Rattus_norvegicus Locus ENSRNOG00000016220
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus ENSRNOG00000016220
Rattus_norvegicus
ENSRNOG00000016220
3
SNORA65
2533..2662
4375
AAGGTTGCTGGCCCTGCAAGGCCAGCTCAGGGCTCCTCCCTCCCTCACTTGCAGGCACT
CCTGAGGAATGATGCAGAAACTGCTCTTCTCCATCCCTTACAGATGGCCACAACTTACCC
TTCTCCTCACTAATGACCTGCCCTCCCTTACCCTATCCTCCAGGTCTACACTTCTAATAC
CCTCTTTATGACCATCTCCCCCAAGTCCCCATTCCTCATTGTTCTCAACAGGGCTCTATC
AGTTCTGGTTTGAATTTTCCTGATGGTCCAGCTTGGCTGGGAAGAACCTTCCCTGGGAAG
GCTGGCCAGTGGCTGACCTGGTTCTGTGTATGGGGAGGTTCTCCACCGATGTTCCGACTC
TGGGGTGAACCTCAAGGTGGGCCAATCACTCTGAAAGCTTGGCCACAGATACCAACCTTA
GGCCCCAAAAAGCTGAGCTGAAGTCGGGTCTCCTTCAAACATAGGAAGTGAGGACAGAAA
CTCTAAATTCAGAAAGATACGCAACTCAGGATGACAAAGTCTTGAGATTCTAGAAACCAA
GGAATTGCAGAATTAAGAGTCGTGATTAGACCGGAATAGTTTGCTCCCGTAACTAACATA
CACAAGCCGCAAACGGGTTAGAAGGGTACTAGGGTGGCGTTGGTACAGGGGTCCCGCAAG
CCAGGTGCAGCAGATCACTTAGGGGAGGGGCGGGGCCCTGGGTTGGGTACCAGGGACTTC
AGAGTCACCCTCAAGAGAAGGGAACGTGGAGTACATCAGGAACCAGGGCCTCTGCTGCAG
CCCTTCTACTCTGACTGTCCCCAGGTAAGGTGCTCCGAACATTCACCCCTTCCGAATCCC
GAGCTCACCCACTGACCAAGCGCTGCAGTCCTCAGCCGCAGACGCCTGCCCATAAAAAAC
AGGGATGCAAGGGTGTCGCCCAGAGACTGGGTGGAGCCAGGAGTTATCGCGAGAGTTGAG
CTTTTCGGCCTATATCCGGCGTGGGCGGAGCAACATCCGTCTTTTCGGCTTTCGGTTCGG
AGGAGGCAACGGTGCAACTTTCTTCGGTCGTCCCGAATCCGGGTTCATCCGACACCAGCC
ACCTCCACCATGCCGCCCAAGTTCGACCCCAACGAGATCAAAGTCGGTGCGTGCCCTCGC
CCCGCCCGGGCTGCCGGTGGAACCTTTTCTGCCGCGTGCTGTCCCGGGGCCTGGCGGGTC
TCCCTTGGGCCTTGTCCTCCTCGTGTGTGAGCTGGGAGGGAGTCCCGACGATCTGGCAGC
CTGCGTGCCTTAGGGTAAGGCCTGGCCCTGGAGGTCTGCGGCCCGACGGCAGCGCGCAGG
GCGGCCTGCGGCGCACTCCGCAGAGGTTCTGACTTTGCTTTTTCTCAGTGTACTTGAGGT
GCACCGGAGGCGAGGTCGGCGCCACATCCGCCTTGGCCCCTAAGATCGGTCCTCTGGGTC
TGGTAAGTCGTGGCTACTGATGGGAGTCGTAGACATGTAACGTGCAAGCCGTTTGGCCTG
CATGTGTGTTGTGTGCCTGCGGAGGTCAGAAGAGGGCAACATGTGCTTGTTGCGGCCTCT
AGTATGTGGGTGCTGGGACTTGGGACTCGTGCCGCGGCTTTGTTGAGTGGCTCGTTTAAA
TCCCAGCCAGCAGCCTTTAAAGGCACACATTCCATAGATAACACATGGGAAACTAGTATT
TAAAGCTCTGACTCTGAGCGTGCCCCATTGCAGATCTAAGTGATTGGCCCTTAGTGCAGA
GTTGGCTTAGCTGAGACGTGGAGCCATTGCGGGTGGGCTCGTGTGGGACGGTGAGGAGGG
ATAGTCCAGGCTAGCAATGAGCTTGAGGCTCTGGCTTCAATTTTGGGCACATGGTAACTA
ATGCCATTATTTCTACAGTCTCCCAAAAAAGTTGGTGATGACATCGCCAAGGCTACCGGT
GACTGGAAAGGCCTCAGGATTACAGTGAAACTGACCATCCAGAACAGACAGGCCCAGGTA
TTTCCGTTGGCTAGTGCGTGGGAGGGCTGAGGTAGCATCCCTCAGGAATTGTGGACAAAA
AGATACTGCTGTTCTGATGAATCGATTGTATCTGTGGGGAGGCATATAAGACAAATATTC
GTTGTACGTGAGTCTGCCATGCACGACTCTGCTGCTCAGGCCGGACAGAAAGTACTTTAA
TCAGCCGAGTAGTCCTGCTGGCTCCTTTAACATGCCTGGTTGTAGTATTGTTACTGGGTT
TCCTGGGCTGTGTTCATATCAAGTCTCTTTGCAGATTGAGGTGGTGCCCTCTGCCTCTGC
CCTGATCATCAAAGCCCTCAAGGAGCCACCAAGAGACAGGAAGAAGCAGAAAAACAGTAA
GTTGATTCCAGTGTCTTGGTGTCCAGTGTCTGCTACTCGGCTGTGTTGATCCATTTCGTG
GAACCTAGGGTTGGAATGAGATCACATTGGGCCATTTGCTGCATGCCTCCAGAGATGACT
AGTGCCCCAGGGTTGGTTGACATTCCACCCTTGGCCTCAGGGATTTAAGCTTGTCTGTTT
CTATCCCTAGCCACCCGCCACTGCACCTGACCAGTATTATTGGCTGGTGCAATCCAGTGG
TGAGCTGACAGTAAGCCCCAGCTTTTAGGAAACAGGGTTGTCCTACATGTGGGTGACTCT
GTGCCGAAAGCGTGGGGACAGCCTAGACATAAGATGGGACCATGATCTTTGCTCAGAAGA
TAGGCGGAAGCTTTAAAAAGCCCTTGGGTTTTCTCTCTGCAGTTAAACACAATGGAAACA
TAACTTTTGATGAGATTGTCAACATTGCCCGGCAGATGAGACACCGGTCTTTGGCCAGAG
AACTTTCTGGTAAGAGCAAGTTTTGCTGTTGAAGATCCAAGATTTGGATCCAGTATCTTT
TGAACTTGTGGAGCCATGCTCTTCCCTCTGTTCAATGGGACTCTGGGGTTCCCCCTTCCC
CTGGGATCTGAGGCCACCATTCTCACTGTAGGAACTATCAAGGAGATCCTGGGTACTGCA
CAGTCTGTGGGCTGCAATGTGGACGGCCGCCACCCTCATGACATCATAGATGACATCAAC
AGCGGTGCGGTGGAGTGCCCAGCTGTGAGTGACTTTGCTGTTATATTGGAGGAAAGCTGT
TAGGGTGGGGGAAAGCTGGCCTTTTGTTGCCCCTTGTGTCTTATAGGGGCATTGTTAATT
CTGTATTTATATTCCCCATTGTGACTGACAATTTTTCTTCTCTTTCCCACAGAGTTAAGA
AGCAACGAGAAGGGGTTGGGAATTTAGCTCAGTGGTAGAGCGCTTGCCAAGCCCAAGGCC
CTGGGTTCAGTCCCCAGCTCCGGAAAAAAAAAAGCAACAAGAAAATATTTAAATAAAAGA
CTATCTGATAAACCAGTGCGCTTGGATGCTCTTTTTGGGGCAGGGGAGGAGTTCCCTTTG
GCCTATCAGTATAGCTGCTGTGGTAGCAGGATCTAGGAAGCACTAATTCTGGTGCTTTTT
CTGTGGGCGTGGTTAGGGAGGCCCAGGTGCTGAAGGATCTAAGAGTCTGCTCTTAAGAGG
CAGTGAGTGGTACAGGGGCTGGAGAGATGAATGGTTCACCGGGTAAAAGCACTAACTGCT
CTTCTAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCAAAACCATCTACAC
CACAATCTGATGCCCTCTTCTGGTGTGTCTGAAGAGAGTGACAAGGCACTTACTAAAAAA
AAGGAAGTTGCCTGACTAGTAAGTTAAAATTCAGAATATTTAAAAAAACTCAGTGATACA
GTAAAGCTTGCCCTGTGCCTGTCTCAGTTCTGGGGGCATAGTGGGGTCTCAATCAGCTTA
ATCCTCAGCAGTTCCACAGAATAAGAAAGGTCCCTTCTGTGGGTTTCTAAAATTGACTAC
AAGTAGCACAGAGGGCATGTTGAAAAAAGCAGGTCTAACATGAACCAAAGGCATTGACAG
TGACTGCATACAAGGGGAAATGCTAGCTGGGACTAAATCTGTATGTACTTTGAGGAAAAA
AAACCCAGTAAACCCAGTGCAATTGATAGAAGGGGCTGCAGCAGTGCCTGAGTGTTGAGC
CTGGTTCTCTGCACTCACAATTGTGAGATGGGTGACAAGCTCATGGTGCAACGCACCCAT
CTGTCCTGCTCTGGGGGATTGGGTGGAGGTGCCAATGAGGTCTGCTGCCTGTGGAGTCCT
GTTGGGTGGGTCAGTGTTACCAAGGTCCATCAGTGAAGCAGTTGGGTGTTATATCTGTGT
AAGGATTTCTAGAAACCAATTCTCTGGAGATGACTGCAAGACCAGCAACTGGATCAGAGC
AGACAAGCTCCCTTGTGGTACAGGCTATAATTGTGGCCACCTTAGAGACTAAAGTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1125, 1368..1441, 1878..1976, 2254..2335, 2742..2828, 2971..3083, 3232..3375
1089..1125, 1368..1441, 1878..1976, 2254..2335, 2742..2828, 2971..3083, 3232..3237
AC_000071.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved