Rattus_norvegicus Locus ENSRNOG00000006847
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus ENSRNOG00000006847
Rattus_norvegicus
ENSRNOG00000006847
3
SNORA62
1183..1334
3333
ATAACCCTCAGAGAACGGAAGCCACAGAAATGGGCTGGGCAGGTTCATAAACCAAGTGT
GCCATCATGAGATGTCACCACCAGAACCTTTAGCAAAGAGCTTTGATGAAAATATTGAGT
CAATCTGGGCATGGTGGCAAATGCCTTTAATCCCAGCACTTGGGAGGCAGAGGCAGAGGC
AGGTGGATCTTTGTGAGTTCAAGGCTCTCCTGCTTTACTCCAGGACAGTCAGGGCTGTTA
CACAGAGAAATCCAGGCTTGAAAAACAAAAGAGGGGGGGAGGGGGAGGGAGAGAAAGAGA
GAGGGGGGAGGGAGAGGAGGAGGAGGAGGAGAAAAGAAGAGAAGAAAGAAAAAGAAAAAA
TACTGAGAGTCACATATCAACATGGAAAACTCCCAAAGCTGCTATTTGCCAGTGAAAGTT
CGGGAAACAGATACACTTTTTTTGAGGTGTGTTGCACTGTGGTGAAGGAACTGACCTCAC
CCTTTATCCCTCAGAGGATATCTCCCTGGATACCCAGTAGTGTCTGAGCAAAGATGGGAT
CTATTGTGGAACAATGTCCTTTAGGCATAGTAACCATTACCCTGCTAACTGGAGCAGCTC
TCAAGAGTGGCCCTGCGGGCTGGAGAGATGGCTCAGCCGTTAAAGGCTAGGCTCACAACC
AAATATATAAGAGTGGCCCTGCTGCTCTCTCATAGAAGGGGGCAAAATCAGACCCTCACC
AGGGACTCCAGCCCCTCCCTCCTGCACCACCCCACTTTCCCAGCTGTTTGCAATTCTGCC
CTAGCTGCTTGCGATCTTGGAGGTGCTAAAAGTGTACAGAGTTTCAAAAGTAGTCACACA
GGCTGAAGTGGCCCTTTTCAGTGATGCGACAGTTTGGGATGGAGGGGATCAACTCTGCTC
CTGTAACAAACCCCTCTCCCAGGCTTCTGTAAGTAACTCTGATAAACTTAGTATTTCACC
ACGCTAGCCTGGAATAGAACTGTTGCTTTGCCCCACCTGCCATGAGTAAATATATCTACC
CAAGAAAAGCTAACGTAACAAGATCCTACACGACTCCCCATACTTGGGAATAAATGACCT
TATAAAAGAGTCCACCATTAAGGGACTGAGCCCCAACTATGACTGATGTCCCAAGCATCT
TTAAAGATGTCCCATCGATGGCAACTATCGTCATTTCAGAAAATGGGCTAAGAGGTGGGA
AAAGAGTGGATACACCTTGGCCAGTGAACTTCTGAGTGTTGGAAGTGTGCTACATTGAAA
CTAAAGCAGGATTTCGCTAACACCAGTAGAGCTTGCCTCAATGTCTGGAGTTCGGTAGTG
ATCACTGCCACATACATATACTCTGCCTTCCTGCAGTGTCCATTTACAGAGCTATGAGGT
TAGCAAACCTGTCTGGGGCACCCACTTGTGACCAGATCCACTTGTGGCCAGGTGTGGTGG
TGCACACCTTTAAACCTAGGGCTCAAGAGGCAGACACGCAAATCTCTGATCAGCCTGTTC
TACAGATAGCCAGGGTTCCACAGACCCTGTCTTGGAAAGCCCCACCCCGACAAAGAATTC
CATTTGCTGGCCTAGGTATCTACATCATAAACCTGAAGAGGACCTGGGAGAAGCTGCTGC
TCACAGCTCCAGCTATTGCTGCCATTGAGAACCCTGCTGACGTCAGTGTCATCTCCTCCA
GGAACACTGGTCAGCGAGCTGTGCTGAAGTTCGCTGCTGCCACAGGAGCCACTCCCATTG
CTGGCCGCTTCACACCTGGGACCTCACTAACAGATCCAAGCAGCCTTCAGGGAGTCACGG
CTTCTAGTGGTGACCGATCCCCGGGCTGACCACCAGCCCCTCACAGAGGCCTCTTAGGTC
AACCTGCCCACCATTGCCCACCATTGCGCTGTGTAACACAGATTCTCCCCTGTGCTATGT
GGACATTGCCATTCCGTGCAACAACAAGGGAGCTCACTCAGTAGGTCTGACGTGGTGGAT
GCTGGCCCGGGAAGTACTGCGCATGCGAGGAACCATTTCCCAGGAGCACCCAGGGGAGGT
TATGCCTGATCTTTACTTCTACAGAGACTCAGAGGAGATTGAGGAGGAGCAGGCTGCTTC
TGAGAAGGCTGTGACCAAGGAGGAATTCCAGGACGAATGGACCACACCAGATCCTGAGTT
CACTGCTGCTCACCCTGAGGCGGCTGACTGGTCTGAGGGTGTGCAGGTACCCTCTGTGTC
CTTCCAGCAGTTCCCAACGGGAGACTGGAGTGCATAGCAGCCACTGAGGACTGGTCAGCA
GCTCCCACAGCGCAGGCCACTGAGTGGACTAGAGCCACCACTAAGTGGTCCTGAGCTGTT
CTGCAGATGCCTGAGCGAAGGAAAAAAAGATGGAAGGAAAATAAAGTTCCTAAAAACTGC
AAAAAAAAAAAAAAAAAAAAAAGAGTGAATACAGGCCATTCCATAAGTGCCTTTTTTCTC
TACACTGGGTATTGCACCCTGGAGACCTCACACAAGTAAGACAATCCCTCTATCACTGAC
CTGCACACACAGTTAGCTTTATTTATTAGGACAGACTGTTTTAGAGATAAATTTGTACAT
TGCTCTGTGGCTGGAAGCCAGAGCCTTACACATGCTAGGCAAGCACTCTACCACTGGCAT
GCACTAGTAATCCTCTGATGACTCCTTAGCAGAGGCAGGCGCTCATGTGTCTCTTTCCCA
GAAAGGAGAACATAAAATTCCAGTTTGTCCAATGTTCGTTGCAGGATCTGATCTTTGGCT
CTGGGCAAATGCGACCCAAGGGTTTGTGGAGGCCCTGAGCAGCCCACTTGTTCTGGTCTC
TAGCCAGTACAACAGCAGAAGCAGATCTAAGAAGAGTGCATGATCAACCACAAGACAGCT
GCCGCCCTTTGGGGTCCAGACATTCACTGGGGCCCCAGGTTGAGAGAAGCCTAGGAGAAG
GCAGGCCCACTTGTACAACCACACCTCCCACCTGCCATGTGCCAACCCTTCTCCTCCAGC
CACACTTACTTCCCACTGTGAGCACAAGAAGCCTGTCCCTAGGCCAGCATGACTAGCGTC
AGGCCCATCACCTCATAACACCTCAGTCTAAAAGGGCTGGTTCCCTCTCAGATTCTCATT
TCCTTCCTGCATAATAAGAACAATAACTCACAACCGTAGTGTGACCTGTAGCCAAGATTG
TTCCGAAGCCTTCGGATAGAAGAACTTTTGTAATAGCTTTCTGTTGCTAAAACAAAAATA
CCTGAGATAATCACCTTAGTAAAAGAAAAGGTTTGTTTTGGGTTCACACTTATTGTTTCA
TGACTATTGCTCTGGGCCTGCAGCGGAGACTCAG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1574..1768, 1770..1853, 1858..2253, 2256..2333
1001..1033, 1574..1768, 1770..1853, 1858..2253, 2256..2330
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved