Rattus_norvegicus Locus RGD1563912_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RGD1563912_predicted
Rattus_norvegicus
RGD1563912_predicted
3
SNORA71, SNORA71
3923..4056, 4750..4882
7180
TTCTAGGACAGTCAAGACTACACAGAAGACCCTGTCTCAAGAAAGAGAAATCACACTAA
AACAAGAAGCATTGCTGACCCGTTTTGCACGAGCCTTGTGTCTCTATTTCACTCCTTACA
TATACTCCTGGATATAATATACTGCACATTTCATAATCTATTCCTTATTTTCCATCAAGC
ATGATTGTCTTTTCTTCAGAGAAGGCCCTGCTGTCCATTCTGGATAAATACATAGGTCAC
CACTGTCACAATCTGCCTAGTGTTTCATGTGTAGTGCTTATGGTTTTTTTTTTAATTTAT
TTTATGTGCATTAGTTTTTTTGTCTGCATATACATCTATATAAGGGTGTCTGACTTGAAA
TTACAGTTATGAGCTGCCATGTGGGAATTGAACCCAGGTCCTTTGGAAGAGTAGTCAGTG
CTCTTAATCACTGAGCCATCTCTCCAGCCCCACGCTTATGATTTTTAATGGTCAAGTTTT
CTAGCCTATTTATCATGCTCATTAAAATGTAACCGAATTAGGGATCATGCCTGTCTTGTT
GCTTTTAATTTTAGTGCGTAGTCTGGCCCTTGATATGACGTAGTTCCTTGGAGGATATTA
TGGGTGGATGCAAGGCTAGATGAGCAGATTAATGAAAAGGTGATTGGATGGATAGATGAG
TGGATGGATGGACAGGCAGACAGATGCATGCAGACGAATATTTAGATACATAAGAAGGTA
GATGGGTCAGTATTGATGGATGACTAATGGGATGAGAGGTAGCTGACGTTCCGCACATAT
TTTCTGGCAAAATGGATGCATGGACTGATGGGAAAGAATGGAAGCTAGGACTAAGGGAGG
AGAGCCTCGCTGGCGCGGTAAGCATTTCAGTTCTACTCCTGCAGGGGACGCTGCAGAGCC
ACGCCCACTGTCTGCGCAAAGGTGAAGCTGGAGACTGCAGCGCGCGCGCAGCCGCAGCTG
GGCGGACACTGCGGTGTTCGAGAAGGGTCTTGCGCAGTCCTGCACTGCGGCACTCACGCA
CTCCACTTTCCACCTCAGCCTGCTAGGCGAGTCACCTCGGCTCTGCGCTCTCGGCCGCCT
CCAAGGCCTCCAAGTCACCTTTAATCATGAAAACCCAGGAGCCGGGAAGCTAGGACGCGG
GCTTGATCCTCCCACACCTGCGAGCTATGGATCTTCTGGAGTACACGAAAGGAGATATCG
CTGGTAGGCTGCGACATCTGATGGGTTCGAGCTGAGCTTAACCCCAGCTTCGGAGGAGGG
AGCCAGTAGGAGAGAGACCCGGGACGCAGTGCTGGTGTGCCCGAGCGGAGGTGGAGGGTT
GAGGGTTGGGGGCTAAGCCCAGGCGTCTTGGGTTCGTTCAGGTAGCATGCGAAGCCACTT
GTCCTTTCTTACTAGGGTCCTCAGACTGTTGACGCGTCCTTCCAAGGAACTGATAAGCCC
AGGCCCCTAGGACGGGATGCTAGGACTCCAGTGTGGGGCCTTGCTGTGAACCCCTTCCCA
AGTGTTTGCTTCCCTGATGGGCCTTTGCCAAAAGGCCCTCTTGACACCGAAAAGGATGAC
GACTCAGGTTCTGCGGCAGCCAATGCCCCTCCCCCAACTCTCTGCACTCACTGGTGGGGG
CCACGGTCAAGGAAGCAAGTATCCCGGTAAGTGTTGCGGGTGCACCTTGAGGCCTGAGGG
CCACCTAATTTTAGCCTTCCTGTGGGCACCAGCAGAGGGGTGGCATGGAGTTCAACCAGG
TTCTGAGGGGAGCCTAGCAACGACCCTGTGTGGGAAGTCCACTTGGGAGTCTGGACTCAG
GCCATAAAAAATCCTCAGGTCCTATGTGTGCTAGTTCTTTCGTTCCCAGGTAGGGAAGTC
GCAAAGGCAGATCTGGCTGCTGGTCATATTTTGAACCCTAGTGGTGGCATGGTGTGAATG
AAACCCATTTCTCATTTTGAACCTAAGTTGGTCTTCTTGTGGGTGGCAGGTAGAGTCTTA
CCTGAAAGGATGATTTATTTATTTAATAGAGCTTGAGGTCTTTGAAGCCGGCGTTAGACA
GTCAGCCAGCCAGTATTTTTCCATTTGAGGTCCTTTGCCAGGAGACGGAATAAAAGGACC
TTCTGGAGCAGCTGCCATTTATCAGAGTTTGCAGGAATGATCTGGAAAGTGTTCGCTGAC
ATAGGTGATTTGTTGCTAGCCTCTCCCTTTGTTCACGAGAAAATGCATCGTCACGAGTAA
TCCAGCCTCCCGTGTATCCGTTGTATTTGACTGCTGCACCAGGGACTCTGTGTGTGCTGC
CCAGGACGGATTTGACCAGGTGACATTTAGATGCTTATTTAAATGCTTCTTGTTTATTGC
AGAATTGACAGCTTGGTGCAGAGGGGACATGCGAGGTGTCTCTATCCTGAGAGGAAGCAG
CTGGACCCTGGCGCTCCCAAGGTAGGGTCTGAACTTAAGATGGCTGCCGTCAAGGGTTGC
TCACAGGTTCCCAGGGAAGTGAGGTAAATGGACAGAAGAGGAAGGCGGCTGCATCCCTGT
CCCCAGTTTCATTGTCCCCTGGGCCACTGGTGTACATCTAATTTCTGTTGTGCCTGCTTC
AGTTCTGAGTCCTCTGCAATGCTTCTCGATTTGCTGGGTTAGCAGCAGAAGGTCTGAATC
AGACACAGGCGATTGCTGTACCATATCCACCAGTACTCAGGTCCATACTGGTTGGGGTTC
CTCTTGCTGCAGTAAAACACCATGACCAAAGCAGCTTGGGGAGGAAAAGGTTTATTTGGC
TTACACTTCCACATCACTGTTCATCATCAAAGGAAGCCAGGACAAAAACCCAAACATGGC
CAGGAACCCGGAGGCAGGAGCTGACGCAGAGCCCATGGAGGGGTGCTGCTCACTGCCTTG
TTCCCCCTGGCTTGCTCAGCTTGCTTTCTTATAGAACCCAAGACCACCAGCCCAGGGATG
GCCCCACCCACAATGGGCTGAGCCCTCCCGCAACAATCACTAACTTAAAAAAAAAAAAAT
GCCCTACAGGCTTGCCTACAGACCAATCTTACAGAGGCATTTTCTCAATTGAGGTTCACA
CCTTTCAGATAACACCAGTCCGTGTCAGGTTGACATCAAACTATCCAGGACAAGGTCTCA
TTCTCCGGAAAGCAGAACAACTAGACTATTTTCCTTTGGGCCAGGAACCTCCTTGTTTCA
CAAGCGAAGACCGCCTGCTGTGTGCATTCCTTTGGACTCCACCCCCCACCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCACTGTCATCCGGGCTTTTGCTTTCGTGCCCTGGGTGTTAAGTTCTCCTGGATG
GCCGCAACGTCATTGCCAGTCCATGGGGACGTATTCCCACAGACCCGTTTCATCCTGTTG
GGCATTACATTGGTGGTGTGATTGATGGTGACTGCTTTGCCATAGACTGCACACAATGTC
CTTTTTAGGAGTTAAAGCCGACAATGGCTTCGTTCTGGAAGTAAGAGCCAACAGTTTTGG
TATGCTCACTGACTGGTAACTCCCGCGCCAACCCTTTGTCCCATAACCACCATACCCTGC
TGTGAGCAGTGGTAAGATGGGTACTCATCAAGTTTCATGAGCTTTGCAGGTGACCCCACT
GAATACAGAGGCATCCTGGGAGTTGCCATGTCAGGAACATTCTAGACCCACCTGTACTCG
AGGTCAGACCTCTTGTCCAGTCCCTTCTCTGGAGTACTGATCCCTTGCATCCAATACAGC
ACCATGCATGTTGCCACAGGCTTTCAGCGATGATACAAGGGCCGACTAGACACGGGACTC
CTGCTCTGTCACTCTCTTATGTCAAAGACAGACTCAGAACTTCACTTTCAGCATTTGAAA
AATAAAAGGATAGCCGGATGAGGTGGGGCACACCTTTCATGCCAGCACTTGGGAGACGGA
GATCTCTGTGAGTTTGAGGCCAGCCTGGTCTACAGAGCAAGTTCCAGGACAGCCAGGGTT
AACACACAGAGAAATCCTGTCTCAAAAAATGAAAAAAAAAAAAAAACCAAAAAATGGGTG
TGGGGGTGGGGGTGGGGAGAAGAACTGAACAGAAAGGAGGGGGCTGGAGAGATGGCTCAG
CAGTTAAGAGCACTGTCTGCTCTTCTAAAGGTCCTGAGTTCAGTTCCCAGCAACCACATT
GTGGCATCTGACCATCTGTAGTGGGATCTGACACCCTCTTCTGGTGGGTCTGAGGACAGT
GAGTGCTCACATATATCAAATAAATCTTTAAAAAGAAAGAAGAAAGGAAAAATAAGACAA
CGACCGAGGCAGAGACAACTTCTGTTCCACTTGAGCGCATATGTCTGTCCCAACCCCTTA
TGCCTCCCAGTAGCTCTGCCCAGGGAATCTTCCTTGGTTATCTGTGGCCGAGAGGCTTTC
TGGGGCCTGTGTAGGGAACAAGGACCATGGCAGAGGAGTTCATCTTGGCTGGGCTCTTTC
CCTGGACACAACAGGACAGGCCTCCGGGATCTGCCTCTCTTCCTGGCCTCACGTCTGTAC
CTGTGCATGCACCTGCATTTGGAAGCCGACCACGGGCTGCCTGTGCTCTGGTCATCCATA
ATGCAGGGAGAGGAGTTGCTGAAAGCCATTTCCCGTGTTTGAAGGGTCCACTCCTCCCTC
TCAAATGCTGGTGCTTTCACACACTCCTGCCAGCGTTTCGGCCTCCCCACGGGACACTCT
TGAGTGTTTCGTGTTATTGTACTTTGTTTTGTTTGTTTAGTTTGAGACTATGTGGGTCTG
GCTGGCCTGCCTCTGTCTCCCAAGTGCTAAGATTAAAAAAAGACATGAGCTGGGCCTGGG
AGAGATGGCTCAACAGTTAAAAGCACTGGCTGTCCTTCCAGAGGTCCCGAGTTCAATTCC
CAGCAATCACACGGTGACTCATGACTATCTGTAAGGAGATCTGATGCCCTCTTCTGGCGT
TCGGGTGTACATGCAGCAGAGCACGCATATATTAAGTAAATAAGTAAATACATTTATATT
TTGGCTTGGGCTTTCTCGGCTTGGCTCCCTGCTATCAGAGATCAAGGTTTTGACACTTTA
GGATCTAGGAAGGCCAAGGTGAATTACACATAATGAGTCACCACTACAAGGTTTTCATAG
AGAAGCTATCTCTATGGGCCTTTGCAGAAATGAGGTTCAATGGACTAAGGAGGCTTGTAG
GAGAAGGCATGGGAGGGACTCGGTTGAAGTGCAGGCCACTAATGACAGTCTATAGGCAAG
ACTGCAGATGGAGGGACCTTGGTGGGGGGAGCCCTGAGAGTAAGCCTCTGAGCTGTGTCT
CTGCCATTTATATGACTGCTCAGCCGACCGGAAGGGAGCTGTTTTAGACTAACAGGACTG
CGTTCACGTTGACTTTCTCTCCCACATTAATTAGGAGCGTACTCCCCAGTGTGGAAAAAC
AAGAGAACGTGACTGTCTCATGGTGAGCGCCTGCTGGGGCCTTATCCAGGTGAGTTACTG
CTGGACCACAGGGTCAGAGCATACAATCTGAAATGGAACTTACAAGCTGCCGGCCTTGCC
TGATTTTCTGCCCTAGGCTATGGCGGTCTCCGTGGGCGTCCAGGGAGAGCAAGGATGCTG
ACATGGAACGTGCCTCCAGAGCTCGTTGCCATCGGCTCGCCAGCCAGGAACACCTTTTTA
CTTTGGTAGGTATGCAGAGGGAAGGGCCTTGACTCTGGAGACTTGGGGACCAAAGTTAGA
GCGGAGGTAGTTCTGTCACTCCCCTTAGACAGAGCCACAGAATGCCAGGTGGCACTAAGG
TCCTTGCTCTCACAAGTAAGCACTGTCCGGGGAACCAGCAATATTAAACACGCAGGGTTG
TCTCTTCAAAGGGAGAGATAGATATCCTGTTTTTCCTCCCAGAAGGCTGGGAGCGGAGGT
GTTTAATATCCTGGCGAACTTTGTGCTATCTGTATGACCAAGGCCATGCTAGATCCTCCC
CTAAGATTATATATGAATCTTAAGATGTCATATATAATCAATATACCTAGTCGGCTAGGT
AGTGGTGGTGCATGCCTTTACTCCCAGTATTCTGGTAGCAAAGGCAGGCGGGTCTCTGCA
TTCCTCCCCTAAACCCTTAAGATGTCATATGTAATCAGTCATCTGGGTGGTGGTGGTGCA
TGCCTTTACTTCCAGGACTTGGGTGGCAAAGACGGGTGGATCTCTGAGTTCGAGGCTCGC
CTGGTCTACAGAGTGAGTCCAGGTTAGCCAGGACTACCCAGAGAAACCTTCTATCTGGGA
AAAAAAAAAAAACAATAAATAACTTTTTTAAAAAAGTTGTCACGTGTAGTTAATCATCTT
TATGGAAAATGTCACATGTACTTTACAGATGTAGTCATGGCTTAAATGTTAAACTACCTG
GTGTCAGACTCTTGAAGTTTGAACCAGCACCTAGCCGGGCGATGGTGGCGCTCGCCTTTA
ATCCCAGCACTTGGGAGGCAGAGACAGGTGAATCTTTGAGTTAGAGGCCAGCCTGGTCTA
CAGAGTGAGCCCAGGACAGCCAAGATTACACAGAGAAACCCTGTCTCAAACATAGAATTA
AACGAAGTAAAATAAAGTAATAAAAACGTTTGAATCAACGCTGGCTGCTGAGTCATGTTG
AGCCAGAGTGCCTTTTATACCTTACTTGGGCTCTCACCCTGGCTGGTGGAGGTGCCTGCA
GGAACCCCCACAATGGCGACCAACAGGAGGGGCTCAAGTCTTGGAGAAGGTAAGAGAATT
ATTCTTTAAATAGACTCAGGAGCGGTGTGTGCCCTCACCTAGGAGGTCACAAGTAAGTGG
GGAGACAAAATAAGCCTGGGTTCTTCCCAGTCCAGAGACAAAGCATTTTCTACAATTACT
GAGCTGTTGGTTAAGATCTAAAGGAGGGAAATAGTTAAAGCAGCAGTCAGTCAAATTCAG
TCCTTGGTTTCCTGAACCAGAAACTATTGGTGTTGAAATTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1202, 1395..1645, 2342..2420, 5614..5688, 5776..7180
1516..1645, 2342..2420, 5614..5665
AC_000071.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved