATTGAGAATAATTCAGTAAAC
CGGGTTCAAAGTTAAGACATACTAAAGAGAAAAACATGTAGTATGGCCACACTGAGAGGA
GAGACAAAGGGGTTCAGTGACACTACCCCTCCTACCAACACTTAGATGAACGAATCTATG
GGGTTTTAATTAGCAGACCAGAGGCATAAGGAGTCATCGTTTTCTGCTCTAGTCTCCTGA
GAAAGTTTACCTACAGGCTGGCTCTCCAGGCATCAACATCCCCTGGAACTGGAGTTATGG
GCTGTTGTGACCACCATGGGGGGCTGGGAATTGAAGCTGAACCATCTTTCCAGCCTCACA
AGCACACTTTCTTGGTCACTAATCTTTGAGACTCTGTAGCTCCTAATCCCACGGAGGTTG
TAAGGGATGTGCACTCTGGGAAAAATCACCATCCTGCTGAGCCCCATTCAGGGACCTAAA
GATATGAATCGCTGGAAGTGTGTGAGCATGCATACAAGGAAAGTATTGGTCAAGATTCTG
AAGTTAAAGCATTTCAGGTTATCTCTTAATGTACTGGGGCTTCTCTTCATTCTGTGTGTC
TTTTGCCTGCATGTATGTCAGTGTCTGCAGACACCAGAAGAGGACATCAGATCCCCTGGA
AGTGTAGTTATAGATGGTTGTGAGCTTCCATGTTGATGCTGAAATAGAACCAGAGTTCTC
TGCAAGAGCTTCCAATGCTTTTAACTACAGGGCCATCTCTCCAGCCCCTAAAGGTGCTTT
TTGAGACAGGATCTCACTTTGTAACTCTGACTGGCCTGGAACTTTATAGACCGAGTTGAG
TTGGTTCAGAAATTCATCTGCATCTCCAGTGCTCAGATTAAAGGCATATGCTACCATGCC
CAGTCTTAAACCATTGTAATTGTAACTGCTGGTTATACACTGAAACCTTTGTATTTTTGT
TTTCAAAACTTGATAAATAAGGTTGGTGGTAGGATCCCTAAGCAGGTTTAAAAAGAAAAA
AAGCACCAAGCCTAATAATAACTGGAGGTCTTTTTATTATGGTTTGTTTGTTTCGTTTGA
GACAGGTTCTCTATGTAAACCAGGCTGGCTTCCAAGTCACAGAGATCCTCCTGACTCTGC
CTTATAAGTGCTGGGGTCAGAGACATGCGCCACCATACCTGACTTAGATGACCAAGTTTA
ATCCCTGGCACTTATATGATAGAAAGAGAATTTAGTCCTGAAAGTTGTCTTCTGACCTCC
AAAGTTGTGCTACGCATTGTACACTTGATATGTACATATATACATTAAAAAATGTAAACA
TTTTCTTTAAGTTAGGAAATAAAATGATTGTGTACACTGGGCTATTGACACGTGTTTTTG
TCTGTTTTAGGTCAGAATACAAAGCGTGAGTCTGGAAGAAAAGTTCAATCTGGAAATATC
AATGCTGCAAAGGTAACACATGTTTTAAGTGATAATAGCAGTTCATTCTGGATGACTCCC
TAATATTTCAAATATTACAAATCTTCATTATTTGTAATAGCAAACTTCCTATGGTTCTGT
ACAGTTGAACAGAGGAAAACGCATGTTTCCCTGACAGTGATACAGGAAGGGAGGTTTTTA
AAGATTTACTTATTTATTCATTGTTTGAGTGTTTTGCCTCCAAGTATGTGTACGTGTACC
ATGTGCATGCCTGATGCACAAGAAGCCTAGAAGAGGTTGTCAGATCCCCCTGGAACTGGA
GTTCCAGGCTGTTATGAAAGTTACTATGTGAGTGGTAGGACTTCTGAAAGAGCCTAGGTC
CTCTGAAAGAACCCTGTCCCCTCTTTGGAGACAGGATCTTGTCGGGGTTGCCTAGAATTT
TCTATGCACGCCAGACTATCTTTGGACTCAGATCTGCTTGCCTTTGTCTCCCAAATCCTG
GAACTAAAATCATGTGCCAGCACACTTTCAAACTCATAAATATATTTTTAAGTGAATGAT
TGAAAGACTTGATTTCATGTGGCTTAGAGACCACTGTCAGTAAAAATATTAAGGCTGGAC
TCTTAGGACACTAAAACGGAAGACTTTTTTTTTTTTTTTAAGATTTATTTATTTATTTAT
TTATATGTAAGTACACTGTAGCTGTCTTCAGACACACCAGAAGAAGGCATCAGATCTCAT
TATTGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGAAAGC
AGTCAGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCTGAAGACTCTTTTTGAAAGTT
CATTTATCATGTCTAAAATAGTTAGCATTCTTGTTAAACACTGACTCTGGCTGGAAAGAT
GGCTTTTTTTTTTTTTTAACAATTTCTAATTTACTTTATGTATGAGTACACACAATTGTT
ATCTTCAGACACACCAGAAGAGGGCATCAAATCCCATTACAGATGCTTGTGAGCCACCAT
GTGGTTGCTGGGAATTGAACTCAGGACCTCTGGTAGAGCAGTCAATACTCTTAATTGTTG
AGCTATCTCTCAGCCCCAAGCACTTGCTACTCTTGCAGAAGACATAGATTTGATTCTCTA
AACCCAGGTGGTAGCTCACAACTTCCTGTAACTCCAGTTCTAGGGCATCCAACGTGCTCT
TCAGGCATCCATCTGGAGCACAAACATGTATTTGAGCAAAAGACTCGTACCTGTAAAAAA
TAAATCTTCAAAACACTGGCTATGCACTGGGCATGGTGGAGCACGCCTTTAATCCTTTCA
TTGAGAATCAGAAACAGGGCTGTCTCTTACGTTCAAAGCCAGTCAGAGCTACCTAGTAAA
ACCCTGTTTAAAACAAAGTAATGGTTCTGTTTGTGGTTCTTCGAAACACATTATTCTCTG
ACTATGCTTCTTGTTTTGTATTTCCTTACCAACAGACAATTGCAGACATCATCCGGACCT
GTTTGGGACCTAAATCTATGATGAAGGTTGGACTACCTTTTATTGGAACTCAAACTCCAT
GTCCTCTTTTTTTGTTATCTATAACACTTTTGCTTTTTCTTAGATGCTTTTGGATCCAAT
GGGAGGCATCGTGATGACCAATGATGGTAATGCCATTCTTCGAGAGGTATGTTTGATTTT
GGTTTTGTTGTTGTGTTGTGTTGTTTTGTTTTTGTTTTTTTTTTTTTCTTTAAACCTCCT
TTTCTAACAATTTTGAATACCAAGAACCTATTCAGATACATGTAGATAACCTTGGCATAG
TGTTATATGCCTCTAATCCCAACACTTTGGGACCAGAGGTAGAAGTAAGATCATGAGTTC
ATCCTGCACTAAATAAAATAACCCTGTCTAAAATCCAAGTTTATCAAGGCATGATGGCAG
TGTGCCTCTAATCTCAGCATTTTGGGGTAAAGGTCAGAGGAGTAGGGATTTGAGATTAAT
CTTGCGGGTTCAAGGCCTCTGAGTACTGTGATTACAGGTTTGGAACATTTTTCCTAGCTA
GTCTGCCTGCTATGGCTGGCTTAAAGATAGAAACTCCAGGGGCTGGGGATTTAGCTCAGT
GGTAGAGCGCTTACCTAGGAAGCACAAGGCCCTGGGTTCGGTTCCCAGCTCCGAAAAAAA
GAACCAAAAAAAAAAAAAAAAAAAAAAGATAGAAACTCCAGGTGTGCTGCATGCCTGCTA
TCTCAGCATTAAGGCAGAAGAGTTGAGATTGGAGAACAGCCTCAGCTATGTATCAATAAT
TTGTCATAAAGGGAGGCTAGAAGATGTACCTCTCTATTAGAGTACATCTTTCTTATTCAG
AAGGACTTAGATTCTATTCCCAGCTGCACAAAATAAAGGGATGCACCAGAAACTTAATTT
TCCCATGACTGAAGCTGTATGGGGTTTCAGTGGGGCCTACTTCTGACAACTAAGCCAGAA
TCTCTTGTTTCTTTTCTTTTTTTAATTAAGTATTTTATTTATATAAATACACTTGTAGCT
GTCTTCAGACACACCAGAAGAGGGCATCAGATCTCATTACAGATGGCTGTGAGCCACCAT
GTGGGTGCTGGGAATTGTACTCAGGACCTCTGGAAGAGCTGCTAGTGCTCTTTTTTTTCT
CTCTCTCTCTTTTTTTTTTTTTCCGGAGCTGGGGACCGAACCCAGAGCCTTGCGCTTGCT
AGGCAAGCGCTATACCACTGAGCTAAATCCCCAACCCCACTGCTAGTGCTCTTAACCACT
GAGCCATCTCTCCAGCCCGAATCTCTTGTTTCTTATATCTTTTAATAATGTTTCTCATTC
CTTTCAGTTGTAAGCACATGGTCTCTGTTTCCACCTTATGCTGTTAAAATTCTTGTTTGT
CCTTTATTTGTAAAAGAATGATGGGACTCACTTTAAGCCAGTATGACCTTGTTTTAACTT
GAATGCATCTTCAAAGGCCACCTTCCAAGTAAAGACAACATTCATAGGTCAGACAGTTTA
GACCTTTGAGTCTGTCTTCAGAGGACATAATTCAATCACTACAATGCTTTTACTAAACTG
AAGAAGCTTTAAAGATTAAGTTCTCAGTGACACTTTTCCCCACAAATGTGATTTGCTTAA
GATATTGAAGAGAGGAGCACTATGACCCAAGGATGTACCTTCTAGAGGTACAGNNNNNNN
NNNNNNNNNNNNNACACTATGTGATATATGGGTGGCCTAGAATTTACAGAGATCCACCAG
CATCTGCCTGTCTCTTCTGAGATTAAAAGCACGAGCTACCACATCTGGCTGGAGCTGGTT
TTAATTTAATTTAATCTGAGAAATATAGTAAAACAAAGGGTTAAGAGAGTATGAGACAGG
CTGGAGAGATGGCTCAGCGGTTAAGAGCACCCGACTACTCTTCCAGAGGTCCTGAGTTCA
ATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTAAAGAGCTCCAATGCTCTCTTCT
GGTGTATCTGAAGACAGCTACAGTATACTTATATATAATAAATGAATAAATCTTTAAAAA
AAGAGAGAGAGTATGAGACACTCAAGAGTTGGGGCCATGCTAAGAGGTCTTTTGAGAGCT
GGCAAAATGGCTCAGTTTGCTGCCAAGCCTGACAACCTGAGTTCTGTCCCCAGTACTCAC
ATAGTAGAAAGACAGCCAGTAACCACAAGTTGTCTTCTGTCCTTAAGGGACATGTATGGC
ATGTATGTAAGTAACCACATAAAAACAAAACTGAAAAGTTTGGGGAGGTTGTTTTGGTTT
TTTTGTTTGTTTGTTTGTTTTGTTTTGTTTTTTTTTTTCCCCTTTTTTTTCGGAGCTGGG
GACCGAATCCAGGGCCTTGGCTTGCTAGGCAAGCGCTCTACCACTGAACTAAATCCCCAT
CCCCAGGTTTTGTGTTTTTAAAGTGGTTCGTTTTTCTTTCAGATTCAAGTCCAGCATCCC
GCAGCAAAATCCATGATTGAAATTAGCAGGACCCAGGATGAAGAGGTTGGAGATGGGACC
ACATCAGTAATTATTCTTGGTAAGAGGAAAGTGGAAGATTGAAGGAAAAAAAATTAGAGA
TAACATGTGTTAGCCTGACATTGTGGCACACACCTTCAATCCCAGCACTAGGGAGACCAA
GGCAGGTGGGTCTCTGAGTTCAGCACCAACCTAGTCTACAGTGTGAATTCCAGAACAGCC
AGGGATCCACAGAGAAATCCTGTCTCGGAAAAAAAAAGAATGGTTTTTGCAATAGATAAT
AAGATTCATTCTGTAAAGTTATCATAAACAACAAGTAGTTTAATTCCAAGCTATTACTGA
TAGAAGCAATAGAAGGTTAATAAGTTCCTCTGGTACATTTTTATCATTTTAATGCATATT
GTATGTGAATTGGTCTTTTTTTTTTTTTTTAAATAATTTTGTTTTTAAGCCAGGCACTTT
TGACAGATAGTTTTACATGAATTGTTTTTATATGCATATGGGGAGTTGTTTATCTTTGGG
GCAATTTAGGTTTTGTTCTAAATTATGTGCATGAGTGTGAGTGTGTTTGTTTGTCTGTCT
GTCTATGTGTCTATGATGGTTTGTTCTCAGGAGTACAAATGCTCACAGAAGTCAGAAGAG
GATATTGGGTCTCTTAAAATTGGAATTACAGATGATTTTGAGTCACTTAACTTGGTTGCT
GGGAATGGGTTCTGAAAGAGTAGTTAAGTGCTCTTAACCTCTGAGCCACCTCTAGCCCCA
CTTGCTTTTGCAGAGGACCTCGATTTGGTTTCCCAGCATTCACTCTTCACTCACAATCTG
TAGCAGTGAGTTTTAGCTACATTGCTTTGTGCTCTAGCCACCCACTCAGGAACTCTTTGG
ATTTGCAAATGAAAGGCAAATGCACATTAGCTTATTTTTGAAATGCTTGCTAACTCAATG
ACTAGGCACTCCTAAACCTTCCCCTGCTATCCTAGGCCCAATTGGAGAAGTGTCCAGTGG
CTACTTACCCAAATTCACACATGGCTGATTGGTTTTCTCTCCTGCAGCTCCTGTGTCCCA
TCCTTCTCCCTGGAACTCGTGGTGGTCTCTCTTTTCTCTCCCTAGCCTATGCAACTCTAA
AGAATCCCACCCTGCCCCATCTCCCTTTGCCCAGCCATTGACTGCTGGCATCTTTATTGA
TCTATCAAAAACCAATTAGGGACATGGACCTTTAGGGTGTGGATAAGCAGATTCCTGATT
GAATCAAAGCATTAGAACCAATCTCCAAACAACAGTCATCTGTACCTAGTTCCAGGGGAT
CCCATAACCTCTTCTCACCTCCCACAAGCACCAGGCAGGCACATGGTACACACACGCAGA
CAAAACACACACATATCTATAAGAGATTAATATAGATAGTATAGTTAATAGAGACCTGGG
TAAGATAACTAGAAATAATTTGTTTTCTGTTGAGAACAGTGGCCAAGCATTCTCTCAAGG
CTGGCTTTGAGTTCCTGTTTCTCCTGACTCTGCCTCCCAGTGCAGGGGTTATAGTGAGCC
CTTTTTCTCTGTTTTATTTTTAGTGACAGCAGTTTGGCTGTATCCTAAGGTATTATGTCA
ATAAATCTCTTTCCCCTTTGTACTTTTCTTTCTTGGGAAAAATATTTTCATTTTTCTTGG
GAAATTGAAGTACATATTTAGTTAGAAAGTTAAAAAGGAAAGAGTAAGCCCATAATGTCA
ATTTTAGATAAATTAAGATGTATCTAGTAAGGATGTTTTCTTTATAAATTGTTTATAGAA
GTTATAAAATGTAGAACAATATTTATAGCCAGATACATACATACCTTTAGTGAGATCTGT
TTTAAGAAAAATTATTTTTTATTAGCATATCCTGGTACTTTGAAATGCGTTGCTATAATG
CCTATATCCTTTTGCAGCTGGAGAAATGCTGTCTGTGGCTGAGCACTTCCTAGAGCAGCA
GATGCACCCAACAGTGGTGATCAGTGCTTACCGCATGGCACTGGATGATATGGTCAGCAC
TCTGAAGAAAATCAGGTATGGAGGCAGGACTGAAAATAGATAGTGTGAGAGGCTTAGATT
GATCTGTTCTTAATAAAAGAAAGCCAAGCACATAGGTTGAGGGCCATTAGAGCAAGCACA
CAAACAAGGTACTTTCCATTATGGAAAAAAGATAGCAAAATAGAGAAGAGAATTGAATTC
TCATTTTAAAAAATAATTCGGGGTTGGAAAAATGGCTCAGCGGTTAAGAACACTGACTGT
TCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCACAACCATCTGTA
ATGGGATCCGATGCCCTCTTCTGATGTGTCTGAAGATAGCTACAGTGTACTCATATACAT
AAAATAAATTAATTTTTTAAAAAAGATTCTGGTAGGGGTTGGGGATTTAGCTCAGCAGTA
GAGCACTTGCCTAGCAAGCGCGAGGCCCTGGGTTCAGTCCCCAGCTCCGAAAAAAAGAAA
AAAGATTCTGGTAGTCCTTCAGTACTCTAGGCTGGTTGTCTGAGCTGGTCTTCAATCTAC
TTGGAATCCCAAAGAAGTAGGCTCTAATGCCTTAGCAGCAGGCCAGATGAGTTTGCCAGT
GAGAATGAGAGCAGGCAATCAGCAAGTCATGTATGAGTATAGCTAATTCGGGGCTCTGTG
CTGTGAGGATAGTACCTAGCAGGTTTCCATTGGAACAAGAGGACCACACCTGAAAATGCT
GCTTGAATGTAGAGAACTTGAATGTAGTTTATACTTGCTTGGTGCTAATAGTGCTGTGAA
GGGAGTATAAGAGTGCGTGCCTTTAATCCCAGAAGTTATGATGCAAAGGAGGGCGACCCT
AATCAAAACGACACAAAGTGGGCTGGAGAGATGGCTCAGTGGTTAAGAGCACTGACTGCT
CTTCCAGAGGTCCTGAGTTCAAATCCCAGCAACCACATGGTGGCTCATAACCATCTGTAC
TCTTCTGGTGTGTCTGAAGAGAGCTACAGTGTACTTACATATAATAAATAAATAAATCTT
TAAAAAAAAAAAAAAAAAAACGACACAAAGCCAAGTGTGGTGTTGCATGAGAAGCAGAGG
CAGGTGGATCTCTTGGGTTTAAAGCCAGCCTGGTTTATGTAGTGCCAGAACTGCAGAGTG
AGATCCTGTCTCAGAACAACAGAGAACAAATTCCATGATGGAATTAAAAACATGCCACAG
TGCCTCAGACCCTCCCCCAAAATATCCTCAACTATTTTTTTTTTCTTTTTTTCAGAGCTG
GGGACCAAACCCAGGGCCTTGCGTTTGCTAGGCAAGTGCTCTACCGCTGAGCTAAATCCC
CAACCCCTCCTCAACTATTTTTTAAGTGGCTTTTTCCTGTTTAGAGCCCCAGTAGGTCTA
GAACAGGATATGTATATCAAGCAAAGAAACCTGTGCCTCCAGAGTACTGAAAAACCTGAC
TCTTTTTTTTTTTTTTTTTTTTTTTTTTTTTATGACCTACTGATTCCAGTTAGTGCTGCC
CATATGTGTGCAGGGCCATGCACCAGAGAATGACCAATCCACCTGTGGCCACAATTATAA
AGAAAATGGCCCTCCTCCAGCAACTCCCAGTTGCTAAATGTTCTGCCATGGTGGAATTTT
AACAAGGTGTTTTTGTTTTATGTATGTGAGTACACTTTCACTCTTCAGACACACCAGAAG
AGGACATCAGATCCCATTATAGATGGTTGTGAGCCACCATGTGGTTACTAAGAATTGAAC
TCGACCTCTGGAAGAGACAGTGCTCTTAACCACTGAGCCCTCTCTCCAGGCCCACACTGG
AATTTTGACTGGCTTGACCTTGAACAAGTAACCACAGCTGCTGTGATAGTATGAATGCTG
TGGCATTGTCTTGTTCACAGCCACTAGCTCTTGCATTCTGATTGCCCTCTCTTCTGAGAT
GTCCACAAACCTTGCGTAGAGATTGATACAGATGTTTCATTTGCAACTGAACACTCAGAA
GTGCTTAGTTACTCTTTACACTTTGACCAGTCTCTGTCTTTGGGACAAAATCTTCTCCAA
CCAAGACTGAAAGGTACACATATTTGTAGGTCTAGACTTAATCTGTGTCCTGCAATAGAG
GTGTGTGGTGTCTTCAGTAATAGAGTTTTATTATCTAGTTATGATAGGCGATCAAGAACA
GTGGCGATGGTTTCTGTTTTAGGGTCCTTTGGATCTTCCCTGATGCATACATAACTCATT
GGGAATTATCGTATGCCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCCGAATTTTTTCGGTGCTTG
GGGTTGAACCTGGGACTTTTTTTTTTTTTTTTTTCAAAACTGGAAATTCGTATTTCTCAG
GGTAGACCTCCTTACTCTCTTGTATCCCTGGCTACTTTTTTTTATCAAGCAGTAACTGTC
TATCTTGAACATTTGCCTTAGATAATGCTTTTGGAAGCTGTTGCCTCTTCCCTAAAATCT
ATCTGGCGTTGTAAAGTGTTTTAGGAATTTTAGCAGTATTTGAAAGTTTAGCAAGATGTC
TTGTCACTTTAACCACTTCATTCTGCCTCTCAGCATGCTCTTATGCTCACTGAGGTTTAC
ACGAGTTACTGTGGTAAACATTTTATATTGACTGTTATCTGGGTTTCTTTTTCCAGTACC
CCTGTTGATGTCAATAACCGTGATATGATGTTGAACATCATCAATAGCTCTATTACTACA
AAAGTCATCAGTCGGTGGTCCTCTTTGGCATGCAACATTGCACTGGATGCTGTTAAGACT
GTTCAGTTTGAAGAGAATGGCAGAAAGGAAATTGATATCAAGAAGTATGCAAGGGTGGAA
AAGGTAAGCTAGTCCAGTGTGTGCTTGAGAATTAAGTATCTGTCATGGTCATTCCAGTTC
AGAGTAGGGTGTCTTTATTTAGTTAGACTAGAAAGAAGAACTGGACTAACTTAGAGCCCT
GTGGGATAATGTCACAGGTAAAGCAAGTATAAGATAGAAGGAGGCTGGGGTTGGAGATTT
AGCTCAGTGGTAGAGCGCTTGCCTAGCAAGCACAAGGCCCTGGGTTCGGTCCCCAGCTCC
GGAAAAAAAGAAAGGGAAAAAAAAAGATAGAAGGAGGCCTGTCATTGGACAAGAAGGTGG
GAGAAAAGTTTGAAGGAAGAGAAGGAGTCTGGAACGGAAAGGAGGAAGAGACAGGAGGGA
CAAGGAGAGAAGCCGTGGCAGGATAATATGGCAGGTGACGTTAAGATTCCGCTCTGCGTA
TTTACAGGTTCTTATTAATGTTCTTAAGGGATGGATGTGTATTGGGCTTTGTATGTTTAG
GTGTGCAATTATATCTTATCAATTGGATCAAAGGTTANNNNNNNNNNNNNNNNNNNNTTC
TTTTCATTTGGCAATTTAAGTGTAAGAAAGTGTGCTGCGGCTGGTCTGGGCCGACACAGA
GTTGGGATGTGTGTTTCTGGCATGGAAACCTGCCTTGGGAACTAGATAGGTAAAGAGATT
GCTGCCAGGCTCAGAGAGAGGCCTTTGGCAGTGTGATATGGGATGGAGCAAAGCGGGTGA
GACGCTTTGCTGACTGAGACTTAAGATATCCAGCAGATACCTTGGGGCACTGCAGTGTAC
ACCTAGAGTGAGGATAAAAGATTCCATTTTATTTTTTATATCTTTACAACAACAGAGCCC
AGAAACAAAGACCTAAAAGAGTATCAAGGAGAATTCCTGATAGCATTTTTTGTTCCCTTT
ACTACCTTCCATACACAAGGTTTACAAGGGTAAGAAAAGACATTGATATGTCCGTAACTA
TGCCTGTGGGTATTAATTAGCTACTGGTGAGGATATTCATTTTACAAGTGCTGAGGTTGG
TGAAATGGCTTAGTGGCTAAGAGCACTTAACTGCTCATGTAGAGGACACACATTCCATTA
CCAGCACCCAGATGGTGTCTCACAGCCATCCATAATTCCAGTTCCAGAAAACCTGATTTC
CTCTTTTGACCACTGAGGGCACCAGGTACACATATATTACATATGCATGCAGGCAAACCA
CTTTGTTAGTCAGGGTTCTCTAGAGAACAGAACTATGAATATTAAAGAGAAAGGCTTTAT
TAGAGTGACTATTCCAACAGTGGCTGTCACCTGATAGAAAAATAAGATTCTGGTAGTGGC
TGGAGAGATGGCTCAGCAGTTAAGCACTCTGACTGCTCTTCCAGAGGTCCTGAGTTCAAT
TCCCAGCAACCACATGGTGGCTCACAACCATCTATAGTGGGATCTGATGCCCTCTTCTGG
TCTGAAGAGAGCAACAGTGTACTCATTAAATTAAATAAATTAATTTTAAAAAAAGATTCT
GGTAGTCCTTCAGTACTCTAGGTTGGTTGTCTGAGCTGGTCTTCAATCTACTTGGAATCC
CAAAGAAGTAGGCTCTAATGCCTTAGCAGGCCAGATGAGTTTGCCAGTGAGAATGAGGGC
AAGCAATCAGCCCTATGTCCTTTTATGTGGGCTGCCACCAGAAGGTATGGACCACTTTCT
GACCTCAAATGATCCAATCAAGAAAAATCTTTCACTGGTATGCTAGTTGCTTGGGTTTTA
GTTAATTCCAAGGTGTCAGAAGTTGACCACCAACATTGACCGTCACATACTCATTATAAT
AAAATTTGTTTGAACAGTGATGGCACTCATCTTTAATCCCAGCACACCAGTCAGAAGCAG
GCGGGTCTCTGAGTTTGAGGTCAGCTTGTCTACAAAGTGAGTTTCAGGACAGCCAGGACT
ACAAAAGCTTTCCTACTTTTACTAAATTTAAGATCAGAATGTAAGTGTAGTAGCTAGCTA
GTGTAATATCTTAGAGCTAGCAGCTGGAGCTCAAGTCTAAAAATCTGTGGGAATATCCTA
ATGATGAAGTAAGTCCTTTCAAATCTTTGTCAGGACAGTGAATTTCTATGGATCTTATTC
ATCCTTCAGGTTGCATGTCATGGCCCAAGATTAGCATCCTTCCTAAGAAGTCAAATATTT
GCAGCCGAGCTTGGTGGTGAACTTTAATCCCAGTATTTGGTAGATGCACTTAGGTACATC
TATGTATAGCTACAGCTATGTAGTAAGATTATGTCTCAAACCAAAAACAAGAACATATTT
GCAGCCATTGCTTTGGTTCTCACTATTCCTAAAGGACCTGGAACTCACTGATGCTCACAC
CACCTTAGAACTTATATGGTGCCTGCCACTTATCTATTTAATTATTTTGTTTTTGAGTTT
CATAGAAGAAAGGTATCTTGGATCTAAAAGAGTAGTCGTTTGGGAAAGCTGTATGGGGAT
AGATTTGAGATGGATTTGGCTTGCATGCAGGGAAGCAAGTGCCGTGTGATGTGTCATCAG
TCCCAGTTATTGCATCTTGGTTATGTATTAAAGTAAATCTTCTTGGGCTGGAGAGATGGC
TCAGTGGTTAAGAGCACTGTCTGCTCTTCCAGAAGACCTGAGTTCAATTCCCAGCAACCA
CATGGTGGCTCACAACCATCCGTATTGAGATCTGATGCCCTCTTCTGGACTGCAGGCATA
CATGCAGGCAGAAAGCTGTATGCTATATACATAATTAGTAAATATTTAAAAAAAAAAAAA
AGTAAATCTTCTTTTGCTCAGATACCCGGGGGCATCATTGAAGACTCGTGTGTCTTACGT
GGAGTTATGATCAACAAGGATGTGACCCATCCAAGAATGCGCCGCTATATTAAGAATCCT
CGAATTGTTCTACTGGATTCTTCTCTGGAGTACAAGAAAGGAGAAAGCCAGGTAAGATTC
CCAGCCTTGTGAGGGTTTTATTTTTTGTTTTTGAGATAGGTTCTCTTTACGTAGCTCTGA
CTGTTCTGTAAATCACTGTGTAGACCAGACTGGCCTCAGATTAACAAAGATCACCTGCCT
CTGCCTTCTAAGTGCTGGAACTAAAGTACATGTGCCACTACCCCTGGCTGCCCCGCTTTA
GTAGACTTGATCACTAATATGGACAAGTGACATTTGTGTGCTGCCATTTATTATCCTTTC
TTGAAAATAGTTTGATGTTTGTTTTCCAAGTGAGCAGTCTGAAGCCCAGGACTGAGGGAA
GAGAGTGACAAAAATTAAATAAATTTGTTGTGCACTCATTGAGATGTGTGGGTATAGACA
GAGTCCTGCTTACATGGGCAGGTGAATGAGGCAGGGAGACCTCTTGGATCAGAAACAACC
TGGACAATGTATAGGATAAGACCCTGTCCTAAAAAAGGTATAGAGAATTTGAGATCTGAA
TTATTCATACACACTAATAAAACAAAAGGTCCAACCCAGATGTGTGGAACAGATGTGAAG
TTTTGACATTCAGATTGACATTTTCTGGAATACATGAGAGGGTTGGGTAGAGGGAGTAAC
TGGGATGACACTTGACTATCTTCATCAGCCTAAGGATTTTTAAGTTATTTTCATTTATGT
TTATTGTGTGTGTACCTGGATGTGCATGTGGCAGTCTGTGGGGAACATTATGTGTCTGAG
TACAGGTTAGTTGGATCCCCTAGAGCTGGAATTCCAGGCAGCTGTGAGTGCTACTCCTGA
CTGCTGAGCTGTCTCTCCAGCTTCAGTCAGTGCCTTTTCTTCATTCACAGACTGACATTG
AGATTACACGAGAGGAGGATTTCACCCGCATCCTGCAAATGGAAGAAGAGTACATCCAGC
AGTTGTGTGAGGATATTATCCAGCTGAAACCTGACGTAGTCATCACAGAAAAGGGCATCT
CGGGTAGGGCCCCATTTGTTTTTCAAGCCTGCCTTTGAGGTAGAAGAGGGTGAGTGGTGT
GATTTGGTTTTGTCCCATGGGTTGGCAAAGACAGTTGTGTGCTGTTTTAAATACTTTGGG
GATAAAACCAGTTCAGAGTTTGGGTGTCTAGCTGACACATCTACTCTTAAATTTCAGATT
TAGCTCAGCACTACCTCATGCGGGCCAATGTCACAGCCATTCGTAGAGTCCGGAAAACAG
ACAATAATCGCATTGCTAGGTAAGTAAGCCAGTTAAAGGTAATATTTTATTTTAGCTGCA
TAGTATATTCATTGCCTGAAATGGTGCAGGATGCAGTAACTGCTTGTCAAAAAGTTCTGT
TCTCTGAAATTTTTGCTCAGTGGTAAAAATTTCTTTTTCTTTCTTTCTTTCTTAATCTCT
TTCTTTTTCTTTTTTTTTTTTTTTTTTTTAAGAAAAGCTGTTGCTCTGTATCCCTCAATG
ACCTGTAACTCTGCACCCCAGACTGAATTTGAATTTATAGCAGTCCTCCTGCCTTTCAGT
TCTAGGCTTCCAGGTGTTAACCACTCGGGGCTGGTGATCTGTACTGTCTGGCTCTGTCTG
TACTGTCTGGCAAAAGCATTAGATCGCTGCTAGTGAGTCCACTTCTGTAAATTTCAATAC
ACTGATGTCTACATTCAGGGTATCTATTTCTAGTGCTAATTTATTATGGCCAGAGTGGTA
CCTGCCTATAACTCCAACACTAGGGTCATAAAGGGAGAAGAATCAGTTCACAAGTGATCT
TTAGAGACCAGTTGGGGCTATGTGAAACCTTGTCTTAATATCTCAAAAAACAAATTTTTT
AAAATGTGACCAAGAGTTCCAAAAAGAAGGTTTCTGTCTGTTGAAGTTAGTAGGCATTTG
TGAAACAAATATGTAGGTGCTGGGAATGAAGCTACAATGGTCCTCCCAAAAGAGTACTTT
TGACCATTAAGCTATCTTTTTGGGCAGTCCTCCATCTTTTACAGCTGGCTATGGTGATTG
TACCTCTGGATGCAAAGACAAACTATTTGAGTTTGAGGCCAGCCTGATCTACATAGTGAG
TTCTAGGTCAGAAACTGTCCAAAAAAAAAAAAAATACCATTAAGAAAGTAAAAGACTTAG
GGATAGAGAGAGAGATGGCTCAGTGGTTAAAAGCATTGACTGCTCTTTTAGAGACATCCT
GAGTTCAGTTCCCAGGAATCACATGGTGCTTCACAACCATCTGTAGTGGGATCTGATGGC
CTCCTCTGACATGCAGGCATACATGCAGACAGCATTCATATATTAAAAAACATATAAGTA
GGGCTGGAGAGATGGCTCAGCGGTTAAGAGCCCCGACTGCTCTTCCAGAGGTCCTGAGTT
CAATTCCCAGCAACCATATGGTGGCTCACAACCATCTGTAATGAGATCTGATGCCCTCCT
CTGGTGTGTCTGAAGACAGTGACAGTGTTCCCACATACATAAAATAAATAAATAATTCTT
TAAAAAAAAAAACATATAAGTAAGTACATTTTATTTAAAAGGAGAGAAAATTTGATACTG
GATGTCATGACGTGCACCTTTGATCCCAACCTTTAGGGGGTAAAGGCAGGCTGACTTCTT
GATTTTGAGACCAGCCTCGTCTGTAGAGCAAGTTCCAAGATAGCCAGGGCTATAAAAAGA
AACCCTGTCTCAAAAACCCAAAAAATAAAACTTAATGATAGGAGTAATTGAAATGGCTTG
GGTTATAGAGACATTTGCCTCCCAGCTTACCACTTGGATTCAGTCTCATGAAAGTAGAAA
ACTCCTGACTCATACATGTGTGCCACAACTAAACCTAGTTAATTACCACTAAATGTTACT
GATACAGGGACTGTAGTTACACTAACTGCTATTGTAAAGGATCTATGAAAAACCAGTGTT
GATGGTGTGCATGTATAATCCCAGCACCTGAATGGCTAAGGTAGGAGGATCTTTGTGAGT
TTGAGGCCAACTTTTGCTGCATAGTCAATTAAAGAGCAGCGTGAAATAAAAGTTGAAACC
CTGGTGGGTCTGGGCATTCACAAAGTGACTTGTCAATTTGCCATAAAAGCCTGAAGATTG
GCCCTGAATCAAGGCCAGCAGCTTGCTGAAGCTGTTGGCTTCAAGCAGGTGCCTAAATAA
ATGTCTTTCTATGGTCTGTTGGCCATTTCAGAAATTAAAAATGTAATGGTCAATTCATTA
GAAAGAAACATCTGGCTGACGGAGAGGAAAAAAAAGCCTGAAGAACTGAATTTGATTCCC
CAGATCCTATGTAAAGGTGGAAAGAGAGAACAGACAGACAAACAAAGTTAGCCTCTGCTT
TTCACACGTGCACACTTGGGTTGTTCATTTGGATCTGTAGGTGTGGTGCGTGTGTGTACT
TTTTCCTACCACTAAGTCAGTGGTACGACCTGTCATTCTATCACCCGAGTAGACAAAGCA
AGAGGCTATCAAGAGCTGAAGGTTATTTTCAGGGACTTTCCAGTTAGCCTGAGCTATAAG
AGACATCTCAAAACAAAACAACCACTCAGGACTCAGAAACCCAGCACTCTAGAAGACTGA
GGGAAGAGGATTGATTATCTTAAGTTTGAAGTCAGCCTGGGCAAATTACTTCCGGGCCAT
CTTTTACAACTGAATGAGACTATCTCAAGGCTTGAGGGTGGGAGGGTAGGGTCCTGATGG
TTCAGTGGGTAAAGGTATCTGCTTTAAGCCTGACAACCTGAGTTTGATTCCTGGGACCCA
CATGGTGCATAGAACTGACTCCCACAAGTTGTTCACTGCACAAAGTAAATATAATTTTGA
AAAAGCTAACCTATTGGGTTAATTCTCTTCATGAAACAAATACTTGAGAAAAGGTTTATT
TTGGCTCACAATTGGGAAGGTTCTAGTTTTTTGTTGGTTGATTTTGATTTTGGTCCTGAA
AACCTTTATGATTCAAAATCATAAAGACTTTATTACTCCAGTGGAACTACCAAAGGGAAC
AAGGCATTAGAATGTAGAACTATGGGAAATACTTGAGATCCCAACTCTACCACCTACCAG
GCACATAACTCAATTTAAGAGAGTCCTATGTCGGGGTTGGGGATTTAGCCCAGTGGTAGA
GCACTTGCCTAGCAACCTCAAGGCCCTGGGTTCGGTCCCCAGCTCCGGAAAAAAAAAGAA
AAAGAAAGAGAGAGAGAGTCCTATGTCTGCTTGTTCCAAAATGGTTCTAGACATGCATAT
GCATGCTTAGTTTTTCTCCTTGTTCCCATAAGTTTACATGAAAGGAGACATGGTATCCTT
GTAAGCTGAGCAATGGTGCCTTTAATCCCAGTGCTCAGGAGACAAAGAAGGCGGGGGACT
CTCTGAGTTTAAGGTCAGCCTGCTACACAAAGAAGTTCCAGAGCAGTGAAGACTATACAG
GAACACTGTCTCAAAGGACCAAGAAGAAAAAGAAAAGGAAAACTGCTATCCTGAGCTGGG
TGTAGTGCCTTAGGCCTTTAATTCCAACACAGGTACAGGCAGATGACAGGAACACTGAGC
CTATTGTATATAGATGTACATAGTGAGCTCCAGGACTGCCAAGACTAACTACATATCGAG
ATTCTGTCTCAAATAAAAAATACGAGGGGGGGAAACCTGCTTGGTACTAGTGTATAATAT
GATCTTAGCACTTGGGAGGTAGAGTCAACAGGGTGGGAAGTTGGAAGCCAAATTGGATTA
AATGGGACTGTCCCAAAAGAAAAGTTTAACATTTATTATTGGGTTATGTTTATAATTTGT
ACTGTCTGGAATTCAAAGCTGTACTTAAATCCACAATCCTACCTCGGCCTCCTATGCTAG
AATCATAGATATATACCCCAAGTTTTTCTCAGATTCTTGCTTGACTTTGGAATCTTTTCG
TATAGTCTTTTTTTTTTTTTTATTACACTTTCTATGATGTGCAGAGGGTACATTGCATGT
GCATATGTAGAAGTTAGATGACTGCTTTCTGAAGTGTTCTCTCCTGACTTTTTTAGTTCT
GGGTTGTATTAGTTAGGGTTTTATTGCTGTGAAGAGACACCATGACCAAGATAACTTTTA
TAAAGGACAACGCTTAGTTGGGAGTGGCTTGAAATTTCAGAAGTTCAGTCCATTATCATC
ATGGTGGGAAGAATGGCAGTCTTGGCAGACAAGATGCATGTTGCTCTAGAAGGAGCTGAG
TATTCTACATCTTGACCCAAAAGTAGCCAGAAGGGGACTGGCTTCAGAAGGCAGCTAGGG
ACTCTTCTGTAAAGTCCACCCCCACAGTGACACACTTCTTCCAACAAGAATACAGCCATT
CCAACAAGGACACACCTCCCCATGGGCCGAGGATTCCAACACAGGAGTATGAGGCCAAAC
CTGTTCACAAACCACTACATGGGTATTGAACTCAGGACCTCAGACTTGTATGGAAAGCGT
GGTACCTGCTGAGCCATCCCATGGCCTCTTGGTATAATTGAACTGAGTTACATATGTGTG
GGAGTTCATTGTCCAGATTTTATTATCTAAAAATTATACTTGAATCCAGTTATGATTAGT
TGCCATGTGTATATATATAATTACATTTCTAAAGCCAAATTTAAGAAACGTGGCTTGTGG
GGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGCAAGTGCAAGGCCCTGGGTTCG
GTCCCCAGCTCCAAAAAAAAGAACCAAAAAAAAAAAAAAAAAGAAAGAAACGTGGCTTGT
ATACATTTAAAACTTTCCTACCAGTCGGTTCAGACCTCTCAGTGATTCTAGTAATGCATT
TTAGTCTAACCTTTAACCACAGACGGTAGATTACTAGATGGGTAAAAGCATCTGAAGTCA
CATCCTCTCCACCCAATAGAGCCTGTGGGGCACGGATAGTCAGCCGACCCGAGGAACTGA
GAGAAGATGATGTTGGTACAGGAGCAGGCTTATTGGAAATCAAGAAGATTGGAGATGAGT
ACTTCACATTCATCACTGACTGCAAAGACCCAAAGGCCTGCACCATTCTTCTTAGAGGAG
CCAGCAAAGAGATACTATCGGTGAGTGAGCCTTGGCAACGTGACCAAGGGAAGGACATTG
TTCCATCCTAGAATTGTCACCACTGTAACAAGCTTAAAAGAAAATGATGTGGGTTGGGGA
TTTAGCTCAGTGGTAGAGCGCTTGCCTAGCAAGCGCAAGGCCCTGGGTTGGGTCCCCAGC
TCCGGGGGAAAAAAAAAAAAGAAAATGATGTAGCAGTTATTTTCAGTCCATGATCCTTTG
GCCTGTGGCTGCATGACTGCATAGATGTGTGAAGGAGCAGAACCAGTCACATGACAGTGA
AGAGATTAACGGGAGTACTGAGTGCCAATTTCTGCCCCTGGTGCCACGTAATCAAGGCAT
GGTGGTGAGTCAGAAAGAGGGACTGTTCTACATATAGAGTATGAGGCCAGCCTCAGCTTA
AAGTAGAAAGAGAGAGGAATGGAAAGCAGGCACAATCTAGAAACTGCTGTGCATTTGGAA
GCCTAATATGGCAGCTTATACCTGTGATCCCAGCTGAAGCAGAAAGATCACCACAAGTTT
GAAAGTATGAAGGGCTATACAAGCCAGGCCGTGGTTAGCGTATGCCTTTAACTCCAGCAC
TGGGTGGAGACAGGGAGAGGGGAGGACAGAGACAGGCAGATCTCTGAGGTTGAGGCCAGC
CAAAACTATATAGAACTATGTAAAAATATCCTGTCTGAAAAACAACAACAGGGTTGGGGA
TTTATAGCTCAGTGGTAGAGCGCGCCCTGGGTTCGGTTCCCAACTCAAAAAAAAAAAAAG
AAAGAAAGAAAGAAAAAGAAAAACAGCAACAAATAAAAACAGGCCAGGTAATGGTAGTGA
ATGCTCCTAATCCCAGCATTTTAGAGACAATCAGGTGAAGCAAGCCTAGTCTACAAGAGT
TTTGGCCAGCAGAGGATATACAGGGAGACCTTGTCTCAAAACAAAAGAAAACAGCTGGAG
CAGGAGAGAGGCTCAGTGGTAAGATCACTCATTGCTTTTCTAGGGAATTCCCCAGCCTCC
AAAGGCACCAAACACACATGGCATGCATAAACTCATGCAGACACACGCACACACACACAA
GATAGGTAAATCTTTAAAAATAAGAACGAATGGCAAAGGCCGGCTATGGTGGTATACTCC
TTTAATCCCAGCGCTCAGGAAGTAGGAACAGGTGGGTCTTTGTGGGTTTTTTTAAGGCCA
TTCTGGTCTACTTGATTAAATTCCAGGGCAGCAAGGGTGTGAGTGTATGTGTATGTGATA
GGATCTCATTTTGGTGGTTCAGTGTGATCTCGTATGGGTGGCAGCCCATATGTACTCCAT
TGTGGCTCCAGTTAAGCCACAAACCCAACATTACTGCTCCTTTCTCCTTTCTCTTTTTTT
TTCTTTTTTTTTTTCAGAGCTGGGGACCGAACCCAGGGTCTTGTTCTTGCTAGGCAAGCG
CTCTACCACTGAGCTAAATTCCCAACCCCTCCTTTCTCTTTCTGTTCTCCTTCTACTGTC
CCAGTCCCAGGAATCAAACTTAGGTGATCCAGCTTGTTAGTAAGAGCCTTGAACCACTAA
GCCATTGCTGCAACTGCAGCCCCTTTAAATTGAAATTGTAACCCCATCCCTACTCCCAAA
GGGAGTAATTGTTCCAGGATAGTAGCTGGTAAGCAGAGGATAGTTGACAGTACACCATAC
AGTCTGCTGGAGGGCACAACTAGGAAAGAAGGGAAATAGTTTGATTCTCTCTGGTGCAAT
ATAAAGACCTAACCTCGTAGTTGAGATGTAATATCCCCTAACCCTTTTGCAGGAGTCCTT
TTGTGCTCACATTCCTGAGTTAGAATGTGAACATAACTTCTGCCCCTTGCCAGTAGGGGT
CACAAGAGTCTTCTTAGTTGCCCTATTTGTGGTTTGCAAAAAGTTTGCCAGTCAGGAAAT
CCTTAGCCTCTGATTTCTCTGTGAGTCACCGAGCTGACTAAACCATTTCTCGGCTTCCCC
AAGGAAGTAGAACGCAACCTCCAGGATGCCATGCAAGTGTGCCGCAATGTTCTCCTGGAC
CCTCAGCTGGTGCCTGGTGGTGGAGCCTCTGAGATGGCTGTGGCCCATGCCTTGACAGAA
AAATCTAAGGCCATGACTGGTGTGGAACAATGGCCATATAGGGCTGTGGCCCAGGCTTTA
GAGGTCATCCCTCGGACCTTGATCCAGAACTGTGGGGCCAGTACCATTCGTCTGCTTACC
TCCCTTCGGGTGAGTTCTTTTCTATACCCATTCCTTGCTGAGGTAAGGAAAGCTGTTTTC
ACCCTAAGGGAAAAAAATTTTTTCTGACAGGATGTTTATACTCATAAGTGCACATACCCT
TAAGTTCATGCACACTTGTGTGGGTTGTATGTGTAGGCCAGAGGTCAACCTTTGGTGTCC
TTCCCCAGTAGCCATCAACCTTAACTTTACCCCTTTGCTTTTCTTATCGCTCGTTCCTTC
AAATCTTGTAGTCTGCCTTTTTTGCTGTCAGTTTTTAGTGGTTTGGTTTTGTCTGTTCTC
TGACACAACATCCTTCATTGTACTCTCCCTGCCCGTATTTATTCCACCTGCAGGCCAAGC
ACACACAGGAGAATTGTGAGACCTGGGGTGTGAATGGTGAGACTGGTACCTTAGTGGACA
TGAAAGAGCTGGGTATTTGGGAGCCATTGGCTGTGAAGCTACAAACATACAAAACAGCAG
TGGAGGTAAGACGCCATACGTCATTTCTGTCCAGATAACCAGCTTCTGAGATTTGTCTAA
AAGGAAGGGCCATAAAAAGGCAGTGTTCCCCAAAGGTCTCCCAAGGAACTCTACTCCCTA
CTTACCTTTAGCTTATACAGAAGCAGCGTAACAGGGGACAAGTTATATCCCTTGCTTAGG
TAGAGCTTCATTGTTCATTCGAGACTCTGAAGAGGAAGATCCCAGATAAAATGGTAATTC
TGTGGGAGGAGCCAGGAGAAAGCTAAAAGTAAACGGTGTCTTTCTCTTCTCTGCTGACCT
GTTTTTCTTTTAGACTGCAGTTCTGCTTCTGCGGATTGATGACATTGTCTCTGGCCACAA
GAAGAAGGGTGATGACCAGAACCGGCAAACCGGTGCTCCAGATGCTGGCCAGGAGTGAGT
GCTAAGCAAGGTGACTGAACCACAGAACCAGCAGTCTCCCCTTTCCTGAGCCAGAGTTCC
AGGAACACTGTGGACATCTTTGTTTGCAAAGGATCAGGTTGAGGGGCAGCCCCCAGTCTG
TCCCATCTCGGTTTGCAAAAAGCACTGACGTGTATCTCTTCTGTTGTAAGCTTCCATTCA
GTTTGCTTCCAGTGATTAAATCTAAGTCATTTGAGACAGTTGTCATGTGTTTTTCAACCT
TGGGTCACATCTCTACCTCCTAACAATGGAAAAGGAGGTAGAAGACTTTACTGGGAGGAA
AGGAGACAAGTCACTATTCGCTGACTTGCACACACACAAACACATACATCCCACAGCCTT
TTTTAAGACTAGGTCTCACTGTGACTGTGTAGACCTGGGCGTGGTGTTTCTACTGCCTCT
GCCCCCAGGGTACTCTTGAGTACTGGTTGGTATCAGAGATTTTAAAAGGACTGTTCCGCC
ACACGCCACACGTGGTTTGGTGAGTTTTTTGAATCAAATTAATCCCTCACAGTTGTGCCT
TGAGAGACACCCCTGCCCCTAGCTCATTCCTTCCTCACTGACCCTCACAGCTACATAGCC
AGTAGGAGACAAGCCTGTGCTGCACTTGTCTCAAGGACAAAGTATATACAGAGCCAGTGA
GGTTCAGTGGGCAAAAGTGCTTGCCGTTAAAGCCAATGGCATTCAGTCCTCAGTTTCCAT
AGTGGATGAAGAAGAGGTTCCCAAAAGTTGTCCATTGACCTCATCAATGTCCACAGTGTG
GCACATGCATTCGTAGACATTACACAAAAGCAAGGGAGCCCAGCTTCAGGAGGCTGAGGT
GGGAGTCTCCCTTTATCTAAAGCCAGACTGGACTACAAAGAAATGTCTGTCTCAGTGTAT
AAGATCTTTTGCTCTCCCAGAAGAAGCAAGTTCAATTCCTAGCATCTACACTTGGTAGCT
CATTGTTACCTCCAGCTCCAGGGGACCCAAGTCCCTCTTTTAGCCTTCTGAGCTACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1050, 3070..3131, 4595..4645, 4723..4785, 7062..7158, 9017..9134, 12236..12422, 15201..15350, 16190..16322, 16497..16578, 21199..21379, 23343..23588, 23933..24064, 24373..24693
1020..1050, 3070..3131, 4595..4645, 4723..4785, 7062..7158, 9017..9134, 12236..12422, 15201..15350, 16190..16322, 16497..16578, 21199..21379, 23343..23588, 23933..24064, 24373..24477
AC_000070.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved