Rattus_norvegicus Locus RGD1565869_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RGD1565869_predicted
Rattus_norvegicus
RGD1565869_predicted
3
SNORD24, SNORD36, SNORD36, SNORD36
1321..1395, 2293..2374, 2612..2682, 2952..3022
4424
AGTAGAGCAGCGGGTTCTGAACCTGCGGGTTGCCTTCCACAGAGGCTGCCTAAGACTAT
CGGAAAACACTGATATTTATGTTGGGAGTCATAAAAGTAACAAAATTACAGTTAACCTCC
TGTCCCCTTACTTTTAACGCCTCATAGCTCCCACCCGCACCGGTCAGGTGAGTCACATCC
CATCTGCAATCCCCACCCCTGTACTAGAGTCTGGACCCTTGTACCCAGACCCCTAGGAAA
ACCAGTTCCTGCATTCTCCCATGGCTTCGGAAAAGCCACCACGCACCTTGGCCGTTTTGA
TGATCTCGGTGAAGTTGTCCATGATGGACTTGATGTCGTCTTTGAGCCGCTTGTTATATG
ACTGCAGTAGCGTCTCTTTGCTCTGGGGCAGGGCTCTCTGCTGGGCCATGGCGGGCCCGG
GGTGAGAGACACAGTCCGGTCCGACGTGAACCGAGTACGCAGGGCTGGGGACTAAGGTTT
CCGCTACAACAGGTCCGTCCACGAACACACGCCCGGCAGCAGGCCCTTCCCGCGAAGAAA
CAAAGGGCCCACTCCTTCACGAGGCTCTCGTTCCCCTCTCGCGCCTCCGTCGCGTCTCGG
AGTCTGCGGCTACACGCCCGGCCCCGCTGACCAGGACAAACGCGCGGCGGCGGCGGCGGC
GGCGGCTCGGCACGCCCACTCTCAGGCTCCGCCCCCTCCGGCAGAGTCTTTAGCCGGTCC
TTGTCACTTTAAATCCGAAATCCCGCGCAGGCGCCTGCTCTCGCGATCTCCGCGGCCGCT
TACTTATCACCCACAATTCCCTCTTCTTTCTCTCTCCTCCAGCCGAGCAAGATGGTGAGT
GATTATGGGTCTGCGCTCTATCCGCCTCCATCCGCCACTCGCCGCCGCTTCGGGGCCCCT
CGCGGGAAGGGAGCGGCATCGAGCGGCGCACAGGCGGTGACACCGCTGCCCGATGGGGTG
GCAGAGGACACAGCCTCACCGGCTTTCTCTCTTCTGCCCAGCCCAAAGGAAAGAAGGCCA
AGGGGAAGAAGGTGGCCCCGGCCCCCGCCGTGGTCAAGAAACAAGAGGCCAAAAAGGTGG
TCAATCCTTTGTTTGAGAAAAGGCCTAAGAACTTCGGCATTGGTAAGAAGTGGCGCCGGT
TTCAGGGGTCGTTGAGTCAAGCCTTTAGGGGAGCTGGTCGTGAAAACCCGGCTCCTAACC
AGACACAGGCGGTGTGCCTTCGAGGGCCACCCTGGCCTTCAGACAGCCACTGCGGACGCT
TCGGCTGTTGTGTCTGCTGGCAGCCGGCGACTCTTTGCCACAAGGGGAGATGGTGCTCGT
GTGCAGATGATGTGAAAGAATATTTGCTATCAGAAAGATGGTGATGACATCTTGAACCAC
CAAGATCGCTGATGCACCGACACCTCCTGGGGGCCTCAGTGGCAGGCCGGCACGGTGGAG
ATGCCTCGGTTGCAGTGTCCCTCTTTCCTTCTCAGGGCAGGACATCCAGCCCAAAAGAGA
TCTCACGCGCTTCGTCAAATGGCCCCGCTACATCAGGCTGCAGCGGCAAAGAGCCATCCT
CTATAAGCGGCTCAAAGTACCTCCTGCCATCAACCAGTTCACCCAGGCCCTGGACAGGCA
AACAGGTGAGGTTCTGTGACACAGCCAGTTGGAAGTTTCCGGAGCTTGGAACTGGTCCTG
AGTTTGCCCTTAATGCAGTATATGACCACATTAAAACAGCTATGTGTAAAGATAAGTGGC
GGGTGGGGGGGGTGGAAGGGGGTCCCCATCCCTCCACCGGAAACAGGTGAGGTGGGGAAG
CAAATGAGAGTGCTGACCCCCGCGTTCTCGTCGGTGTACATACCACAATAGGGTAGTTTT
GTGAGGGCTTTGTTGTGGAATCGGTATCTAGATGTAGAGCTCAATATGTAGACCAGGTAG
GCTTTGAGATCGCTGCCTCTGTCGTCCACGTGCTAGGATTAAAGCTGTGCCACAGCTGTA
CCAGGGATCGGGACCATTCATATAACAAGGGAGAATTGAGACTTTGCCAGGTAGCCAGCC
CCACACTCAGGAAGCAGCTAACCTGTGCTAAAAGAGGTAAAGCTTGGGGTCTAATTAAAT
GTTTTCCCAGCGACTCAGCTGCTTAAGCTTGCCCACAAGTACAGGCCAGAGACAAAGCAG
GAGAAGAAGCAGAGGCTGCTGGCCCGCGCTGAGAAGAAAGCTGCTGGCAAAGGGGACGTC
CCAACTAAGAGACCACCTGTCCTCCGAGCAGGTCAGTGCAACCACACACCCAGGGAGGGT
GGTAGGGCAGGCTGTGCAATGATGTGTGAATTTCTTCACCTGAAATCACCGTGAAGAGTA
ATTTAAGTAATCGAGCTTTTTAACCCTGAGTCACAGCTTGGTGGGGCTGTAGCTTTTGTG
ACTGTAGCAGCCCAAATACTCAGAAAAAGTGGTTGTGTGTTCTAGGGGTCAATACAGTCA
CCACTTTGGTGGAGAACAAGAAGGCTCAGCTGGTGGTGATTGCCCATGATGTAGACCCCA
TTGAGGTAGGTGTGGGGGACTTTAAGCATCTGTTGCAGAACCAGGGTCCTGTGTTGCTTC
TGGAAGGGTGGGAGGTCAGATTTGTGTGGCTTTTGCAATGATGTGAATCTTTTGCTGAAG
TGACCTTGAAGTGTAATTCCTGAGCTTTTTAACCCTGAGCAATTGCCACAAAGTAGTGTA
GCTAGGGTATTGCTTCTGCCAAAACAGCCTACAGCTCATGCTTGCTTCTAGCTGGTGGTT
TTCCTGCCTGCCCTGTGTCGAAAGATGGGGGTGCCCTACTGCATCATCAAGGGAAAGGCC
AGGCTGGGGCGCCTGGTCCACAGGAAGACATGCACCACTGTTGCCTTCACACAGGTGAAC
TCGTGAGTATTTGGGCTTGTCTCTCCATTTCCCTTGTGCACCCATACCTTACCCTCCCAG
CTCTGGGACCGTTTGCCAATGATGGTTAAGAATTTCTTCACCTGAATCAACTATGTGGTC
ATACTCTTCTTGTCTGAGGCAAAAAAAAAAAAAAAGTGGGGAGGGGGCATTCCTGCTTTC
CAAACAGTAACAAGTTTTTCTCATTACCTTCCCAGGGAAGACAAGGGTGCTCTGGCTAAG
CTGGTGGAAGCTATTAGGACCAATTATAATGACAGATATGACGAGGTGAGCAGCTCTATA
CTCTGTACGGGCTGTGGGTTTGATTGGTGCCTTAACTATGTAATTTGGGCACCCACTTGG
AACCACTGTATATACAATACTGGTTGATCTGTGTATTAGAGGGTAAGGGATCAGACTAGT
AACTATTGCTTCTGTTTCAGATCCGCCGCCACTGGGGAGGCAACGTCCTGGGTCCTAAGT
CTGTGGCTCGCATTGCCAAGCTGGAAAAGGCAAAGGCTAAAGAACTCGCCACTAAGCTGG
GTTAAATGTACACTTAAGTTTTCTGTACATAAATATAATTACAAAGTTATCTTCCTTCTT
TGGTTCTTTGGGTTGCTGCAAGTGTGTGTGTGCTCAGATTGGCGCCGTTCCCTAGAAAAT
GTTGAGACCAAGCCAGGGTTTTTATAAATCAAAATATTTTATAGTGGTTAGGAACAGGTT
CATTATTTTCACACACCTGGTGTCCGACGCACAAATTTTCGGAACCACAAGTATGATGTA
GCTGCACAAAGTCCATACCTGTGGTTGAGAGAGATTAATTTAGTCAGCCTATTCAGTATG
TTTGTGGAGGGGGTAACCAAGGCTGCAGGACTGACCAGGTAATGATGTACTGCATGTGCT
CATTCCGAAGGGTTACTCTGGTTTGACCTCCAATGGGCCCTCCGGGTGTTGTGCTATCTG
TAGAGACAATACAGTCAGTCCTGTCAAGCCCGCCCACCCAAATGAGGTCCTCTTCAGGGC
CTGTCAGGCTATCCCCTGCTTCCCACCCCCCCAATCTATACCAGATGTCAGAATGAAAGG
AGAGGTAGAAAGTTCACAACATACTGAAGTCTGCATCAATGAAGATGGGGTCCGTTCCTG
TTCTCTTGGCCATAGCGTCCAGGTCCCGGTAATACCAGAGACTCCTCTCTGGGTTGTTCT
CAGGAACAAAGGGCTTCCTGTTTTCTGTCAGCCTCACTATGCCTACTAGGTCTACTTCTC
CCAGAACCTACAAAAGGCAGAATTGCTTTTTACAGAGTCCTGTGAAGACAAGGTGACCTA
TATACATCTCCACAGCTGAAGCGCCATAGGCCTTACCTGGCCTTGCTGCCTGGTCTCCGG
ATTCACTTTCTTCCTGGGAACAAACCCTCTATTGACCAGGATGGTGACTCTGGAGCAATG
ATAAAAGTGTCCCTTTGGGTGAGGAAGAGTTCCAATACAGATGGTCACTAATGTTCACTG
AGTATCTATCTACTGGGCAAACAAATGGTTTTCTTATTCTATGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 1475..1624, 2110..2250, 2445..2524, 2751..2881, 3095..3164, 3320..3424
1001..1121, 1475..1624, 2110..2250, 2445..2524, 2751..2881, 3095..3164, 3320..3421
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved