Rattus_norvegicus Locus Rps3a
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rps3a
Rattus_norvegicus
Rps3a
2
SNORD73, SNORD73
2787..2860, 4477..4546
6371
ACCACTAAAGCCACTCTAGTTCCTTACTCCACTAAAAAAAACAAACGCTCCTCCTATCC
CAGAACAAACAAAACCCCAGGGCTGTGGCAGTGGCTCAGCTGGTACAGGCATGGCAGCAC
TGAGGGCCAGTGTGCTCAGGATGGCAGTCTCTCCCCAAGCCTTATACCCTCGTGGTGGAA
GAAGAGAACCAACTCTTGAGAACTGACCTCCACACACAGGCCTGTGAGGCACACGAACAA
CCACACTCATAGTCATACAAAACAAATAAAAATATGATTACTAATGTATAAGAGTTTTAT
ATATATTTTTTCTCGGCCCCCCCTACCCCCCCAATCTGTCTTGCTAGGTAGTTCAGGCTA
GTCTGGAACGCACCACATACTCTAGGCTCTACTCCAACTTGCTATCCTCCTGCCTCCAGA
GCTCTGGGATTGCAGGCATGTGTTATCACACGTGGCTAAGACTCTCTTTTCATGAATGTT
CACCACACAACCATCTCAGCACGTGAACAGCATGCCCGAAGTTATGTTTATTTAATTATA
CTAACATTATGAAATAAATCACGTGATTATTCCCATTTCACACACTGATGGCTAAAGAGG
CCAGAAGGTTAAGTACGTTTAAGTCACCACTTGAACATGGTTTTGTGATTCAAAGCCCAG
GATCTAGGGAAGAAACATCCTCTCAAAATTAAAACCTTGAGAGAGTTCAGACGGCATCTC
GTTGTACGGAAACTTCCCACACTCAGGGAAACATAGGAAACCCGACGTGAGTTGAACATT
TCTGACAATTTGCAAGCTCCTGTGCATAGCAGTCTCCCATAGCCAGTCCGCGGCCCGCTG
CGCGACCTCCCGACACACGAGGGCGCTGTGGCAGCACGGTGGGAAGGAGACTGGGAAGTG
TCGCGAGATTATCAAAGGCGGAAGGGCGAAAGAGCAAGGGTCACGTAGACAGCGCTCCCC
GCCCGGTTCGCATTAAGTTCTCGCGCGAGTTGTACTTCCGCCCTTTTGGCTCTCAGAGCG
GCACCATGGCGGTCGGGAAGAACAAGCGCCTGACGAAAGGTGGCAAGAAGGGAGCCAAGA
AGAAAGTGTAAGTGGCGGATTTCGCGAACCCCCGGTCTTTGGGTCCCGCAGGAGTCGGTG
GGCAGGTTCTGGTCTGCGGTGTAGGGCGGATGGTGGGGATGCATGGTGGATTGCGCGGTA
CGGCTGCTGGCCGGCGATCCGGACGGCTGCCTCTCCCCCTGGGCCGGGCGTCGCGTGCCG
CGTGGGAGCCCGCCCTGCGTTCTCGAGTAGTTGCTCGCGTGTTTCGAACTGTGGCCTCCT
GGGTTGCTTGAAGTCCGCTGCACTTTTAGCGCCCCTTCTACGTCAGGAGGCTCGGCAGTC
ACTCTGGTTGACCCCATGTCACTTGCGTGCCGGGACCTCGTGGGAACTCGTGATAGCAGT
TCGTACCAGTTAATGTCAGAAGTCCTTTGGGTTCCGGGGCAGTATATAATAGCCTATGTA
ATGGGGGAGTGCAGAAGGCATGTTTTCTAACCTACTGGTTCATGCATTGGCTGACAAGCC
AGCCTTACAGGTTCACCCCACGGTGAGGGGGCGTCATTTTGTATTAAATGCAAGCCCTCT
ACAAGATTTTGCCTGGGAAGTTGTGTCAATAGAAGTATTAAGAAGAAGAGTTTAAAAGTT
GTCAGGCTTGTTCTTAGGATTTACAAAGAAACTTGGTTATTCTCTCCAACCCAGGGTTGA
TCCATTTTCTAAGAAAGACTGGTATGATGTGAAAGCTCCAGCAATGTTCAATATTAGGAA
CATCGGGAAAACACTAGTTACAAGGACTCAAGGAACCAGTGAGTACCATATATTTTGTTT
TGTTCCTAAGCTGTTGCATGTGTATTTTGCTGGGGGACTTGGTTGAAATGTCAGCCCAGT
GGTTGCAGGCTTGGCATTTTGGAGTGCTTGTTTTTAATACATTTGCGGCAGCAAGGAAGT
GTTTATGCAACTGTCCAAGGAGACATTGAAGTATTGCCAGTAAGTCACTGGTGTGGAGGT
GGATTTGGTAACAAGTTAACAGGATCTGTCATTCTTTTGTAGAAATTGCATCAGATGGCC
TCAAGGGTCGTGTGTTCGAAGTGAGTCTTGCAGATCTACAGAACGATGAAGTTGCATTTA
GAAAGTTCAAGCTAATTACTGAGGATGTTCAGGGCAAAAACTGTCTGACTAACTTCCATG
GCATGGATCTTACCCGGGACAAAATGTGCTCCATGGTCAAAAAGTGGCAGGTGAGACCAA
AAACTATGAGTGCAGTGCTGTGGTGTGGGTGTGCAAAAAACATCATGGGTGTGTTGGTAG
GAAGGAGCAAACGTGACTGGAGAGTTGGATTTCATTTCCAACTGGGATGCTTTTCTTGGT
GTGAAGCAGCAGCCTGGAGTTGGGGCCTCCTGTTTCACATCAGTAAGTATCACTGCTTTT
CTGTGCTGGAACTAGAGCCCAAGGCGCTCCACGGGCTAGGCAGGCAGTCCTAACACTGAG
CTGCAGCCCTTAGTCTTCTAGTGTTAGCTTGTTATGGTCACATGACGTGAGTGGGGAGCT
TTGCCAGTTTGGTGAATGTTTGAGTTCATAGTGAAAAGATGCTCTAGGTGACTTGATTGT
CTGACAATGACAGTCAGCTCATGGAGTTGTGAAGATGAAATAGCAGATGCAGGGAAATGG
TGACCAACAAAGAGAGCAGCAACCCATGTTTCAGGACAAAGCTGTTCAGATGTATCTGGG
TGACAGTCGTGACATATTGTATATGGGAATGAGTGATGACAGGATGTTTCGGTCCCATAT
GAATCCTACTGATTTCACCGATAACATTTCTTGCTGACATTCCCTTATATACTTTATGTA
ATTTTGGAAATAATAAGCTATTTAATAAATACTGTTATAGACTCCTTTGCAGTGATGTCA
AGATTTTGTTTTTAGGCAGTTCTGATTATGCTATTTAGGCTGATCTCAGGCTCATAATCC
TGCCTCTTGTGATAGGATTGAAGGCATGTACTCATGGCAAATATTGGGTGTATAATTTGT
AAATAAATGTAGTTTGTAAAATTCAAAGATGTCAGATCACTTAGCCACTAAAATGGCCCT
TTAAAAGATGGTAGTATGGCCTAGTTGCAGATTTTATTTAGATCTTAGCTCTGGAATTAT
GTATTTAAGTTCTTTGCATAACTTTAGTTTGGAATAAAGAGCATTGAGAAAATACTTTTT
TTTTTTTTTTTTACTTTTTTTTTATTAACTTGAGTATTTCTTATATACATTTCGAGTGTT
ATTCCCTTTCCCAGTTTCCGGGCAAACATCCCCCTCCCCCTCCCCCTTCCTTATGGGTGT
TCCCCTCCCCACCCTCCCCCCATTGCCGCCCTCCCGAGAAAATACATTTTTATAGTAGAA
CTCCACTGCCCCCTTTTTTCATGAAAGGATCGCCTACCTGTTGTGATGTGGTGCTTGCTA
TGCAGACCAAACTGGCCATGAACTTTGGATCTGCCTTTGTAAACTGCAGGGATTTCGGGT
GTGGGTTGTGTGTGGCTCGTTTTGTAGGGTTTTTTTTTTGTGTGTGTGTTTTTTTTTTGT
TTGTTTTTGTTTTTTTTTTGGTTTCTTGAGACAGGGTTTCACTGTATCCTTGGCTGGCAT
GGAATTTCTATGTAGAGCAGGTTGGGCTCAAATTACTAAGAGATCCAGCATTTTCTGCCT
CTTGCTTGGAGTACTGGAACTAAAGCCACCACATACAACCTAGTTTTCCTTTGTAAAAGA
TAAAAACAGTTTTATTCTGTCTATACCGTCTTAGGATTTAATTTAACTTTCAAAGCTCTT
ATGTTTGCGAGTGTTGGTATAAATGTAAGGGATGTGACTTCAATTGACTGGTTTAAAGGC
AGGGTAACAATAATGATTTGGGGTATCATTCTAATTTCACTTTCAGGAAGTTGCACACTT
GTTTATTATGTCACATGGGTTTGACATCCCAAGCTTTTTAATTAGCACTTAAAAATTGAT
TTAGGCCATTAAAAACACAAAAGGAGGGGGTGGTCTCTTAAGTTCAAGGCTAACCAACCA
GGGCTATATAGTGAGAACCTGTCTCAGAAAACAGCAAACCCCAAACGCTTATGAGCTGAC
AGCATCCTTTTCTCACTAGACCATGATTGAAGCTCATGTTGATGTGAAGACGACCGATGG
GTATTTGCTCCGACTTTTCTGTGTTGGTTTCACTAAGAAACGTAACAACCAGATTAGAAA
GACATCCTATGCGCAGCACCAGCAGGTCCGCCAGATCCGCAAGAAGATGATGGAGATCAT
GACCCGAGAAGTGCAGACAAATGACTTGAAGGAAGTAGTTAATAAACTGTAAGTGTGTTT
CTTCTTTTTGAGGTGGAACCTCAAATCACTGTTTTGTGGAGAGTGAAATTTAGACTTGAC
TTTAATACACAATAACAAAACTTTACATAATCATGGGAATGTGTGATGAGAAAATGTTTC
GGTCCCAGTTGATGACCACTGATAATAACTCACATTTTTCTGATGTTCCCATGCAGAATA
TAGGTAGCTAAGAGGGTTATAAGACATGCTAATTTTAATTTTGCTAGGCTGTGTTACAAT
TTAGATACTTTCTAAGATTGTTAGTTTCTACGATTGTTTTCTTTTCTATTTAAAGAAAAT
TGCTTCTGTGTGAGAAACTAGACTTTGGGGTTTTGGTTGCTTGTTTTTAAAAGTTTCTTG
TTCTTGCAGGATTCCAGACAGCATTGGGAAAGACATAGAGAAGGCTTGCCAGTCCATCTA
TCCTCTCCATGACGTTTTTGTTAGGAAAGTCAAAATGCTGAAGAAACCCAAGTTTGAATG
TAAGTGAGGAAAAATCATGTTTATGAGATAGAAATTTGTGGGACCAAGTACATTTTTAAA
AATGACTTTAGAATTTTTGATTTAATTTGCCTGCCTGTGTGTATAATGAATGTATTCCTG
GAGACACTGGTGGTCTTGGACTGGAGTTAGAGATGGTTACAGGCCGCCTGTGGGTGCTGG
GAACCGAACCCAGTTCCTCTGCAAGAACAAGTGCCTCTTAACCACTGAGCCAGCCTATAC
ATGTAGGTTTCTAGGACAAAATGATGGTCTGTTTTCTTCTGTCTGTAGTACAGAAGACCA
TTTTTTATACTTGTCTATAACAAGATTGTTTTTCTTTTCCTTTTAGTGGGAAAACTCATG
GAGCTCCATGGTGAAGGCGGTAGTTCTGGCAAAACAACTGGTGATGAGACAGGTGCTAAG
GTTGAACGAGCTGATGGCTATGAACCACCAGTCCAAGAATCCGTTTAAAATCCAGATTTT
TAATAGCGACAAATAAAAAGTCCTATTTGTGATGATTGCTTCTGGACATTGTTTTAAACT
ATGAGAGCTGGTGAATCAGGTATTGTTCAGTGTGACCTGCTGGACTTAATGATTTTGTAA
ATATCTGGTTTAAAGGCATGTGCCACCACACCCTATGATACCAGCATACTCCAAAGTTCT
TTTTTTCCTCCCTTTAAATAAACTCATACTACCCAGTAGCACAGTTACAGTTATGGAGTA
GCAACAAAGATGACTTTATGGTTGAGGGTCACCACAACATGAGGAACTGTATTAAAGGGT
CGCAGCATTAGGAAGGCTGAGAACCACTAGTTTAGAAACTACAGTTGGTGAGCCAAAAGA
TTGACTACTGGAAATGGTTTGTAAAGGTTTTACGATGCCCAGGGATCATCCAGATCTCAG
GCCTTAAACATGCTAGGTAAGTGCTCTGCTATTGAGCTCGCCCCCTTTTTAGTGTGTCAC
TCGGAAAGTTGTCATTGTTCAAATTAACTCAGTTTCTTAATTTTCATTAAGCGGTTAGTT
GCCTCCTCCAGTTCTAGCCTATACTTTTACAGGGTAAAGTTTAACAGATTTCTATCCTCT
AGGCAAATGGTCTGTTTATAGTATTAATAGGTGCCTTGGTCATGGTAGCGAGCAAACACT
ATTATGGCTACTTTTCTAGCTGTCAGGTATCTGTTGACATATGTACCTCAGGTAAGCCTG
TTGATGTCTTGGTAAAGAAGCAGATAGTGCTGCTACTAATAGCCCATCTTGTTTGTGGGC
TCGAGTCACAAAAGGACCAGCATCCTTCATGGAGTGAATATAAGATAGCCAGGAGCTCAA
CATGGCACACCTTTAAGGGCACTTGCTGCTCTTAGCAGAGGACGTGGTGGCTCACATCCT
TCTAAAACTCAAGTTGCAGGGATCCCACATCTTTTCAAGCACCAGACCTGCACATACATT
AAAGCAAAAACAAGAAATAAGCGGCTGGCTCATTTCATGTGTTCAGTTAAAATGTAAGCC
TACTTACAGGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1086, 1734..1837, 2082..2269, 4159..4367, 4749..4858, 5206..5371
1025..1086, 1734..1837, 2082..2269, 4159..4367, 4749..4858, 5206..5327
AC_000070.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved