Rattus_norvegicus Locus Bat2
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Bat2
Rattus_norvegicus
Bat2
20
SNORA38
1280..1413
15520
CCCACCCACAAATGAATGCCTGGTCACTCTAGAACGGACTAAGATGTAGAGTTTGGCCT
GCCTGGCGAGTAAGGGCTGTTAAGGAAACAAATGACTGCTTATGAAGAGATTGGATGAGG
ATAAAAATTGTAGTTGCTTCTCGTTTTGGCCCTCTGCTGTCTGGCCCATGGTTACAGGGT
ATTTTAGGTAGCTCCATTATGCTGTGTTTTCCTTCAGTTTTACATTGGGTCCACTAGTAT
GTTTTTCTTTTCTTTTTTTCTATTTCTTTTCTGTAAGCAGAATTGTTTCCGAGAGCCAAG
GTGGGCTAGTTAAGGAATAGATGGAGTATTCTGCATACAGGGGTTTTGTTCAGCTTGGGA
CTGTGTGGAGCCCCTGTTGTTTAGTAAGGCTTATGCTGGCACCAGCTCCCGGTCTGGCAG
AGCAAGCTCATAAAAATCCTTAAGCTCCCAGCATACCTTCCTTCAAACCTCCCCAGATGG
GACTTAAGGCTGCTGGGAATGGAACCTGGGACACAGGGCCCTGGGGCGTGATTAGGGAGC
TGGTGTCTAATAGGTTGGCAATCTGAAGTTCTCATACTTGCTGGATGGAGTTGTGCGCCT
CGTTCTGGTTTTCTCTGGGGCTTTGACTTGGTTGTTTAATTTTATCATATAGCTCTGAAG
TTATTTTGGAGGAGTGAAGGATTGGCTGCCATTTCTAAGGTGGCACAAAGGATAGATCTG
GAAGATACCAGGTTGTTATTTGGTTTTCTTTGTCAGGATAATCAGGGAGAAGGGACTGTG
GCTGTGGAAGCTGAGTGAATTGTGGTTGCTTAAGAGACCGTAGTAGTTTACACAAGCTAG
AGGGCCACATATCTGGCCCCTAAAGAGAATGCAGAGAGCTTCTAGGCTTTTGTCTGTGAA
AGGGGCAGAACCTGAGCTCACTACTCTCTGGCCCACAGGCACCGGCTCGTTTTGGGGGAG
GTGCCTGCAGGACCCAACGTACTCAATGAGCTTCCAGCGCAATGTCCGATCGCTCGGGGC
CGACTGCCAAGGGGAAGGATGGAAAGAAGTATTCCTCGCTCAACCTGTTTGATACGTATA
AGGGCAAGTCCTTAGAGATCCAGAAACCCGCCGGTGAGGGTCCCGCAAAGAAGTTTCTGA
TATTTGCAGGCTGAGCATGTGTGGGGTGTAGGATTTAGAGCTCTTCAACAAAGTCAACAA
ACAGAACAGAGGAACACAGGAGACCTCAGTTCATCTTCAGGGCTAAAGGGGGTACTGGGC
TCTGGGTAAAACACAGGTCATCCTCCTACAAAGGCGTGTTTTGGGTTCCCTGTCCTTGGA
CACGTAAGAATCGGAGGCAAAGAAATGTGGTGGGTTTGGAAAGGTCTGGGACCAGCTTGC
CCGCCGCAGGCTCAGGATCAACCATCCCACAGAGCGACGATGATTATGTTGAGCTTAGAA
GATTATTGAGTGATGGAATAGTTTTTGAGAGACTCCTATAGTGAAAAGGTGGGAGGGTTG
TCTAAATGGGATCTGTGGATGGGCCTATTTCACCCTTTCTCTCAACCTTTTCTTCAGTTG
CCCCTCGACATGGCCTGCAGAGTCTCGGAAAAGTTGCCATTGCCCGGCGTATGCCGCCCC
CAGCCAACCTTCCAAGCCTGAAAGCCGAGAACAAAGGCAATGACCCCAATGTCTCACTAG
TGCCGAAAGACGGAACAGGATGGGCAAGCAAACAGGAGCAGTCCGACCCCAAGAGGTAGA
CAGAGGCCTGTGGACCCTGAGGAGTCTCTGAATTTGGGAGTAGTTTAAGGCCTGGTCTGT
TTCATCCAGAGATAAAGAGAGAAACACCTTCCTTCTGCATCTAGTTTGATAGATGACAAA
GAAATGAAACCTTAAACTTAGATGGAGAGAAGTCAAGGCCTGTGGGACAGTTCTTTTGTT
CTAGTATTTATAGATAGTAGTGCTAGGCTAGGGTCAGTTCCAGCTTTGTGCCAGTTAGAG
TACTGAGGAAGTGGCATCTCCCACTCTGGATGACCTTTTTCCATTCCTGCCATCCCAGTT
CCGATGCCTCAACCGCTCAGCCGCCGGAATCGCAGCCACTGCCGGCTTCACAGACGCCTG
CCTCCAACCAGCCGAAACGACCCCCAACAGCCCCCGAGGTACCTGGGGAACTGGAGGGGT
CGGAGGAGGAGGAATGACCCTTACTCTTCTCTCCTCATGACCATTCCTTACCTTTGCTTC
TCCAGAACACTCCTTCGGTTCCAAGCGGGGTAAAGTCCTGGGCACAGGCCAGTGTCACCC
ATGGAGCCCATGGAGATGGTGAGGGCAGCAGTGTTGGAGCATGTGGGAGGCAGGGGACGT
GCATCCCTTCAGGAGAGATCCTTTGTCTTGTGTCCAGATCGCCCAGGATTTAGAGCTTTC
CATTTTTATGTACATGTTCAGGAAGTGAGCCCCTGTTTGGTGTACACCCCCATTTCAACA
GGTGGAAGGGCATCAAGCCTACTGTCGCGATTCTCTCGAGAGGAATTTCCGACCCTGCAG
GCGGCTGGCGACCAGGACAAGGCTGCCAAGGAAAGGGAGTCTGCCGAACAGTCGTCTGGG
CCCGGACCAAGCCTCCGCCCCCAGAGTGAGTGGCTGCCTTGTAGCCAGGATCACGCCTGT
TCTGTGGAAGAGCTGTGTGCTGACTACTCGTGCTCTTCCCCATCTTTTTGCATGTTCACT
TGGCCCAAATCAGTGGTAACTTTTCTTTTCCTCCCTCTTTGCATTTCTAAACTACAGATT
CTACAACTTGGAGGGACGGAGGTGGGCGTGGCCCTGATGAACTGGAGGGCCCGGACTCCA
AACTTCATCATGGTCATGATCCCCCGGGGTGGGCTGCAGCCTTCAGGCCCACCCCAGTTC
CCTCCCTACCGCGGAATGATGCCGCCCTTTGTGAGTTTGGCTCTGTTACTTGAGTGGTGC
ACTGAAAAGGCCAGAGTGCTAAGAATTAGGACTTAGTCTATAGAAGACACAGGGAGTAGA
CCCTAGTGAGATAGGGGGATGGGAGGATGAGATGTTTAAGGGTTGGCAGGTTATATATCC
CTCTAAGCAGCTGTTGTTGGGCCTTTGCAGATGTATCCCCCATATCTCCCATTTCCTCCA
CCCTATGGACCCCAGGGGCCTTACAGATACCCGACTCCTGATGGGCCCAGGTAAGTAAGC
AAATTCTGGGTTATTTGGGGGGAAACGGGGAGCTACTTGGGAAGAAATGGTTTTTCTGCC
ATGAGGTTCAGTTTTGTTTGATTCTGCTACGTGCTGTATTTAACATTGCCCCCTTTTCCC
AATACACAGCCGTTTTCCCCGTGTGGCGGGCCCCCGGGGCTCAGGGCCACCAATGCGCCT
TGTAGAGCCTGTGGGTCGGCCTTCTATTCTTAAAGAAGATAATCTCAAAGAATTTGACCA
ATTGGACCAGGAAAATGATGATGGTTGGGCAGGTGAATATGAATATTTGGATCCTCAAAA
GTAAACCGTGAAGAAATGGTGGGTCATGTAGAGGAAGACAGGCGTGAGAGGGAATGATAG
GAAGCTTAGTGCTGCCAAGTACTAAGGAATGAGGGCGACAGGACGTGGGACGAGTGAGGA
CAGTTAGCATTGACTGCTGTTTGTAATTCCAGACTGTTAGCTGCTGTCTGGGATGGGAGA
GCACACTGCTTAGTTCACTTTAATGTCAATTTCTTTTACCTCAGGGGCCCACGAGGAGGT
TGACTACACTGAAAAGCTCAAGTTCAGCGATGAGGAAGATGGGCGAGACTCTGACGAGGA
GGGAGCTGAGGGCCAGTGAGTTAGGGCACTGAGGAGGGGGCTGTTTTTCTTGTGGTGTCA
TAGCCTCATAGAAGGGCTGGGTATAGCAGAGCTTAGTTATACTGTGATCTGCCCACAGCA
AGGATTCCCAGTCAGCTGCTGGTGAGGAACCTGAGACAGATGGCAAAAAGGGCACCTCCC
CTGGCAGCGAACTGCCCCCTCCCAAGACAGCCTGGACAGAGAACTCTCGGCCTTCAGAGA
CAGAGCCAGCTGCTCCTCCTATCCCAAAGCCTCCCCCACCTCCACCTCACCGGGGGCCCG
TCGGGAACTGGGGGCCCCCTGGGGACTACCCAGTGAGTATCTACAATTCGGGGTTGAGAG
TGTCAGCTGTGGCGGGCATCAACTGAATAATTGAAGGTAGTGACAGGAAGTTAGGGTAGG
ACTAGGGTTGTACCTGAGAAAAGTTTGGGAGCCTTTGGTTCTAGGGGAGTTGGGGATATG
AGCTTGTGATGCTGGGAAGGAAGGCCTGCATGTTTAGGTCTCCATAGTAAAAAAAGGAAC
AGAGACAAGGGTGAGGAGTTTGTTTTCATCCAGAGACCATTAATTCCAGGGCCTGGATCT
CTTATCCTGTAGCTATAGACAGTTGTTTGGTCTTTGAAAGAGGTAGTAGAAGGTAGAATG
ACTGACATGCCTGGCCTGCTGGGTTTGCCCATTTCCAGGATCGAGGGGGTCCTCCCTGCA
AACCCCCAGCACCTGAAGATGAGGATGAGGCGTGGCGACAGCGTCGAAAGCAATCTTCCT
CAGAGATCTCCCTGGCAGTGGAACGGGCCCGAAGACGCAGAGAAGAGGAAGAGCGACGAA
TGCAGGAGGAGCGCCGGGCAGCCTGTGCTGAGAAACTTAAGCGTCTTGATGAAAAGTTCG
GGGCACCTGACAAGCGGCTCAAAGCGGAGCCTGCAGCCCCACCTGTTACTCCTCCTGCCC
CGGCTCTACCACCTGTAGTCCCCAAAGAGACCCCTACACCTCCAGCTCTGCCACCAACAC
CAACCCCAACCCCAGAGAAAGACCCTGAGGAGCCAGCACACGCCCCTCCCGTGCAGTCCG
CCCCCACTCAGGCTGGGCCTCCAGCCCCCACTCCGGTGAGTGGGGGTGGCACTGCCAGTA
GCACCAGCAGTGGCAGCTTCGAAGCCAGCCCAGGTATGGAGAAAGGAATAGGGTCTACTG
GGTGTCGAGTCTCTGCTGCTAGGCTTAAGGGGATACCGGGTACTGAAGATGGATGTCAGT
AGGAGACAGTGACACGTTTAATGAATTCTGTGAGTGGTGGGATGTGTGGAAAGAGTCTAA
AGTATTGTGTAGAACAAAACTTTACTCTTTTCTGCTTTTGCATTTTTTTGGTAGTATCAC
AGGAATACTTGAGGCTTTAAAGTACTTTTATGGCTTTTAAATAGGATTGGTATTTTGTTG
AATACTTTAACTGGGGGTGGGATTTCTGGGGTATTTGTTGTGATGTGCCAGGTCACTCTG
TTCTTCAATGCAGCGGAACCCCAGCTGCCTTCAAAAGAGGGTCCTGAACCACCAGAAGAG
GTTCCTGCACCTACCACACCCCCAGCCCCAAAGGTGGAACCCAAGGGTGATGGCGTTGGT
CCCACTCGCCAGCCCCCCAGTCAGGGCTTGGGCTATCCCAAATACCAGAAGTCATTGCCA
CCTCGCTTCCAGCGGCAGCAACAGGTGAAGCCAAGGTCTTTCCATTTGGGGGCTGTTTCT
GTCTCTTCACTGCCCTTCCATGTCTTCAGGCCTGGGTTTGTCTTTGTGTTGTAGCACAGT
TCCCTCCATCCCATCTCTGTCATGTCACTGCCTTAATGTCCTCTGTACTGATGGACAGAT
GGAGGCCCTTGGGTAAGGCTATGGTGACCTTTCCATCCTATCTCCATCCTTGCAGGAGCA
GCTCCTGAAGCAGCAGCAGCAGCAGCAGTGGCAGCAGCAGCAGCAACAACAAGGCACTGC
CCCTCCTGCCCCAGTGCCCCCATCACCACCACAGCCTGTGACCCTGGGAGCTGTACCTGC
CCCACAGGCACCGCCCCCACCTCCCAAAGCCCTGTACCCAGGTGCTCTGGGCCGGCCCCC
ACCGATGCCTCCGATGAACTTTGATCCCCGCTGGATGATGATTCCTCCTTACGTGGACCC
TCGGCTTCTCCAGGGCCGGCCCCCTCTGGACTTCTACCCTCCGGGTGTGCATCCCTCTGG
TACGGGCCCATGGGAGTGCTGGTGACCTCCTTGGTCCCAGGAGGGAATGTGTCTTTGTGT
AACGGGATAGCCAGGGAACATGGTGGTGTATCTGCTTAGCACTTAGAGGGTCTTGTGAGA
CTGAGTTTGGAGAGGAGGTGAGCAGTGATCCTTCATTGGGCATCTTATTCGTGGGGCTTG
GTTACTTCATAGGAAAGCTGAGTGGTTGGCTTGTTTTCTTAAGAAAGGCAAAACCCTCAG
AGAACAGGAGCTGTGGGTGCTGCTTGCTCTCAACACAGGTGCTTTTGACATGGAAGGCCC
ATGATGGTGATTTGTTTTCTTAGGCCTGGTTCCCCGGGAACGCTCAGACAGTGGGGGTTC
AAGCTCAGAGCCATTTGAACGCCATGCACCCCCTCTGTTACGGGAACGGGGCACCCCACC
AGTGGACCCCAAGTTGGCCTGGGTAGGAGATGTCTTTACCACCACACCCACCGATCCTCG
CCCTCTTACCTCACCACTGCGCCAGGCAGCAGATGAGGAGGAGAAGAGTCTGAGGTGAGT
TGCTAGGGAGCAACCGGGCAGGCCTGAGAGTAGTGGGGATATCTGAGGTGATAAGGTACA
CGGGGAAGGAGTGTCTAAATCTTCATTCTCTTCTGCTTGTGCTCATCCTCATAACAAACT
TTTCTATTTCTCTTCAGGAGCGAGACTCCTCCAGTACCTCCCCCCCCACCTTATCTGGCT
AATTATCCAGGTTTCCCAGAGAATGGAACTCCTGGGCCCCCAATCTCGAGATTCCCTCTG
GAAGAATCAGCTCCCCCAGGACCCCGTCCACTACCCTGGCCTCCAGGCAATGATGAGGCT
GCCAAGATGCAAGCTCCACCACCCAAGAAGGAACCCCCCAAGGAGGAACCAGCACAGCTG
TCCGGGCCAGAAGCAGGCAGAAAGCCTGCCCGAGGAGTTGGAGGTGGAGGCCAAGGCCCA
CCACCACCACGCAGAGAGAATCGCACTGAGACTCGCTGGGGCCCCCGGCCAGGCAGTTGT
CGACGTGGCATCCCTCCAGAGGACCCTGGTGTCCCTCCTCGCCGAGCTGGGCCTATAAAG
AAGCCACCACCCCCTGTGAAAGCAGATGAGCTGCCTCCTAAGTCCCTAGAACCAGGGGAT
GAAACCCCCAAGGCCCCAAAGCCAGATGCACTCAAGACAGCTAAGGGCAAGGTGGGCCCC
AAAGAAACCCCAGCGGGTGGGAACCTGTCTCCTGCGCCTAGACTTCGAAGGGACTATTCC
TATGAAAGAGTAGGCCCTACGTCTTGCCGTGGTCGGGGCAGAGGCGAGTATTTTGCCAGA
GGAAGGGGTTTCCGGGGAACTTATGGGGGCCGGGGTCGGGGAGCCCGGAGCCGTGAATTC
CGAAGTTACAGAGAGTTTCGAGGAGACGATGGACGAGGGGGTGGTTCAGGAGGAACAAAC
CACCCTTCTGCTCCCCGAGGCCGCACTGCCAGTGAGACACGAAGTGAGGGTTCAGAGTAT
GAAGAAATCCCCAAGAGACGTCGCCAGCGTGGCTCTGAAACAGGCAGTGAGACTCATGAG
AGTGACCTGGCACCCTCTGACAAGGAAGCCCCTCCACCCAAGGAGGGAGTGCTAGCTCAG
GTCCCTCTTGCCCCCCCACAACCAGGAGCTCCCCCATCACCAGCCCCAGCCCGATTCTCC
ACTGCCCGAGGTGGTCGTGTCTTCACTCCCAGAGGAGTGCCATCGCGCCGTGGCCGAGGT
GGGGGTCGGCCCCCTCCTGTTTGCTCTGGCTGGAGCCCTCCAGCCAAGTCCCTGGTTCCA
AAGAAACCTCCAACAGGTCCTTTGCCCCCAAATAAGGAGCCTTTGAAAGAGAAGCTGATC
TCAGGGCCTCTGTCCCCCATGTCCCGAGCTGGCAACATGGGTGTGGGCATGGAAGACGGG
GAGCGACCCCGGCGGAGGCGACATGGCAGGGCTCAGCAGCAGGACAAACCACCGCGTTTC
CGAAGGCTGAAACAAGACCGGGAAAATGCTGCCAGAGGCACCGATGGCAAGCCCCCTCCC
CTAACCCTTCCAGCCTCCACCCCTGCACCCACGGAGACGCTGGCCACAGTCGCAGCTCCC
CCACCCCCTCGCCGCACAGCTGCTAAGTCTCCTGATCTGTCAAACCAGAACTCAGACCAA
GCCAATGAGGAATGGGAGACTGCATCAGAGAGCAGCGACTTTGCCAGTGAGCGCCGGGGT
GACAAGGAGACTCCCCCAGCAGCACTTATAACCTCTAAAGCTGTGGGGACTCCTGGGGGC
AATTCAGGTGGGGCCGGACCAGGCATTTCAACCATGTCTCGTGGAGACCTGAGTCAGCGA
GCCAAGGATCTGAGCAAGCGGAGCTTCTCCAGTCAGCGGCCAGGCATGGATCGTCAGAAC
CGGCGCCCAGGCGCTGGGGGCAAGACTGGCGGTGGTGGCAGTAGTGGAGGTGGTGGTGCA
GGCCCTGGGGGACGGACTGGCCCAGGACGAGGGGATAAGAGGAGCTGGCCCTCTCCCAAA
AACCGAAGGTGGGTAAGGGTAGATGGCTAAGTGTATTCTTATGGTTGCTGGGTTCAGGAT
GGGTACCAGGGAGTAGGAGTTTTATGAGTAAGTCAGGCCTCAGGAAGGGACTATGGAACC
TCTATCTTGGTAGTTAGCTAGAGTTGGCAGTCCTCATATATGTTTGCAAACCCCTCAGGG
CTTCCCCCTCAGCCCTTAACCCACTATCACCCACCCACCCACCGACGGGGTAGCAACACT
ATCAGTTCTGGTAAGCTGGAGGTAAGTGAGTGGGAATGAGTCCATCCCCAGAGGTGTGTG
CTTTTTTCAGCACACCTTTGTAAACAGAAAACTTGGAAAGGTTTTCCCAGGAGAGAATAG
GATGCCAGTGGAGAAGCTAGAAAGTAGATGTGACTTCTAGGGGTAAGAATTTAGTGAGCC
CTGGAGCTGATGCTCTGCCCTCTCTAGCCGTCCTCCTGAGGAGCGACCTCCGGGACTTCC
TCTGCCTCCGCCACCCCCCAGCAGTTCTGCTGTTTTCCGCCTGGACCAAGTTATCCACAG
CAACCCTGCTGGCATCCAACAAGCTCTGGCCCAACTTAGCAGCCGCCAAGGAAATGTAAC
TGCACCAGGGGGGCACCCAAGGCCTAAGCCTGGGCCTCCCCAAGCCCCTCAGGGCTCCTC
CCCTCGGCCCCCAACCCATTATGACCCCCCGAGGGCCAGCAACGCTATCAGCTCTGGTAA
GCTGGAGGCAAGTGGGTGGGAATGACTCCATCCCCCCAAAGGTCAGGTGCTGGACTGGGG
AACAGACGTTATCATGGGGGCCCTCCTCCCCCACAATTGGGTTCTAAAGGACTAGAAGGA
CTGAGAGGTGGAGTTGGGAGAGCAGGCTAGGGTCAGTGGTATAATGGGGTAGGATGCTGA
CAGTTTTCCCCTTTTCCCCAGACCCCCACTTCGAGGAGCCAGGGCCGATGGTGAGGGGGG
TGGGCGGGACTCCCCGGGACTCTGCCGGGGTTAATCCCTTCCCCCCGAAACGGCGGGAGC
GGCCTCCCCGAAAACCGGAGCTGCTGCAGGAGGTGAGGGATGGGTCTGGAGACTGGGCCT
CATTGCACTCCCACCCTTGAAGGTCACTGGTCATGCTTTCTGTGCTTCTTACACTGCTGC
TCTGCTTGCTCACTGGTTCTCACCCCAGATTCTCATTTGCCCCCACCACTGTCTCCCATG
TATTTCTCTCCCCTGCTGCTGCTCCTCGCTCTACCCAGCTTATTTGTATTTTGCCCTTCT
GGGTTTTCTCATCCTTAGGAAACTGTGCCAGCTTCTCATAGCTCTGGATTCTTGGGCTCT
AAGCCTGAGGTCCCAGGCCCTCAGGAAGAATCCAGAGATTCAGGCACAGAGGCCCTAACT
CCCCACATCTGGAATCGTTTACATACTGGTAAGGCTGGTGGAGGGGAAAGATTGGAGTGG
GGCATGGTGGGGTGAGGTGGGTCTTAGTTTTCTCACGGTGCTGCCTCATGGTTGGTGTTC
TCCAGCCACAAGCCGAAAGAGTTACCAGCCTGGCTCCATAGAGCCCTGGATGGAGCCCCT
GAGCCCCTTTGAGGATGTGGCAGGCACAGAGGTGAGTAGACACTGGGAAGGGGTTGGCAG
CCAGGGTGAGGGTTTATTGAGTGTTGGTTGGTATATGACGCCTCTCAGGTGCCGGGTGTT
TTACCTTGCTTCTTCTCCGCTCCTCAGATGAGTCAGTCTGACAGTGGGGTGGACCTGAGT
GGAGGTTCTCAGGTGTCATCAGGTCCCTGCAGCCAACGAAGTTCCCCCGATGGAGGACTT
AAGGGGTCAGCAGAGGGACCCCCCAGGCGGCCTGGAGGACCCTCACCCCTAAAGGCTGTT
CCTGGTGAGAGTTCATCTGCCTCTGAACCCTCCGAACCTCATAGGAGACGGCCACCTGCT
TCCCATGAGGGGGAAAGAAAGGTAAAGACTAAGGATGGACGAGAAATGTCAGCAGGGCCC
TTCCTCGCCCCATGTCTGATCGACTGTCCTTTCTTTGCCAGTGTGCTTTGCTTTTTCTTG
GCTTGTTTCTCTGTCACCCAAATACACTGTTTCTCAATCTAGGAGCTGCCCCGGGAGCAG
CCTCTGCCCCCTGGTCCCATAGGCACAGAACGATCACAGCGCACAGACCGAGGCCCAGAG
CCAGGCCCTCTCCGACCAGCCCACCGAGCGGGCTCTCAAGTTGAGTTTGGCACGACCAAC
AAGGTCTGAATGGGCTGAGCTTGGACATGTCCTTGAGTGGGTATGAGAATGATAAATGGG
ATGGAAGGAAGCGTGAATTCCATTACAATCTTCCCTACACATTACAGGACTCAGACTTGT
GCCTAGTGGTAGGAGACACTTTAAAAGGAGAGAAGGAGTTGGCGGCATCAGCCACAGAGG
TAGGTGGGAAGCCTGTGAGTTTTGATGCCAGCGAGTAAGAGTAATGAGCATCTAGGGCAG
TGGGTCTCACCTTCCCAGCGATGCTGCCACCTTTGTACAGCTCCTCATGCAGGGGGCCCC
AGCCTTGAAATCATTGCTACTTCCTTGATAACTGTCCTGTCATTCTACTGCTGTTAGGAA
ATGCAGTGTAAATATCTGCTGATTCAGAACCCCTTGTGAAAGGGTTGGCTCAACTCTCAA
AAGGGGCCGTGACTAACACATAGAGAACGACTGCTGTCCAATGTAAGCCAGTTTGACAAG
GCTTCTTTTGCTCAGGCCGTGCCCGTATCCAGAGACTGGGAGCTGCTCCCCAGTGCTTCT
GCTTCAGCTGAGCCACAGGCCAAGAGTCTGGGTTCTGGGCAGTGTGGTCCAGAGCCCAGC
CCTTCAGGTCAGCGTCTGTACCCTGAGGTCTTCTATGGTAGCCCTGGACCTCCGAACTCC
CAAGTAAGCTCCGTTTTTAACCATAAGCCCCCTTTCTGTCTTGTCTTTTCTGTTCTTTTT
CCTTTTCATTTTTGTTTTGTTTTTGTTTTTGTTTGGGTTTTTTTTTTTTTGGAGACAGTG
CCTGGAACTTAGTATGTAGACCAGGCTGGCCTCAAACTCAGATTCACCTGCCTCTTCCTT
CCAGGTGCTGGGATTAAAGATGTACCCTACCAACTTGCTCAGCTGGATAATGGTTTCTTT
TGTTTGTTTTTTTAAATTATTTTTTTAATGTTTTTAATTTGTGTGTTTCCGAGCGGGTGT
GTGTCCCAGTGCATGTGTTACGCTGAAAGCAGGGTTCAGAGGACAGCTTTGCTCCTCTCC
ACCTCTACATGGATGGGTACAGGTTACCATGTGTCAGCAGCAGGGCCTTTACCCCCTCAC
CTGCCCTGAAGTTAGTTAATTTATAAATCATTTCCACTGTGTTCCATTTTTCTTTTTCCT
CCAAGGATGGGTGGTCTGGTGCCTCCACCCCCTCAGGAAGTTTTTATTTCATGTGCATGG
GTGTTCTGCCTGCATGTCTGCACCATGTGTGTAGCGTGTCCTTGGAACTAGAGAACAGCC
AGTGTACCACTGGGGTTTCTCTCTCTGTTATAAGTTATGTGTGGGTAGGTACACATCATA
CATGATTGCAGGTGCTCACGGAGGCCAGCAGTCTGGTTTCCCTAGAGCCAGAGTTACGAA
TGGCCATAGGCCTGGGAAAGTATGCTTGTTAACTGACAGCCATCTCTCCATACCTGTCCT
CATATTTTATTTTGAGACAGGGTTTTGCCAAGTTAATCAAATTGGCCTTGAGCTTACTCT
ATAGTATAGACTGACCTTGAACTTGATGGTTGCCACCTTTGACATCTGTCTTCCTAGGAA
CTAAGGTTCTACCAGACTGCTTTTTCACTTGTACTGTGTCCAGGCCCTTGGTCTGTGGGA
TGGTGCTGCCCACTTTGGTGTGGGTGCTCTTCCCTTGGTTAATTAACCCTCCCTTCTAAA
ACACCCAAACACAGAAGGGTGCCTTATTGCCACCTATGTGTTTCTCAATCCCGTTGACAG
CCAAGATTACCCATCACACTGTGCTAGAGATCAGACTTGGGGGGGCTCAGTGTCAGTGAA
GCCCTCTCCCACTATGCAGTACATATACATATATATATATATATGCATATATATATATAT
GCGCATACACACACACACACATATATATATATATATGCATATATATAGATAGATAGATAG
ATGCAACCCAAGTTTGCTTTTCTTGAACAAAGACACTGGAGCTGCTCCTGTCTTGCTTTT
CTCCAGCAGGTCTCTGGGGGTGCACCTATCGACTCCCAGTTACATCCCAGCAGTGGAGGC
TTCCGGCCTGGGACACCCTCAGTACACCAGTACAGGTAAAACCAGGTTACCCAGGGACCA
CATGCACAGAGGGAGAGGATGCAAGAACAGAGGGTTAAGGTATCACTCCAGCTAAGGAAT
AACACCTCTCCTCCCCAACTTCTTTTCAGGTCACAGCCTCTGTATCTGCCCCCAGGTCCT
GCCCCTCCCTCAGCACTGCTCTCTGGGGTAGCTCTCAAGGGCCAGTTTCTGGATTTCTCA
GCACTGCAAGCCACAGAGCTGGGGAAGTTGCCTGCTGGGGGAGTTCTCTACCCTCCACCG
TCCTTCCTCTACTCTGCAGCTTTCTGCCCCAGCCCTTTGCCTGACCCACCCTTGCTTCAG
GTATGAGGTGGGCAGCTGCCAAGGCAGCAGAGAGGATGTTCTTGGGGGACTTGACCTGTT
GTGGTTTCTGACTCTGTCACCCAGGAGAGCCTGAAGACATCATGTAGTTGAGATTACAAG
TTTGAGCCAAAGCACACACCTGAGAATTGACCTCTCCCCCATTTCCCAACAGGTACGCCA
GGATCTGCCATCCCCTTCAGATTTTTACTCTACCCCTCTGCAGCCAGGTGGCCAGAGTGG
CTTCCTTCCTTCAGGAGCCCCTGCGCAGCAGGTATCTTTGATCTTCCCACTTCGCTTTAC
TCTCTGCCTCTGGCTTAGGGTTTTCCGTGTTCTTCCTGTTCTGATGGGCTGACTGGGCAT
TTCTTGTAGATGCTTCTACCTGTGGTAGACTCTCAGCTGCCAGTGGTGAACTTCGGCTCC
CTGCCGCCAGCGCCACCCCCTGCTCCACCTCCTCTTTCTCTGTTACCTGTGGGTCCTGCT
CTCCAGCCCCCCAATCTGGCTGTGCGGCCCCCACCTGCTCCTGCTGCACGGGTCTTACCT
TCACCCGCCAGGCCCTTTCCCGCTAGCTTGGGGCGAGCGGAGGTAAGGTGTTTGAAGGGT
GGGAAGTGGGAGCAAGATTCAGAGTCTGTGTGGGTGTGTCTAAAAGGGTAAGTGGTTCAG
ACAGAAAGCTCACAGGATAAATTATTTTTATTTCAGCTGCATCCAGTAGAGCTAAAGCCT
TTCCAGGATTACCGAAAGCTGAGCAGCAACCTTGGGGGTCCTGGGTCATCACGGGCTCCC
CCATCTGGAAGGTAAAACCGGAATGGAACCCAGGCTCTGCATCCCCAGGGATTTCCTTTA
AGACGGGCTCACCTTGACCACCCTTCCTCCCTTAGGTCCTTCTCTGGTCTCAATTCCCGG
CTCAAGGCCCCACCTTCCACCTACAGTGGAGTATTCCGGACTCAGCGCATTGACCTCTAC
CAGCAGGTGAAGGAGTGACCCTACCCCAGTACAGCAGGTCCCCTTCTGAGCCTCGGAAGG
ATTGCTAACTCACTCTGCCACACGTACCCCGTCCTTCCTCAGGCTTCCCCACCAGATGCC
CTGCGCTGGATGCCGAAGCCTTGGGAACGGACAGGGCCACCTTCTCGAGAAGGGCCTCCC
CGAAGAGCAGAGGAGCCCGGGCCCCGGGGGGAGAAGGAGCCTGGATTGCCTCCACCCCGC
TGAGGGAGTTCCCCTTGACCCCATCCCCGGGGCTTGTATATAGATTATAAATATATAAGA
GGGAAGGGGTGGGTGGGGAGGGGTCGTGGGTCTGGAGTCTCACTGCCCCTCTTCTCTTCC
CCTAGTCCCCTATCCCTGGGGCCGTTTGTTAAAAAAGAATAATAAAAGAATTTAAAAAAA
AGGGAAGTCAAGGGTAGGGGGGAATAGCAGTAATGTTTTACACTAAGTTCAGTGACTTAC
CTGTTAAGTAGTGTAAGGTTTCAGAATTAAGAATTTGGATGAGGTCAGTGGGTACCTATC
TTAGGGGTTCTATTGCTATGACCAAGTCAACTCCCACTCCGGTGACACTTTCTCCAACAA
AGCCACACCTAATGAGACTCCATATGAGCCTATGGAGGCCATTTTCATTTAAACCACCAT
ATTCTACTCCCTAGTCCCCATAGACTTGTAGCCACATATAAAAATAGATTCAGTCCATTT
GAAAGTCCCCATAATCTGAACCCTGTTTAAAAATCCAGTCTCTTCTGACATTCATTGCAG
TCTCTTAGCTGTAACCTTTGTAAAAAGTCAGATCCTACATTTTCAGCATACAGAATATAC
ATTACCATTCTGACAGCATAGCGAGGGAATAGTAGACCAGCACTAGAACAAAAACCAACT
GCAAAATCTGTCTCCATGTCTTATCACCAAAGCTTTTCGGATCTCCGAACTCCATTTGGC
TTGCAGCAACGCACTCTCAGGCTGGTTCTCTCATCTATTCCTTCATCAGCTCTGGCATCA
CCAAGATCTTGGGGTCCCCAAGGCAATCCAGTCCACAGCTTCCCACTCTGGCTTCTCTAG
GCCTCCATGTAGACACTCCCAATCTCCTGGAGGAGATACCAAAGCTGCCAAGTTCTGTTT
GCTGGGGCTAGGACATGGCCACCTTTCCAACTCACCAACTTTCTGTGATAGTTTCCTTCA
CTGCCTAAGCTTGACTGTCCTTGAAAAAATGCCTGCCTTTTGGGAGTTTGGGGGGGGGGG
GGAGTGTGTGTCTTGCCTTGAAGCCACCATTCCCTTTATTACTCTTGGCACCAGGCTTTT
CATTGTCTATGCTTCCTCAGGTCCTAAACAGGACATTTTGTATTTCCTTCCTCAGCTTGC
TTATTTCCATGTCTGCACTATGACCCAAGCACGCATCAACC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1112, 1557..1734, 2038..2137, 2225..2297, 2461..2604, 2757..2909, 3090..3169, 3309..3451, 3704..3794, 3898..4111, 4478..4952, 5293..5483, 5695..5998, 6323..6533, 6677..8527, 8967..9235, 9441..9571, 9798..9927, 10025..10110, 10227..10460, 10602..10742, 10847..10918, 11235..11402, 12729..12814, 12929..13139, 13312..13410, 13509..13721, 13836..13930, 14015..14105, 14202..14520
1001..1112, 1557..1734, 2038..2137, 2225..2297, 2461..2604, 2757..2909, 3090..3169, 3309..3451, 3704..3794, 3898..4111, 4478..4952, 5293..5483, 5695..5998, 6323..6533, 6677..8527, 8967..9235, 9441..9571, 9798..9927, 10025..10110, 10227..10460, 10602..10742, 10847..10918, 11235..11402, 12729..12814, 12929..13139, 13312..13410, 13509..13721, 13836..13930, 14015..14105, 14202..14342
AC_000088.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved