Rattus_norvegicus Locus Nol5a
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Nol5a
Rattus_norvegicus
Nol5a
3
SNORD110, SNORA51, SNORD86, SNORD56, SNORD57
1893..1961, 2690..2821, 3646..3731, 4145..4214, 4465..4536
6793
AATCCCTTTAGGAGTTGCAGTAGAGTTCAGCTGGTGGAGGCCCTGCCTTGAATTCGCTA
ACAGATACACAGGACTGGTAGAGGTTCAAAGAGCATACACGTAGTCAGCTACAGAGCCGC
CAGAAGGTGGGGGGGAGGGGTAAGGAAGGGAGGAAAGGGAAGAGGGAAAAAGGAAGAGTG
AGGAGGTGAGGAAGGATGAAGGAAAGGAAGAGGGGAATGGAAAGAAAATGAGGAGGGAAG
GGAGGTAGAGAATCCCCTTAGCATTATTATTTTCTTTAAGGCACAGACTAAGAGGCAATC
AAGTTTGGGACTTAAAATGCTAAAACTAAAGTTATGTGGGTTTTTTTCCCTCTTTAAAGC
AAGAGTAATTTTAAATTAGATACCTTGGTGTGCCTACAAATGACATTGTTAAACAAGAAA
GCATCTTCTTGGAAGGATTCAGGGCCCACTCAGCCATGAGCACCACGTGGTGCCGAGCAG
AGCTCGGTTCTATGAAGCAGGGCAAGGAAGAGAACTAGCAAGAGGTAAACCGCCATTATC
TACGCCACTGCCCGCACCAACACTTTTTTGAACAACAAAATTTAAGAGGAAGACGCAGGC
AGCAAGGAGCCGCCATTTCTGCAGCGTCGGGGACCGGGTCCCAGGCGGAAGGCGAGGACC
AGGACTGTCTGGGCAGCGGGAAACCGACAAAGTTCATCAGGGAGCCTTTCGTTCCCTCAC
CGAGTTCCGCCTCCCGGCACATGGGTAAAAAAGCACGAAAAACGGAGAAGAATGATCTCC
AGGCTCTGCGGCCTGCCGGTAAGACCGGCGCCATTCATTCCCGACACAGTCTCAGCTCGC
TCAGGCTCAGAGGCCCAGATGGGCAGGCCCGCTCGCGCCCGCGTAATCCAACCCGCCCGA
CGGACGATACCACACCCGCAAATCCCTCCGAAGACCTAGTAATGGTTCCGTCCCCAGCCT
CTGATTGGTCCAACAGGAGAAGGCGTGGCCTCCGCAGTCTGGTTCCGCGCGCCAGAGCGC
GCTACCCGCATTGCGAGCTGGGCACGGAGCAGGCGCCATGGTGAGGAGTGGTTGTGGGTT
ATTTGCGTTGTGAAGGCCTCAGTGTGCGTCTGGGTTTGCATTCAGGTTTGGGCTCGGAGT
TTGGGCCAGGGCCTGCTCTAGCAGCGGCCCAGCGGACTCGGAAGTTTGACTAATGGCCGC
GCGCCGGTTCCCTTTTCAGGTTCTGCTGCACGTGCTCTTCGAGCATGCGGTCGGCTACGC
GCTGTTAGCGCTGAAGGAAGTAGAGGAGATCAGCTTGCTGTTGCCGCAGGTGAGTGGAAT
CGGTGGGCTCGTGGTGCTGCAATGCAGCCCCTAAGGCCGCCAAACCCCAGCATGCACCGC
GTGTTCCCACGTGGCCGACCGCACCGAACGGGGAGGGGGGCAGAGCTGTAGAACGAGGGG
ACTCTAAGGCTAATCTATATAATAGGAGAGGTTGTAGATCAACATCTCATACTCTCATTT
CTTAAGAATTAGAGTCCGGATGCGGGCCTAGGCACCAATTGCTACAACAGCTGGTGTTCC
TGCTTTACTGCGCGGTAGAGGCCAAATTCAAAGAAAGCCCATTCATCCTCTCCACAGGTG
GAGGAGTGTGTGCTTAACCTTGGCAAATTCCACAATGTCGTTCGTCTGGTGGCCTTTTGC
CCCTTTTCTTCATCCCAGGTTGCCTTGGAAAATGCTAATGCTGTGTCTGAAGGTGAGCTC
CCCCCCCCCCCCAGGGATGCGTGTTTCTGAATGGCTGATGATTTTCTTCTAAGCTTGATA
GATTCTAGGCATTATTTGAGACCTACAAGATGGCAGTTTAAAACAGTTAAATGCTTCACA
ATTGTGCTCCCGGACCTGTGGTTGAGTCAGGCTTTGCAATGATGACTTGAAAAATCTGTC
AATCCCCTGAGTGATCGATGATGACTCCATGTTTCTGAGCAATGCCTGAAGGGATGGGTG
TTCCTGTATGGTCGGAGTGGAGGCACAGTCCTTCCTCTGTTACAGTTGGGACATTCTTCG
TCGCGTTAAGAGCTGTGTTCTTTGTTCCAAGGTGTTGTTCATGAGGACCTCCGCCTGCTC
CTGGAGACATACCTGCCATCTAAAAAGAAGAAAGTACTTCTGGGGGTCGGAGACCCCAAG
ATCGGTGCTGCTATACAGGAAGAGTTGGGGTACAACTGCCAGACTGGTGGTGTGATAGCT
GAGATCCTTCGAGGTAAGAGTCCTGTTCAGTGTGTTGCCTCTACCATGTGGATGAAGTAC
CACAGAGGCCAGGAGAGGGGCTGCTGGTTTCTAGTAAGCAGCTATGAGTGGTTATGTGGG
TTCTAAAAGGTCCTTAACCATAGTCCTGCCTTCTTTTTAGGGGTTCGTCTGCATTTCCAT
AACCTGGTGAAGGGTCTGACAGATCTTTCTGCTTGTAAAGCCCAGCTAGGGCTGGGACAC
AGCTATTCTCGTGCCAAAGTTAAGTTTAATGTGAACCGGGTGGACAACATGATCATTCAG
TCTATAAGCCTTCTGGACCAACTGGATAAAGATATCAATACCTTCTCCATGCGTGTCAGG
TAAGGTGCAGAAGCCACCAAACACTGGTTTTCTTCGGCCTAGTTTAGCTAATGCAAACTT
AAGGTCAAGCAAGGCTGATAATTTGTGGGTAGAATCATGGACCAAAGCCAGGCCTCCTTG
TGCTTACCACAGGCTGTGTTCCTACACTGACTGTATAGAAAGAGGAGGCAGAATAAACTA
CCCTGTGTACACCTCAGCCTAGGCCACCATGCCTGGTCTGTATTGTGAATGGGTAGACAG
TGATTTGAGGGAGCCTGGGACCTGAGATCAGGTTTGACAGCTGGGTCAAGGTGTGATTGT
CCCTCTGCAGGGAGTGGTATGGGTACCACTTTCCAGAGCTGGTGAAGATTATCAACGACA
ATGCTACATACTGTCGCCTGGCTCAGTTCATCGGGAACCGCAGGGAGCTAAATGAAGAAA
AGTTAGAGAAGCTGGAAGAAATTACAATGGATGGAGCCAAGGCTAAGGCCATTCTGGATG
CCTCTCGGTCCTCCATGGGTCAGTGCGGAGCGAGGCAGCCCGTATAAGGTACGAGGCTCC
TTGAGTATCTGGTCCCCCTGTTCACACTAGGTGTTTCCTAGGCATGGACATATCTGCTAT
CGACTTGATAAACATCGAGAGCTTCTCCAGTCGTGTGGTGTCTTTGTCAGAGTATCGCCA
GAGCCTACACAATTACCTTCGCTCCAAGATGAGCCAAGTAGCCCCCAGCCTGTCAGCCTT
AATTGGGGAAGCGGTGCGTCATGGGGAACACAAAAGTGGGGGAGTAAAACATAGCATTCT
GTACCGCTATACTTGTGGCTAGCATGCTGTCCCTAGTTGTTGCATGGTGGGGAGGAGGAG
AGGGGAAAGAGTGGTAGGTCAGGTTTCTGTCCACTCACCTGCCCTCCTTGGGTCTCTCTC
CAGGTAGGTGCACGTCTCATTGCCCATGCTGGCAGCCTCACCAACCTGGCCAAGTACCCA
GCATCCACAGTGCAGATCCTTGGGGCTGAAAAGGCCCTGTTCAGGTACCAGTGAGGGCGC
CTGCCCATGTCAGGTGCTGCTTCTGGTGTCCACTGCTTTGTTTGGGGATTACAGTGATGG
CTGACCAGGACTACCTGACCTATAGAGGCCTCTACTATGGGAGTGATGGCCAGTCCTAGT
GTCTGAGTGATTCCCAGGGCCCAGCAAAAAGGGACCAAGTTTCCAGGTCAGCAAATTGAA
TGCCTTCCCTCTCTGTCTCTGGGAGCTAGGTTGGCGCACGTTGAGGTAGAAAGTTCAGCC
AAGTCTGGTGGGAAATTGTAAGAGGGGAACTTGACCGTTTAGGTCAAGTCTTCTGACTAA
ACTGTTCACTGAATATTCTCACAGAGCCCTGAAGACAAGGGGTAACACACCAAAATACGG
ACTCATTTTTCATTCCACTTTCATTGGCCGAGCAGCTGCAAAGAACAAAGGCCGTATCTC
CCGATACCTAGCAAACAAATGCAGTATTGCCTCAAGAATTGATTGCTTCTCTGGTATGGA
TGGGGAGGTTGGCATTTGAGTGAAGGGGTTACATTGGGGGGGGAAGCAACCTACCTTGGC
AGCTTCTACAATGATGGTAATATTTTTCGTCAACAGAGTTCACCTAGTGAGTGTTGACAC
TTTGGGTCTGAGTGAAGCTGAGGGGAGAGGGACTGGAGAGTCATTTGTCTTGTCAAGAGT
TGTAATTGGCTTTGTTTATACATACACATACATCTAGAGGTCCCCACAAGTGTATTTGGG
GAGAAACTCCGGGAACAAGTTGAAGAGCGGCTTTCTTTCTATGAGACTGGAGAGATTCCA
CGGAAGAACCTGGATGTCATGAAAGAAGCTGTGGTACAGGTCAGTGTGCTTTGTTGTGGT
AGCTGAGTACCCCAAAGATTACTGTTGGAGATGATGAACTGACTCAGCCTGACCTTCAGA
AATGGAGGTGATAAAACTGATTTAATGAGCCTGATCCAGCAAGACAGAAGTGTTATGGCA
AGTTGGAGGTTGTCTGGTTTTTTCAGCACTTTGCTTTTTTGCCAGGCAGAGGAAGCGGCT
GCTGAAATAACCAGAAAGCTGGAAAAACAGGAGAAGAAACGCTTGAAGAAGGAAAAGAAG
CGACTGGCTGCACTGGCCCTGGCCTCTTCAGAAAACAGTAGTACTCCGGAAGAGTGTGAG
GTCAGTCCTCTGCACACATCCGAGGTTGTAGGCTTTCCAAACAGTAGCACACAGGGCATC
AAACCATGGTCTGGAGCTTGGGCTTTTTGGACCAAACACCTAAAACTACCTCTTGATTCT
ATAGGGAGGAGATAGGTGCTGAGAGAACTTGACAAGAGCCCAGAATGCTGGTTGTAGCAC
ATGGCCCATTCCATGGCCGTGTGCTCTGTCCTCGGCTGCCTCCCAGGAGTCCTCAACAGG
GGTAGTGTGAATTCCTGCTCTCCCTGTTCTGTGTCTGGAGGTGATAGTGTCTCATGAAGG
GGGGTGGGGGCAGGGAGGTCACCAATGTGACCATTTAGAATTGTCCCCTAGGGCCTCTTA
AATCTTAGCTACTAGTGACTTTCATTTCAGGGTCCCCTGGGAGCTCTGCATGATGTCCAT
CATGACCAGCATACAGGGGGTTTTCTCTAGGGTTAAGAGGGCCAGGGAAATTCTAAATTT
GAGAGTAGATCACCAAAGTGCCCTTGCATTATTGAGTTACCAGAAGTACTAGGTCTGCTC
TTCTGCCTGAATTCTGATGGGAGCTGTGGCTAACAAATGTAAGCAACATATCCCATGTCT
GATTCCCCCTTCAGGAGGTAAATGAAAAACCTAAGAAGAAAAAGCTAAAACCCCAGGAAA
CCCTACAGGAAAATGGAATGGAAGACCCACCTGTCTCTTTGCCTAAAACCAAGAAAAAGA
AAGCTTTTCCCAAGGAGGAGTTGGCCAGTGATCTTGAAGAGATGGCTACTAGCAGCATAA
GTGTTCCTAAGAAAAAGAAGTCCTTACCTAAAGAGGAAGTGGCCAGTGAACCCGAAGAGG
CAGCGAGCCCCATCACCCCTAAGAAGAAAAGGAAATTTTCTGAGGAGCCTGAGGCTGCTG
CAAGCTGCACAAAGAGCAGCACAAAGAAAAAGAAAAAGTCGCAGAAGGCCCGGGAGGAGG
ATTAGAATGGACCTGCTTGGTGGGAGGGGCATACTTTATGGTGGCAGTTCCTCCTGCCCA
TGATAAACCCCAATAAAAACGCAAAACCAGATAACATGTGTTTGTCTATATTTATTTTTA
TTTTTACATGGGCATATAGGATTTATGATAGGGCAGTAATAACAGCTTCAGTGAAGTCAT
GACATGTGGCATAACCACCCATATCTGAGGTTCGAACCTGTGGGAAAAAGTGATAATCTT
ACAGTCTGGGCCCTGTCTCAACAGCCCATCCTGTGAGGTGGTACCCTTAAAGCCAGCCCC
CAGGACAACCTAGCCTCTGCCAGAAAAGCAGTTATTTATTGTCTACTGTCTAGATGGTCT
CTTCTGGTCCACTGTACTGAAGGGATGTATTCGAAGCATGATCCTTTTGAAGGAGGAAGT
AAAGGGCTCTAGCCCCCATGGGGGTGCAGATGGCCGATGACGGACTTGATGAAGTCAGTT
GTGGTGCTGTAGCCTCCCATGTCTCGAGTCCGGACCTACAGCCACCACCAGCAATAGCCG
TGGGGGAAGAAGAGAGAGCCCATGAAGGAGATGGGGCAGCATGATGAGATGGAGACCAAG
AAAGACAAGATGTGGAAAGAGTGGAAGGGAGTAAGCAGGTGTGGTCAAGGACTGCCCACC
TGAGCAGACAAGGCAGTACCGGAGCACAAGACAGGAGGAGGAGCACATCAGAAGGGATGA
GATGAGGTTACCTTGCAGGAAATGAGACCAAGTGGAAGGGAAACCAGGCTGCTAACCCTG
CCTGCAATCTCCACCCTGGGCAAAGCTGCAAGGTCTGTATTCAGATGGCCCAAGGGCAAA
GGGTGGTGCAGGAAAAGGAACAGCAGATGGAACTAAGGTAAAGGAGACCAAGAGGATGAA
ACAGCCAAGAGGGGAAGTGAAGAACAGCCCTGAGATCTGAGATCACAGCATATTGTGGGG
GCCTGGAGGAGAGAGGTCCCTCAGGTCCCCACAATAGCACAGGATAGCACAGTGCTGAGT
CCTTGAAGCCTTCGGAACTTACCTTGCCAACCTTGATCACCTTCTTCACTGCATCTGCAA
TCATGCTGGAGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 1219..1308, 1617..1731, 2071..2232, 2380..2578, 2890..3077, 3161..3312, 3483..3583, 3924..4072, 4297..4418, 4605..4739, 5354..5793
1057..1059, 1219..1308, 1617..1731, 2071..2232, 2380..2578, 2890..3077, 3161..3312, 3483..3583, 3924..4072, 4297..4418, 4605..4739, 5354..5704
AC_000071.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved