Rattus_norvegicus Locus ENSRNOG00000012538
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus ENSRNOG00000012538
Rattus_norvegicus
ENSRNOG00000012538
2
SNORD72
2689..2768
3950
ACTCCCTGTCCCTAGAAGACACTGGTATGATTTGCTAACGTTAAAAACAAACAAACAGG
GGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCGCAAGGCCCTGGGTTCA
GTCCCCAGCTCCGGGAAAAAAAAAGAACAAAAAAAGAAAACAAAAACAAAACAAAACAAA
ACAGAACAAAACAAAAAAAACAAAAACAAAAACTGCCTTAGTGTTTGCTTTGTTCTGTTG
TCACACTTGTTTTAGAATGTATGTAGATGATATGACCAAATTATTTCCCCTATTCATCAA
TGGTTGTATTATGTTTCTCATGTTTCATACTGGGATTGTGGACAGATAAATGCATTATTT
CAAAAACGATCTAGAAAACGGTTTTACAGTACAGACTTCCAAGCTGTACTCAAGCCTAAA
ATCGTCAGACTTCCAGATGGCAGAGCCCTGGAAACTATTACTTAACAAGTTCAGCCTATG
GGATCACACAATTGGCCTCTGAATTGTGAAAACAAGTCAAGTCACTCCGTGACTCCGCAC
TCTCACAAACTCTCTTTAAAGGCAAGCCAGCGGCCAAATCAAGATGAACCTGGGAAGTCT
GGCTTTCCAGGCTCGGCAACCCCGTCCCAGCCGCTCGCTGCACACACGGCCAGGGGCGCC
GCCACGCACAGGGTGTCCGACTTCCCTCGAGCCCCAAGACCAGAATTCAGACCCGACTGC
AAATACTACAGCGGAGCGAGACGGCTCCGGAGACCGAAAGCTCAACAGAAACAGCGAACT
TCTGCGAAAAGCCTCCTAACCTAGGAGTTTCTGGCGCCCGGGAGGGTGGAGCCACAGGCG
CCAGCCACGCCTCCTATCGGTGTCACAGTCAAATTGGTTCCCTGGCTCTCTCGCTCCAAC
TACACCACTGCGCCGGAGGCCTGATAGTGCTGCACCGCACTCACCGGAAGTAGTTGACTG
GGCGGAAGCTTATCCACAGGAAGTGGTAGGCGTACTTTCTCTTCCGGTCTCTTTGGCCTC
GCCGGTAGAAGCAAGATGGTGAGTGTTGTTTCTGGGCTCTGTAAATCTCTTTCCATCCTT
CTTCCCTGGGCTGTCTTGCCTGTCGCCGGTGCGTGGGTGACAAGGTTCCGAGTAAAGGAG
GCTGATGGGCAAGAAGACTGCATGCTGTGATCCGCAGGAACTGGAAGGATGGCTGTCCTG
TGGAGAACTGAGCCCGCAGTTCTAGTGCCGCTGTGGGTCTCTTTGGGGTGTGGAGCAAAC
ATGTTGCTGCCCCGGGTAGATGCTTAGAGGACAGGTTTGGGAACATTTGGCCCCAACCGC
CGAGAAACTGGGTGCTTGTTGGCAGTACCTGGGACTGAGAGGCGGGCAGAATGTGGTCAT
CCTTACCGCTGAAAAACTAAGGCTTCAGAGCACTGACGTCCGTGCAGAGTAGAACATTAG
ATCGTGTGAATAACCGGTAGTGATTTTTACCTTACTTGAGTGTGAAAAGTTTAAATCTTT
ACCCCGTTTTGTCCCATGTAAACTTTGTCATGTCGCGTAAGTTCTCGTTTTCCGAGAAAA
TGCCAGAGTACATTGAGAAAACAGATTTCAAAGTTGCTTTCCTTTTTTTAATGTGCAGAC
GAAAGGAACGTCATCCTTTGGAAAGCGTCGCAATAAGACGCACACGCTGTGCCGCCGCTG
TGGCTCCAAGGCCTACCACCTTCAGAAGTCGACCTGTGGCAAATGTGGCTACCCTGCCAA
GCGCAAGAGAAAGTGTAAGTAGTGGGATCTTAAGGCTGGTTTTTACCTTGACCTGAGGTA
GGGATGTAACAAAACACATTCGGTGGTTGGTATGTTGATTAAGTGGTTAAAACATAGTAA
TGACAGTACTGAGAAAACGGGCTATGCTGGATGCTTGGAAAAAAAACATTTGGAATCGTA
CTTTCTAATTAGATAACTGGAGTGCCAAGGCTAAGAGGCGAAACACTACCGGGACTGGTC
GGATGAGGCACCTAAAGATCGTCTACCGAAGATTCAGGTACAGTTTTGTTTCCCAGTCAT
TGGTCCTTGGTAGTTCTGTTTACTTGTCACTTCCCACTCTTGGTGAATAAGTAATCCTCC
TGGGGTTGGTTTTTGGCTTGAAACACCCACATTCGTCCAGACTGTATGAATGGTATCTGA
GAGGCAGATTATTTGGTTCAGCCCCCACTTCTTCAGATTTTGCTCAAATGTTCTGGATAC
TAGTCATCAGTCCTAACAACATGGGAGACTGGGCCTTGGTGTTCCTTAAAAATCCAGAAA
TCTCAGCCCCCTCTCAGATTGTGCTGTCGTCTGTATTTTGACAGTTGCTATAGTATTTGT
CTTTGTATTTACACTTTGTTTTGTGGGCTTGCTCTGTGGTGATTTGCTAGTGTTTAGTAG
GCTAGTGGTGTGTTTTAAGTCCAATTAACCTTCATGTGCTTCATATCACTCATCTTCTGT
AGAAATGAGTGTTTCTTACCATTTAGACTTCTAAGTTGAGCAGTTTCAAAGGTTCTGTTA
AACGTGGTCGGTGTTTTTCTGTTACTAAAAAAGCATGCCAGGGCCTGTCCTTTATAGCAT
AAAGAATAGCTTCATAAATAGTTCTTGTGGAAATTAGAAAGTTAAGCTCAAAATTGTTGA
GACAGTTAACTGTAATATAATGTGGGTGTTTTGATTGGGGTAAAATACTAGCTTATCGAT
GATGTCCTAAAAGTAAATGTCTGAACATATGAATGCTATACTGATTTCAGCATTTAACTG
AGATAAGCTCATGAAGGTCTTCTGATCAATTTGGAAGTAATGTTTGGTGTTGCTGCATTA
ACTTCTCTTGTCTTTAACATGGCACAGACATGGATTCCGTGAAGGAACAACACCTAAACC
CAAGAGGGCAGCTGTTGCAGCATCCAGTTCATCTTGAGGATTTCAATCGGTCATAAAATA
AATGTTCTGGTTTCAAAAACTGGTGTTGTAAGGTACTTTAATGGCGGTTTGGTGTTTGGT
TGTGTGATTGCTTTGGAAGCAGCGAGAAAGAACTGAGAAAGCTGAGAACTGGCCCTTTGT
ATATGAGGTTAGTTCCTGTGAGTGAAGTTGGTAGGGGCTGGATGAATTCTCTGGGAAGAT
ACTCTTAAGCCCGCCGTAGGTCCCCCATCGTGTTTGCTTGGCCCGGGGCATGGAGGTGAA
TGGGCAGGCTTGCTGGGAAAGAGGACAGTCTTTCTCTAAGCCTGAGGTGTCTTGAAATAC
TTGGAATCTATAAGAGGCTTGGACAAAAACAAATCTCATGGGTGCCTGCACATTTGAGTT
CTTATTCATCCTGAAATTCCCTATTTTTAACATTTATGTGGATAAAGCCAAGAAAGATAA
GCCTTTATTCCCAGCACTTGGCAGCAGGTGGGTCTCTGAGTTGGAGGTCAGCCAGAGCCA
CACGGTAAAAAATTTTTAATGCTGTTTATTTGTATGTAAGCTGCTAATGTAAGTGTTTGG
TGTACTTTGTCCTAGTATTTGAGACTACTATCCTTCAAAGGTGCATGAAGTTGCTTTTGA
CAATTTATAGTTCATCTTACTAAAACTCATGGTCTATAGACTTAAGATTGGTTTCTACCC
TTATTAATGGGTTGAATAGATACAGACTTCTAGGTAATTCTAACAAGGGGTAAATCAGAT
CTCAAGACAAGTGGGAATTGGGCTCTGGGTGTCTGGACTTGCTGGAATCTAGAGATGGAA
AAGGTTAATACAACTTCCACAAGATATGTGGAGCTTGAAGAAATGCTTGGTGCAAGGTGA
CCTCAAGCCTGGTGGTGGTGGTGGCTCAGGCCTTAATCCCAGCGCTTGGAAGGCAGAAGA
AGCAGACTGCCTCCCAAAATCTTGAGTTTGAGGCCAGCCTGGTTAGTTGCCAGACCTACC
GAAGATCCTGTCTCAAAAGAAACAGTGAGCTCCTCTTTGTCAAGCCAGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1618..1753, 1932..2016, 2847..2954
1035..1037, 1618..1753, 1932..2016, 2847..2916
AC_000070.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved