Rattus_norvegicus Locus Tmf1
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tmf1
Rattus_norvegicus
Tmf1
4
SNORA36
15885..16015
24521
TAGCTTCAGCATTTCTTAAGTAGCTGTGGTTCTTTGTGTAGGATTGGATTCTCTTTTCA
CAAGGGATGGATATAACTCTGGATGTTTGAATTAAATTTAAATGCTGGTAGAATTTTTTT
TTCTTTAGCATTATTAGAACCAAACCAAACAGCTGTTGACTGGACAAGACAGGCCATCGA
CTTAAATTCCCTCCCATGACCATGTGTGGAAAAGAGCATACAAGCTATATCTTTTAAGCA
GTGTATACATACAGTATGTACTGATGGGTTAATATGACAATGAAACTGCTGTTACAAATT
GCCATAAAGTGCTGGCTCATAGGCTACAGAAACACTTAATTTTTACAGTTCTTGTGACTG
GGAGGTACAAGATGAATACAGCTGCTGAGGGCGCACCTATTTCTGGCTCAAGGCTGGCAT
GGCCTTGGTATGATGCTGAGAAGGGTGGAGGCACTCAGACCTCTGATTAGGGCATTTATC
TCTTTCCCAAGGGTGTTGCCATCTCGTGACCCAGGAAGTTCCTAAAAGCTCCACCTCTTA
ACATAGGAATGTGCTGATGAACACCATTCAGATGACAAAACTCTGTGTGAGGAAGGATTT
TTATCTGTAAATGTTCCAGAACCTGGGACGGTGCCCCTAAAAAGTCAGGCAAAGACATGA
AGGCCAGGCGGAGACTGGTCAACTCTTTTTCGAGTGCCAAGAGAAATTACTGTGAGGCCT
AGCCGTCGTGTTTACAGCGAGGCAGGCACTGCTTCTTTTGTTCCCGGAGGTCTGGGCCTG
GGCGCAGACAGGGTCCGTTGGCGGCTGGAGGTGGCCATGAAACCTAGAGTCTGCGGGTAA
CTAAGGGCTACCCTCGGCTCCCGGATGTGGCTTCACGCCACCGTCCGCGTCCTTCCGTGT
GGGCGGGACTCAGCTCCCGGATCTGGTGGTTGTGTACGTGGAAGGGCGCGCGCATGCGCG
GCGGAGCCCGGCTCAGCTGTGCCGGAGGCTCCGAACGCCGGGCGGCCGCGGGAGGCGGTG
GGCCGGGGCCACCGCTGAGGCCGCCGGTGCCGGCCGGACCCGGCGCTGAGGAGGGGCCAT
GAGCTGGTTCAATGCCTCGCAGTTGTCCAGCTTCGCCAAGCAGGCCCTGTCCCAGGCCCA
GAAGTCCATCGACAGGGTCCTGGACATCCAGGAGGAAGAGCCGAGCGCCTGGGCCGAGGC
CATCCCGTACGGTGAGCCAGGTAAGCGGGTCCCGGGGTGTCGCTCCTGCCTACCGTCAGA
CCCCTGTTCCGCATGCTGCGGTCCCAGTGCGGGTCCTGCTGACCTCTGGTGTCACCTCGA
GCTCTGGTCCTGGCCCCAGGCCCTTCCTACAGAGTCAGGCCGGAGCACACCCTCAGATCC
CTAATTGCTACGCATCTTCCGCCTTTGCGTCCTAGGTCCCAACTGTGTAAATCCCAAGTC
AGGGAGCCCTGCGAGTAGCGATTAATGGGCACAACGACTTTACAAAAAGCTTCCTTGTCA
AAACAACCGAGTCGGATGGTAGTGCCCGTGTTCTACAGAAGAGCTAACCGAAACTCATTG
CTTAAGTTAACTTTCTCCAGGTGAGGCCCGGACTGTACTGGGCATAGTAGCAAGAGAGTG
CTCTGAGAGTTCCCAACTGTAGCTCTTTTTTTTTTTTTTTTTTTGGTCTTTCCAGTATCA
GGTCTTTCGGATTGGCTGAAATTACTCTTTCCATGGTTTCGGTTACTTGTGTCTTTAAGT
CTGAGGGATTCTTGAGCATTTTTACGCGTGTAGCAACGGACACAGTGCAGACCTTTGGAT
GAAAAGAGTAGTTGACCACTCTGGTTTCTGGTTTTAGTTGTACATTGTTGAAAACTCGAG
ACCGAAGCCGAATCGTTGATATCTTAGTTTATGTCTGATTGTACGTATGTCGGGATCTCA
TTTCACATGTTACCTTGCTATTGAGTAGCTCACGTTTCTGTGGTTGGACCCCAGAGTTGG
AGTTACTAAACGTGGGTTTAGTTTCAGATATAAAGATACTCGTTATTCCCTGCCCCGCGC
GAAATCTGAGACATGAATAGTGCTATATAATTTATTTTTAAGGGCAGGTTGTCTGGAATG
GAATATGCTTTCTAAATGCTATTTTCATTGATCACCTGTTGTGTTTTAGATTACAAAACG
ACGTGGGTCTGAAGAATGGGGATAGTTTAAGTGGATGTGAGGTAACTATAATTTCCTACC
ACATTTTTCAAGATGCAAACTTAAACCCTGGTATCCATGAGGATGCTAATTAACTACCTC
AAAGACCTAATCTTGTTTTAAGCTTCATTTTCTGGTTTTTACACACTGAACAAATAAATG
TAAAACTCTGTCCCCAGTTCAGTTTCCCCAACACTCCTCATTCCTGGTAGCTTTGGGCTC
TTTAATATTAAAGGGTAAATTTTATTAAAGGGCTTCTTGTTTGTTTGTTTTTTCTTCAGG
AAGTCCCTAGTTATTGTGTGCCCTCTTTACCACCTTCTAATTGCACAGAGTTTTGATGAT
TTTTGCTATCTTAAAAAATGTGGAAAAAATATTTTGGAAAAAATAGTTTTAAGAGAGAGG
AACTTGCAGACTGGCCATTAAGGACACAAAAGTGAATTTATTCACTGGAACTCACTGTTC
ACATCAGTTTAATTATGATTTTCGAAAAAGACTTGTCTCTACTCTCTCAGGTTGAGTTTT
GAGCACTGTTGTCTGCTTAGCTTATAATTAAGTTTTATCATCTAATGTTACAAGAATAAA
ATGATTGTGTGCTGGATGGTGCTGTGAATATATGTGCCTGTTAGTGAAGATTTGGACTGT
TGTCGTGAGATGAGTCTTGAATGTGGGATTTCTCACCAGCTATACAATCTTTATCACTAC
TTTAAGCATGTATTCAGAGGGGTTAACATACTTGATTTGGCTAGGCAAAGCCAAGCCTGG
TATTGTATTTGTTTGTTAGACCCTCTTAGGTCAGCCCATACTGGTTTTATTCTTTTATAC
CCAAAGTTAACGTGGAAACTAATTAGTGATGCTGTAAGGAAAGAGTCTAACTTTTCCAAG
TTACAGGGTACATTTCATAAGCTCTCTTTTCTCCCAGTTGATACCTCTGATAATGATTGT
TATCTTAATGTTAATATGCTTTACTTAATGAACTAATTTATTTTTGTCAAAGGAATAAGT
CCCTCTGTGAGTGGAGGATGGGATACTTCAACCTGGGGATTGAACTCAAGCTCTGAACCT
CAGAGTTCACCAACAGCCTCTCAAGCAATTACAAAGCCAGTTCGGAGGACTGTAGTAGAT
GAATCTGAAAATTTCTTCAGTGCCTTTCTCTCTCCATCGGATGTGCAGACCATTCAGAAG
AGTCCAGTGGTCTCAAAGCCTCCTGCTAAATCACAGCGACCAGAAGAAGAAGTGAAAAGC
AGTTTACAAGAACCATCGTCTCCTGGCCAGTCCAGAACCTCTGAGACAGCGGAGTCTGAA
GCGACAGACTCTGCCTGTGTTTCGGGAGAGACTCCAGCCGTGGGCACTCCCTCACCTGTC
CCTGAAGGCAAGCGTGAAGAAACTGCTAGTGAAGAGTCTGAGGGGAAGGTGCCCACCGTG
AGAGCGAAGGCGTCTGAAAGCGTAGTTAAGGTAAACACAGCAGAAGATGTATCTCCCACA
TCCACTCAGTCTCTTACGACCGAAACGAAGGATATGGCTTTGGAGCCTAAAGAACAAAAA
CACGAAGACAGACAAAGCAACACACCTTCTCCTCCTGTTAGCTCCTTCTCGTCAGGCACT
TCCACCACCAGTGACATTGAAGTTTTAGATCATGAAAGTGTAATAAGTGAGAGCTCAGCT
AGTTCAAGGCAAGAGACTTCAGATGCAAAGTCAAGTCTTCACCTCATGCAGACCTCATTT
CAGCTTCTCTCTGCATCTGCTTGTCCTGAGTATGGCCGCTTAGATGACTTCCAAAAGCTC
AGTGAGAGTTGCTGCTCTTCGGATGCTTTTGAGAGAATAGACTCGTTTAGCGTGCAGTCT
CTGGATAGCCGGAGTGTGAGTGAAATCAACTCGGACGACGAACTGCCGGGTAGAGGCTAT
GCTTTAGTACCTATAGTCGTGAGTCCTTCAGCCCCGAAGACAAAAGTAGTAGAATCTACT
GAGGAAAACGTTGAAGAAGAGGAAGGAAACGAGACATTAATTGCACCTTCTGAGGAAGCA
GAATTAGAGGAAAGTGGCCGAAGTGCTACTCCAGTTAACTGTGACCAGCCAGATACATTG
GCTTCTCCTACACCAGTAAATGTTGGGCCCTCTGCCTCTGGACCGGCCGCTGAGGATGGT
GAAGCTGCTGAAAACCACCCAAAAGCACCACAGCTGGAGCAAGAAGATGTTGGCAAGGTA
ACTACAGAGTAGAAGGGGGCTTTGGGATGTGTTTCAGAGTTGCAGGTATTTTCATGAATG
TGTGAGCTTAGATATTTGATCATTTAAATTATAGCAGTTAAGGACTTTAAAATGAATGAT
TATGTTAAATTATTTGAAATGCTTGCAAAGCAACCATGGTAGACTAAGTAGATATTATAC
AAAATGTTTCCATTTCTGTCTTTATTGCTGCTTCCTAATCACTTAACATTCTTTCATGCT
CTGTTCATCCTTCTGTCTGTTTGCAAAGGACTATTTATGTCACAAAGTGTTCTTCTGAAG
ATAGACATGTAATATCCATCAATCTGAATGGTACTACTTTATATCAAAGTGCTTTGCATG
TATATTCTATTTTTGGGAAATTTTAGATTTTATCTTTTTGGTTTTATATGAATACTGTTG
ATGCTTTCCTGTGATTAATATTCTTTTTTTAATATAAAAGCTTTATATCTTTTTTTTAAA
GATTTATTTTTATGTATATGAGTACACTATAGCTTGTCTTCAGACACACCAGAAGAGGGC
ATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGG
ACCTCTGGAAGAGCAGTCAGTGTTTTTAACTGCTGAGCCATCTCTCTAGCCCATGATTAA
TATTCTAATGTTGATGTTTTATGATATAGCAAGTATGCTTCTTACAATGTTTTGGCTTGG
TTTTTCCTTACGTTACTTTTACAATCTGTTTTTAATAGGTATCTTACATGAATAAAAAAT
GAAATGCCCAAGGAGCAAAAGTAAAACCTGGGATGACCAGTGAATTCTTCCTAATACATA
CAAGAGAAAATGGTGTCTGTTCTTTAATGTTAAACCACAGCTTTGGTTTTTCCAGAGTTT
ATGAACAGGAGCTAACATCTTTAATAGGCTTCTGAAGTGTTTATAGAACGTGGAGAATGC
ACTGCGAATGCTCAGTGTTGCCTTAGCTAACATTTTTGAGTGCAGCAGGTTCTGTTCCTT
AGGTTTAATATTGTTCAGGGACAAAACGCTATGCTATATTTTTGAACAAGCAGCAGCAAT
CATAGAGTATATGCTGGTATCTTGAATCCCCCAAAGGCAACACTAGATACTGTTCATGTT
TTTAGTGTCTGTAGGAAGGTAAGTGATTTTTAGTCTGTCCTGACTCAGACAAGACACTTT
TGAAGCTGGAAAGGCACCTTCTCTCCTTTTACAGATGAGTTCATCACTGCTTTAGCAAGA
CCTAAGACAGGAGATATTCAGAATTACTTCTGTTAGCTTTGTACTGACACATCCTAGAAA
TGCTTAAGGGTTTTTTTAATTTTTATTTTTAAGTATAGAGGATAATAGTAAAAAACAATT
GCATTTGGTTACAGAGTAGTAAGAATATAATGGGATATCCAGCTACAACTAAATTCAGAT
GTGAAACATAACCAATAGTTTAGAGCCTTAACTTGACTTTTTTTTTTTTTAACTTTATAT
CTCTTCCTCTTTAGTGGCTATACAGATAGATTATCCTAGATTTTTTTCTGTTAGAAACAA
ACTGCTTTAAATGTTCATATGCATATCGCCTAGTATATAAACATATGCTTCCTGTAAGGT
ATGCCTAGAAGTGGAATTTTCAGGTCGCTGATCAAGTATATGCTGCCTGGTTGTCCTCCC
AGACTCGTTCATCGCTGTGTGTCCTACCAGTTCCATGCTTGCTCTCGTTTGTGAGCTCCT
AACTGTCGACTAGATTGCGTCTGTCTCCTGTGTCTTCAGCGTTGCCTTAGGAGTTGGGAA
CAGCTTCCTCTTACAGCTTTTTACCTGCATCACAAACATTGACTCGTGTTTGTTCTCTTG
TTCCAGACAGTTGAATTTCTGAATGAGAAGCTAGAAAAGAGGGAGACTCAATTATTGTCA
CTTAGTAAGGAAAAGGCACTTCTAGAGGAAGCTTATGATAACCTGAAGGAGTAAGTATCC
GTGCACACGAGTGGTACCACAAAGCATGTGCAGGCACAAAGCATGTGCCAGGCACAAAGC
ATGTGCCAGGCACAAAGCATGTGCCAGGCACAAAGCATGTGCAGGCCGCTGTTCTTGGGT
GCTTTAAAATTGAACTGTTTCACAGTTTGGACCTGGAGAGGTGGCTTAGTGCTTCAGAAC
ACTTGCTGCTATTGCCGAGGACCTGGGTTTGGTTCCCAGCACCCACATAACTCCAGGGGT
ACCAGGCTTGTATGTATGCGTGTGTGTATGTATGTAATATATGTATGTATGTAAAAACGC
AAATAAATCTTTATAAGATATTTTACAGTTGAACTTGTTTATAGTCACTGAAAATTATAT
GGTGTTTCAATTATGAACATTTAAAGTTTATTTTCCTTCTCAAATTATTTTACCATATTA
CCTTTAACATTTCCATGTTTTATAAAAATACATTCATATGTGTATATTACACACACACAC
ACACACACCTTCTTATCTTTTAGTATTAGAGATTTTAAATGTGTTTAATGAAAATTGAAA
CTATATAGTTAATACTGAATTGGCTTACTTTGAGACCATTGAGGAAGTGTGACACGAAAG
ATTTAGAATTTGTCTTAGATTTGCACATCTAATATTGGTGACATTTTCGCCAGTGGGTTT
TATTTGAGGTTTCATAAAATTGGTTTGGTAGGGCTGAGGATTCGGGTTTGTGATCGGTCA
GGTTTTTCCTAGCATGCATGGCCCTGGCTTCAGTCCTGAGCAACACTAATATATGAAGTT
AATTTTGCAAGTAGTTTTTCTTTGATGCAGTAACTGTCTGGCCAGGCATGATGGCATACA
TGCCACGTATAATCCCAACTGAGAAAGAGAGGCAGGAGGATGAAGTTAGAGAGGACATTT
GTGCTGTATTGTAGGACCTTGTCTTAAAAACAGAGCAGAATTAAAGGGACTAGACCTCAC
CCAGTTCTGTTTTAATATGGTATATGTTGAAAAAAATGCTGTCTCATGACCTCTAGACTG
TTAAACGGTATCTTCATTCTTATATATTTTAAACCTAGTGAAATGTTCAGAGTAAAAGAA
GAAAGTAGTAGCATTTCTTCCCTGAAAGATGAGTTTACCCAGAGGATCGCAGAAGCAGAA
AGGAAAGCTCAACTCGCCTGCAAAGAGAGAGACACTGCGAAGAAGGTAACTGAACTGAAC
ACTGTCAAGTGCCATGAATGAAGCTATAGTTTGGTATTAGAAACATGTAGCATATTAACA
GATAAATTGTAGATTTTTGGTATATTAAAGTTGGTAGATTTTGATATTTTAGAGAAATCT
AGAGACTGGAGAGTTGGCTCAGCAGGCTTTGAAACACCCATCAGCCAAGCATGAGGACTA
GAGTTTGGATCTCCAGAACCCATGTTAAAGCCAGACATAATGGCAGGTGTCAGTAACCCC
AGTGCTAGGGGAGGAGCTCAGAAATAGGTAGATGCTTTAAAAGCTCTTTAGCCTGCCAGC
CAGCCTTGCCAAATCAATGAACTCCATGTTCAGACCGTGTCTCAGAAAATTAATGTGGAG
CGGTAATCAGAGACGTTCCTGAAGGCTGCTGCATCCTCCACCGTTGTGCACATGCATACA
TACATTTTCTCCGAAACAGGTTTTTATGTAACTTATATATGAATCTTTGCAAAGACCATT
AAGGTAACCAAAAATGGTAATTCCATCAGATTAAGCAACACTTAAGCCTAAGTGCCGACA
TTCCTCACCTTTGATCCCGTGGCATTTAGAAGGCTAATTCTGTTATGGGCTCTGCTACTC
TGCTGTTAGATGCTTTGCTTAGCAGTGCCCTCAGCCTCTCCTGGTCACTGTAGTACGGCC
ATCCCTGCTTAGTTGCACGGATTGCCATATGCTCTTTGGGAGCAAAGCCATGCCTCTTAA
GGAACTAATTGGGAGCACTCACATACTTAAGCTGTTAAAAACTGTGGTTGTTAATTATCA
TGTGAGTCCTAGTTACTAATAACTTGCTGCTTGCATTTAACTTTTTGAGGTTAGGATGAT
TTACTCTCTTACATTTTAACTTCTCTGTGTGGGCATGAGTGCGTGCATGCACGTGTGTAT
GTGCATGTGCACTCACTTGGCACACCATAGCCCACATACGAAGGTTAGGGGAATTTACAG
TAGGTGATTCTCTCTCTCTACCATGTGGATGGATCCTGTACATCAAATACAGCTCATCAG
CTTGGTGGCAAGTGATTTTAACTGCCAGTCCACTTCACAGGACCCCTTTCCTCCTTTTTG
GGTAATGGTAATTTGGTTGCTGTTGTATTGGTACTTTAAAGTGTGCAACCATAATAGCTA
TATGCTTGGTTAATGGTAGTTTACTGTTTTTCTATATGAACTCTAACATGAAGTCTCGTG
CTTGGTTGCTTTAATTAGCTAGCTCATTTTAGACACTGACAATGACTTGAGATGTTAACC
AACAAACCTCTTCCTGTTCTGTATTGCTGTGTTATTCCCAATGCAAAGCCTAACCTATAG
ATTACATTTGTAGAGACACAGAAAGACAACGGTATAGGGAGTTGTTTTCACTCCTACTTC
CATAGTAAAACTTGCTTATAGAGATGATGAGTGTAGACTTCATGTGGTATTCACAGCTGC
TTTCTGGTGTTAACTACGTATGTGAGTTGACTAAACTGACAGATTTTACTATTGGAATGA
GATTATGGGTGGGTGGCTTCTTCAAATGGGGAGGCTGGAAAAGTATACATAGAATGAAAA
TGATTATGATAACCCCAGCTTTTTTAAATTAGGAAATGAAAACCATGAAGGAAGAACTTG
CCTCTAGATTAAATAGTAGTCAGACTGCAGACCTTCTGAAGGAAAAGGATGAACAGATTC
AAGGCTTAATGGAAGAAGGTGGGTATTTTGTTGATTATTAAAAATAGTCTAAGAAAAGGA
AAAATACTTACTATATAATAGGTAGAACATGTTTCCTAATAGCAAATTTGAGCTGGGTGT
GGTGGTACACACGTGTAGTCCTGCAACACTGAGTACAGCCAAGGATCTGCTGAGCGCAGG
GGGCGAAGATAAACGTAACACAACAGCCCCCACCAAAACAGTGAATAAGTAAGAGAGAGA
AGAGGAGGGGCAGGACGGAGCAGGAGGAGCAGGAGGAGCAGGAAGGAATGGAGGAGAGGG
AAACAAAAGCCAGGAAGGGACACCGCGGAAGTGTCTGTGACAGTTTATGGAAGACTGGGA
TGAGATGTCTTGAAAGAAAAATACGCTGTGTAGCTTTTTGCTCTAGGAAGAGTTTTTTTT
CTTTTCTTTTTTTCTGAGCTGGGGACTGAACCCAGGGCCTTGCGTTTGCTAGGCAAGCGC
TCTACCACTGAGCTAAATCCCCAACCCCACCCCCCCACCCCCTTTTTTTTTAAGTTTCTA
AAAACTGGGCAGAAATTTGTGCTGCCCTTTACAAGTTTGTGACTGTCATAAAAGAGTCCA
TCACTGAACAAAGACGTTGGAAAGCTGTGATTGTGGGTCTGTAAGGGCTTCGAGTTCCTG
GTCTGAGTACGATGAGGTTTTAACATTTGATGACTTTTACTATTTTTGTATTTTGTTTTT
TTAATTATTTGGATTTTTTTTTTTTACTCTTGGAGGTCAGTTTTTCTTCAGTGTATCTTT
GCATCTTCAAGCATAGTTAAGATTGTATATTTCATGTGCAGCCTTCTCATGTCACTATAG
AATTAAATATTTTGTATACTATTACTGATGGCTGTATAAAGCTCACTGTATGGCGAGATT
GCAGTTATTTTAAAGATTGTTAATGTTAGATCTTTTTAAAATGTTCATATTACAAATGTG
GAGCGGACATTTCCTAAGTTATTGAACGTAAATGTGTTTTGGAGCAGGTATAGAATTTGA
GGACAATTAGAAGCAGTCACTTAATTTGAAATTAACTTTTTCCCACCTTTGATTTTTTTA
CTTACTAAGAATTCCTTTAATCAGTAAATATGTTTGATATTATTTGGTACAATACTCGAT
ATGAGATACTTCCCTGTCTTTTAGAAACCCCCCCTTTTTTTTTTAGTAGGAACTATAGGT
ACATAGGCAATTCTGAAATATAGCTATAAGCTGGATATGGTGGTACACACCTATAATCCC
AGTGTTTGGGAGGCTGTGGTACTAGGAGGATCCTGAGTTTGAGGCTAAACATCAAATAAA
GACTGTTAGTATCTTGTTACCTAGAATCCCGTCACATGGTAATTTTAATATTTATTGATA
ATTCCTGTTCAAATGAGTTTTAACATTGAAGGGATGCAGGTTCTTAGACACTCACTGGTT
TTGTTGTTGTCATTGTTGTATTTTTACAATCACCAGGAGAAAAACTTTCGAAGCAGCAGC
TGCATAATTCCAACATGATTAAGAAATTAAGAGCTAAGGATAAAGACAATGAAAGTGTTA
TTGCAAAGCTGAAGAAAAAAGCTAAGGAGCTGGAAGAGGAGCTACAGCATTTAAGACAGG
TGACCAGCAGTCACTGTGCTCTGAAAATGCATTGATCTCACTTCCTGTAGTTGGCCATGG
TGTGTGCAGCAGTCAGAATGATAATGGGATGTCAGGCAAGAAAAGGGTTTCAGTTTAATA
GACAAATGAGTAGCTAATGTTCTCTTACGTCACTGTGATAAATACTTGACATGAACAACT
TGAAGATGATGTTTTCTTTAACCCAAGATTCCAAAGATGAGATTCCATCAGTGTGGGGAA
GGTATAACAGAGGCTTGGTAGGTGGTGGTGCCAGTGTGTGGCAAGTGTTTATTACTTGGT
GCCAACCAGAATGTAGAGAAGCAGAGCTGGGCTTACCCTGAAGGTCTGTTCTCCCATTTC
TTCCAGCCAAGGTTCTAACAGCTTTCCAAAACTTACCTTGAGTAGAGCTGTGTTGAGACA
CGTGTGCCAGTGGGCCACATTTTCTATTCACGCTATAACCAGAGTGAAGAGATTCATGGA
ATACATCATCTACCATGATATCACTTATTGAAAAGTGTTCTTATTTGCTTTGATAACATA
GGTCCTTGATGGCAAAGAAGAGGTTGAGAAACAACATAGAGAAAACATTAAAAAACTAAA
TTCTGTAGTAGAACGCCAGGAAAAAGATCTTGGCCGACTTCAGGTAGACATGAATGAACT
TGAAGAAAAGAGCCGAAGTACTCAGGCTGCCCTAGACAGTGCCTACAGGTACGAAATAAG
CAGCGTGTCTAGAGTCTGTTATCATGGTGGGAGGTCGAAGAAGTCTCTTTTCTATTTTGT
TTTAAGTTTTTATGTGCGTTGGTATTTTTTCTACATGCATGTCTGTGTACCACATTCCTA
ACGAGATTGCTACTCTTAAATACTGAGTGCTCTCTCCAACTTGTCTTTTTTCTGTTATCT
GGGTACTAGCAACATTTATAGATTTTCCTATGAGTGCGTTTGTTATTAGACAAAGCAAGT
CCAATTTTAAGAGTTATTGTACGGATGTGCTGGCTGTTATTTTGAGATTTCTATAGTACA
TAGAAATTGAATCAGTGCAAGGTATGTGTTTACATTTGCATTTTATTAATAAATGAAAAG
TATCAATCTACTTTTTACAGAGAACTTACTGATCTTCACAAAGCCAACGCTGCTAAGGAC
AGTGAGGTACAAGAAGCTGCTCTGAGGCGTGAGATGAAAGCTAAAGAAGAACTTTCTGGG
GCACTGGAGAAGGCCCAGGAAGAAGCCCGTCAGCAGCAAGAGACTTTAGCACTTCAGGTA
GGCAGTGGTAGTCAAAGCCAACTTTTGTATATTTGCATGTTTCTGCAGAGTGAAACAGTT
TGCTAACAAATGTGAGTCTGTCCTTCTAAGAGTATACCTGGGAGGCTTCTATGACTGTGT
TACTGCCATTTTTTATTTCTTGGCTTTCTGTGGTTTTTTACATGTTTATGAGTATATGGT
GTTGTGGGATGTAGCTCGATGATAGAGCTAAACCCTCACTGCCAGGGGAAATAGAGTTTT
ATGAAACTAGGTATCCTGTTGCCAGAGTAATATATGTGCATATGATTAAAACACAGTTTC
CAGAGACTGTATTATATAATTGACTCTTGGACATATATGTAACAACATTTCTGGCAGTTC
ATGAACCTAATGAAGGAAGAAAGAAAGTTTGGCATGCTGTGGTTACAAAATTGTCAAATA
TTGTCAGGCAGTGGTGGTGCATACCTTTAATCTCAGATCTTGGGAGTCAGAGGAAGATGA
ATATTTGACTTTGAGACTAGCCTGGTCTACAGAATGAGTTCCAGGACAGCCATAGCTACA
CAGAGAAACCCTGTCTGGAAAAAAACATAAAGGGGGGGGGGGAACTAACTAATTACATAA
ACATAATATTATACATATTGAACATTTGAGATATATCATTTAGCTAACATGAATAATGCT
GCTATAAATATTCATTATACTTTGTTTTGTTTGATTCTTTTAATGCAGCATTTTATGTGC
TAGGGAAGTGTTGCCCTACTGAACTGCAGCTTCATTGCACAGTAGGTCTTATGTATACAG
ACATCTAGTTTTCCAAGCACTGTTCAAAACACGCAAAGCTATTCTCAGCAACCTCAGTTA
ACGTTTGGTTTTGTTTCACATATTTGGTGGATAAATGACTTACGGATGAAAGCTTGGTTT
CTAATGTGTTCCACCCTGTTGGTCCTCCTGGTCAAAGCATCATCACTTTATCAGTGTCAG
TCTCACTTCAGTGTTTCTGTCCTAAGGGCAGGGCTACAGACAGTCATTCTGATGGAGTCA
TCAGCCACACTTGTGTCTCTGCCACTCTTCTTACAGGAGAGATGACTTCTCGCACTGCTT
TACAACTTGCTTTGTGTTGCCACTGGATGGCTCTTAAATTTGGCACCTAATCTTTAATGG
TTGAGCTATCTCTAAGATGTTCTGCTAGTTGTATAATAGTAAAACTTAGAGTTTTAGTTT
TATATCCCTTTGCTAATTAATTTCCAAGTATATTTTTGATGGGTTTGGATTGCTTTCAAT
ATTTTGCGTTGTAAATTTGCTGTGGTCCATGCATTTCTGCCACCCTGTCACTTTCAAGAG
GCCACCTTATATAAGGAAATATGTATATACAGAATATTACTACTTTACATTAATGGGCTA
GAGAGATGACTCAGCAGTTAGGAGCATTTACTCCTCTTGCAAACTCAGGTTTGGTTCCCA
GATCTCACATGGCTGCTTAATAACTGCCCTAACTCAGTTCCAGGTGGTCTAGTGCCCAAT
TCTGACCTCGTTGGTGTATATATATATGTATGTATATATGTATGTATGTATGTATGTATG
TATGTATGTATGTATTACATGTCATACACATATGTCACACACACACACGAATACCCTAAT
TTTTTAATATTTAAAAATTCTTCAGATTAAAAATACATTGTAATAATAAAGAAAAATTGG
AGTAAAAAATAGGGTACGAGACTGTCATTCTTTTTAAATTTTTTTTATTTTTTAAGATTT
ATTTACTTATATATATAATATATAAATGCTCTATTTGCTTGGATGCCTGCATGACAGAAG
AGTACATCAGATCCCATTACAGATGATTGCGAACCACCATGTGGTTGCTGGGAATTGAAC
TCAGGACCTCTGGAAGAGCAACCAATGCTCTTTCTCAACCACTGAGCCATCTCTCCAGCC
TGGGTTTGTCATTCTTGAAACCACCATGGTATAGAAGGACTGCTGATTTGTATCTTACTG
TGTTAACATTATCTCCTTCTAGGATCTTCTTTAATAATTGATAACCATAGACACAATGTC
TTTCCAGTTAGGATAAATAAGTATTTTGGCCTTGATTGTAATGTTTAGTGCTTATGTTCA
TGTATGAGCATTTGAAAACAAATCTCACACTGATACCATTTAGAGCTCTGCCTTCACCTT
GTTGTTGCCAGGCTTGCTAATGCCCCAGGGCATCTCCACAGACTAAGTCTTCAGGACTGC
AGTGACCAGATAGATTATTTAATATGATTTAAATAAGAGTTTAGATAGTTGAGGCAGTTA
CACGCTGTGTAGCTGTGTTGGTGACACCCTGTTCCTTGTTCTTGTACTGAGATAGTGCTG
TGCAAGTGACCTTCGACTTGTTTCACACTCCCAAATAGCTGGACTGCAAGTGCACACCAT
CACACTCTTTCTCTTTTAGTTTTGTTTTATTGTTTAGATAGGGCCTACTGTGTAGCACAA
AGCTATCTGGACAGCCTAGGCTGGCCTGGAAATCGAAATGCTGCTACTGACCTCACAGGT
GTATGCCACCACCCCTAGTTTAGTACCTAATTTGTATTTGTTTCATCAGTCTAGCTCTGA
TCCCCTCTCTCTCATAGTATGGCAGGGCTATACATATTTGCATACTTTTCTTGGCTAAAG
TGCTTTTGGTTAGGTAGTGAACGTGTTCATAGCCTTGGCATTGCTTAAGGAGCAGGATGT
GTGCTCATTGTTTAGCATGAAGTGTCCTACTTAATCAACACACATGTCAGCTGGAAGTCA
CCGCTAATGTTCTGACAGTGTTGTTTATCCGGCAGGTTGGGGACCTTAGGCTAGCGCTGC
AACGGGCAGAGCAAGCAGCTGCCAGGAAAGAGGATTACTTACGCCATGAGATCAGTGAAC
TTCAGCAGGTATTGTCATGGTTTCCCAAGCACAAGGTCAATAGTGTATCTTTTGAAGTAA
TATGACCACTCACGAGGCTAGTATTCCTGGGTCAAAAGCATTACTACCAGTGGACGAATT
TTTGTAGCTTATGTGAACCAAGTGATCCCCTGGAAAAAAATAGGAAAATATCTAATTTTG
TTTTAAAGGAAGTAATTTTATCATGATAGACTTGCTGTATATTCAATATTGTTTTTCTTT
TCTTTTTTAAAGTAAGATAGCTAGAAATTTTTTTCTTGGAAAATTTTAACTGAAGCTTAG
GTTTGCTGGTGTTTGTAGCCTTTTCTTCCCTCAGTCAGTGGTAATAAAGTAGGAATTTTT
TGATTCAGAGACTCCAAGAAGCAGAGAATCGAAACCAGGAGCTGAGTCAAAGTGTTTCAT
CAACAACAAGACCTTTGCTTCGACAGATAGAAAATTTACAAGCAACTCTAGGATCCCAGA
CATCGTCATGGGAGATGCTAGAGAAGAATCTTTCTGATCGGCTCGGTAACTTCCTTAGTA
CTTTATGTTTGATGCAGGGGGTTTCTGTCTTGTGTGTAGAAGTAGAATAGTGGTATGACA
TTGAAACTCACCTGATCTCATGCTGACATTTGCGTCTAACATGTTTAGGTGTGTCTCTTC
CCCCTTTTCATGGATTCCTCAGTTAGGACTCTTTTAAAATGTTTTTTCTTACACAGCGTG
TCACATACTTTACTGCCTGCCATTTCATTTGTTGTGTTTATGTGGGGATGGTGTGTTTGT
ATGTGCACGTATGTGTGACAATTCATGTACCCACATGTATGTGCAGGTGTGTGGAGGGCA
GAGGTTGATAAGTGTTATTTTCTGAAATGCACAAAGAACTTAACACTCCAAAGGGTTGAG
TTCAGTTCAGGGCAACTTCCCTGTTCTGTTAATTAAACTTTGGGACATTGAAATTGGCTG
AGGGAAATTACTGAATAGAGAATATTACTCTATTCATATACTTCTAGCCTAAACACATAA
GATTTTTTTCTTTTTTTTTTTCCAGATCTGGCAACTGAACGCAGGGCCTTGCGCTTGCTA
GGCAAGCGCTCTACCACTGAGCTAAATCCCCAGCCCCCACACATAGGATTTTAAAAAGTT
AGAAACATTTCATTAGTGCAGTCCTTTGATTTCTGAGTGTTAGTCTGGGTGTCTGTTCTG
TAGTTGAGTCCCCACTTACTTGGGGAAGGATGTCTGCTGTGGTTCCAGAGTAGGAGTCTG
GGGAATGAAGCTGCTGTAAGTATCCTTTCAGGAGGGAATGTGGGGTAAAGACTCTCACAG
TTTTGAATAAAGGACCAAATATGCAATTACTGGACACGTGAGCATTTATGTTGAGTCTTC
AGAAAAAAGGCTCCATTCACAGGGCTTAGAGCTGTGGGAGCAATCCAGTTTATTTACAGC
CTTGGTAGCATTTTCGCTTCTCTGTTCTTACTGTGTTTTGTTTTGTTGTAATTTATCATT
CATAAATTCTTATATCTCATCATCTCAATTTTCTTTTCCCTGTTGAGAGCTGATGTGGAT
CATTGTTTCATGTGCTTGTTTTCCACTTGTCCACCCTGTAGGATGAGCTGCTTGCTCATA
GCTTTCGCTCATTTTTAAACTAGAGAGTTCTATCTGTACTTTAAGCCTACATGTGTCTTG
CATTTATTTTTTTCCAATTTGTACCTTGTCTTTTTTATATTACCAACAAACAACTAAATA
AGACAGGGTCTCATATAGCCAAACTGACATCAAAATGATCTGAAACTGGACCTCAAACTC
TCTAGGTAGCCAAGGATGGTCTTGAACTCCTCCTGCTTCTTTTGCCAAGTCATGGGTTTA
TAGATGTACACCACCAACCTTGGTTTATGCAGTGCTGGGGATGAAACCATGGCCTCATGC
ATGCTAACTAACCAGGGAAGCTCCATCCTTAGCCCATGCGTCTTTCTCTCCTCTCCTCTT
TACCTGCCACAGAAGTTTGTTTGAAGGACTCTATTTCGTTGTGCTTTTTTTTTTTTAATT
CTATTTGTCTTTTACTAGTCTACGTTTGTCTGGATATGTGGTTGCTCCAGTGCTATTTGT
TGACTCATTCCCCTAAATAACTGAATAACAGTGTTTTCAAGTAGATAGGCTGAGGAGAGA
ATGCTAACTTGTGCATTGAGCAGTGCTGGCTACTTGTCTTTGTCTGGAAACTTGAATCAC
TAGAAATTTGAGGTCAGAAACGACCTGGTGTCTGATCTTTCCCTGGTGTATGTGTTTGAT
TTCTTCTTCCTCTGTAACCAGGTGAATCACAGACCTTGTTGGCTGCAGCAGTTGAAAGAG
AACGTGCAGCTACGGAAGAACTCCTAGCCAACAAAATCCAGATGTCTTCAGTGGAGTCGC
AGAATGCATTACTACGACAGGAAAACAGTAGACTGCAGGCCCAGCTAGAGTCAGAGAAAA
ATAAATTAAGAAAACTAGAGGATGAAAATAGCCGGTGAGTATATTTATGTGTTATTCTCT
GTGGTTCTTGACATTTGGGTCTCAGTGTCATTGCATGGAGTACTGAAAGTGAACACCTTG
CAGTATTTAAAGTCAGGGTCATTGTGACATGCGTCAGGCTAGGGAAGGATCCACTTGTAG
GTCTTGTGAGGCTGCATGCTATGCTCTACTTATGTTGTGGTTTTCCAGGTAAAGTCCCAT
CAATATGTATTTTTTAAAAAGAGGCCAATGCCACCAACGAAAGCAAAGGTGGGGTGGGGG
TGGCTTTGTAGTCTTCCATTTTTTTTCTCTAAATAAGTATTTGGATTCTCCTAAAACCAT
GGCCTGTAAAATCATCTATCTGAAATTACATAAAGTCATAATAGATAAACTTTTACCCTT
GATTTCTGCTTTTTCTTTCTTTTTCTTTTTTGTTACATTTGAGCTCGGAATGGTGGTACT
TAAAATTACTGTTTAAATGTCCTATTTTAAATTTCTGAGTACTGGTTTAAAATATGGGGT
TGGGGGAGTAGAACTTTTGAGGCTCGGTGATCTGGAACAGTCAGCTGAAAAGCCTTCAAT
GCTCAGCTGGTGACAAAATGACTACTGACTGTAACTGGGGTTTGACAAGTGGAGAGGTTT
TAATAGTCTGTCCTGTTGTCTTTTTGTTTTGTTTAATTCCCTCTGGTTTACTAGGTACCA
GGTTGAATTAGAAAATCTAAAAGATGAATATGTAAGAACACTTGAAGAGGCAAGGAAAGA
AAAGGTATTTCCTGGTGTTCGCTCTCCCCAGGGCTTGCATTTAGATGGATGGGATGGCAG
CGAGCTGCTGCTGAGTTAAGCTGGCTGAGCAGGAACCTTGTCTTCAGTGGGGAAGGGGCA
GCTTGTACTTGACACTCTGAGCTTTGCAGTTGACTCATGCCGGTGCCATGGGCTAGTATC
TCAAAATGATCTCGCTGTACTCTCTCCTTTAGACACTTTTGAGCAGTCAGTTAGAAATGG
AAAGAATGAAAGTTGAACAAGAAAGGAAGAAAACCATTTTCACTCAAGAAACACTAAAAG
AAAAGGTACTAAGTTGTGGTGGTTTGTGCTAATTTGTATAGCTAAGCTGTTGTGGGTGAC
TGTGGGTTCGTTTAGTAGTACTGACGTCTTAAGTTTTTCCCCTTGTAAAATTTCTGGGCT
GAGTGTGGTAGCACTGCAGTGTTCCATGAGAACAATTTGAAGTCATTTGAGTGCATTCAA
ATTGGTCTGTGGTTAGGTTCTAAATTATAGAAACATTTGCACTTTTAAAAATGCTTGAAA
TTTTAAAATTTTTGTGATGTCTCACTGAAACTAATGTAGTAAATGGCCCGAAGGCAACTT
GAGAATGAATTGGCTTGTACCTTTCTGATTAGTAAATGTAGTGAGGTTTTTGTTGTTGTC
ATTTATGTTTTGCATGTGTGTTAGTGTATTGTGTGGAAACATGCGTATGTGTGTTTGCAT
ATGTGCAGTTGTGTCTGTGCACATGCATGTGGAGGTCCAAAGTTGATATTGGGTGTCTTC
AGTTACTCTCTACTTTGTTTTACTGAGGCAAGTCTCTTGCTGAACCTAGAGCTACTCTAA
CTAGCTAGCTGTCTCAGGGATCCCATGTCTACCCCCTGGGCACTGGGATTATAGGAAGCT
GCTACATTTGCCTGTTTTTTCTATGGATTCTGGCATCTGAAATCTGGTCTCCATGCTTTA
TGCACTAAGCCGCCTCCTTAGCTCCTAAAGGGAATTTTTACAAAACATCTTTTCTATTCT
TAAAGAATTGTAACAAACTGAGAGTTAGCACAGTAAGTTAAAATAAGTCCACAAAAATGG
AAATTACCTTTTGAATATATTTGGATGTTTTTTAATTTTTAATTTTATTTTTATTTTATG
TGTATACGTGTATGTATGTCTTTGTACCACATGCATACAGTATCCTTAGACGCCACAAGA
GGGCATTAGATTCCCCAGAGCAGGTTAGAGGTGTTTCCAGTCACTGTGTCCCTGCCTGGA
ATTGAATCCTGGTTCTCCTAAGCTGGTACTCTTAACTGCTTAGCCAGCTGTTCAGCCCCC
AGGTATTTTGTTTTTGTTTTGTTTTTTTAAGTTAGGTTCTTTCTTTGTAGTCCTGGTTGA
CCCCGGAACTTACTGTGTAGACCAGGCTGGCCTCGAATTCAGAGAGATTTGCCTGCCTCT
GCTCCTAAATGCTAGGATTAAAGGTGTGCACCACCACTGCCTGGCCTTTTTTTTCTTTTT
TTTGGGGGGCCATTAAAATAAAATGAATAAGTCAGAAATTTTAGCAATTTTAAGAGTAGT
TGGTAATATGTTATATAACTTGGTTAGCTTCTGCAGGCTTTCAACCAAAGCATTCTGATT
CCATTTAAAACAAAACCAAACCTGACTAGTATATTACAATATAAATAGATCAAGGCAGGC
TTAAAACTAAAAAAAATATTTTTATTGGCTTTGTAAGATTTATTTATTTTATGTATTTGA
GTGTTCTGTTTTCATGTACACCAGAAGAGAGTCAGAATCCATTACAGATGGTTGTAAGCC
ACTATGTGGTTGTTGGGAATTGAACTCAAGATCTTCGGAAGATCAGCCAGTGTTCTTTTT
ATTTTTTTTTTAAATCACATTTTTTATCTTCTGGCAGATATATATATTTTTTTTTGATTT
ATTTATTTCATGTATGTGAGTACACTGTTGCTGTCTTCAGACACACCAGAAGAGGTCATC
GGATCCAATTGCAGATGGTTGTGAGCCACCATGTGGTTTCTGGGAATTGAACTCAGGATC
TCTAGAAGAGCAGTCAGTGCTTTAACCGCTGAGCCATCTCTCCAGCCCCAGCCAGTGTTC
TTAACTGTTGAGTCATTTCTCCAGATCCCAGGCTTTGAATTTTAATTTAAAATGTTTTTA
TTATGTGTACTTTAGTGTGTATGTGTATGTACATGTGTACACGCATCCCCTGTGGGTCAG
AGGACAACATGTTAGAGGATAGAACTGTTTCTTTCTCCTTTACCATGAGGGTCATGGGAT
TGATTGAACTCAGTTCAGGTTTGGCAGCGCCCATCCTTACCTGATGACCATCTTGACAGC
TCAGCTCCTAATTTTTAAATGCTTTTCATGCTTCTAAGACTTGTGGCTTTGAGAAATCAT
ATCTGTAACATGTTATGGAGAATGTAAAACCTTTGATTTCATTAATTTTAGAAATTGTTC
TTGCTTCCTTTATTTTTTGCTTCTCAGTCTTACAGAGTTTTTTTCCCCCTAAGGAGCACA
AGCCGTTTTCCGTTTCTAGTACTCCCACCATGTCACGATCCAGTTCTCTAAGTGGAGTAG
ATATGGCAGGGCTGCAGACATCCTTCCTATCTCAGGTAATGGCTTACATTTCTCACCCTT
GAGTAAGGTTAAAGGCAACATGCAGTTGCCAGATGGACTGTCACCGTGACCTTGTTGGGG
AGGGTGGTGCTAATTGAAGGGAAGAAATACACATGATTTTCTCCTTTTGAGAAAACTCAG
AGACATTTCAAAAAGCAAGAATGAACGTGATGATAGGACATGTTAATTGTGTGTGTGTGT
TCTTCAACTGAATAGGATGAGTCTCACGACCATTCATTTGGGCCAATGTCTACGTCAGCC
AGTGGAAGCAATCTTTATGAAGCTGTAAGGATGGGAGCCGGATCAAGCATTATCGAAAAT
CTTCAGTCTCAGCTAAAGCTGAGGGAAGGAGAAATTAGTCATTTACAGGTATTGAAAAAC
TTCAGTACGCTGAGGAAGTCCATGAAATAATGAGTCCCAGTTAGTAGTAGTAGCCCTCAT
TTCACCTGAATTTTGAGCACATTGGAAAAATAATATCAATTGGTAATATATAAAACCCAA
TTGTGTATTACGCGTATTAATAATAAAAGCTAGAGTCAAATGATTGGTTCTCCTACCCGA
CTTACTGCCAGAATTAGGTAGATTTATCTGCTCCGTCCTAGGACATGCTGGGGGCCTGTG
CCATGGCCTTCCCCAGAGAGGACTAAGGGTATCTAAGAACAGGAATGGCTCCCTCCTTCC
CAGCCTTCTTCTCAACAAGAAAAAAGGAAGTGCTGAAACAGCACGCTTGCGTCCTCTTCC
TGTGTGTGCACAGAAACAGGTTCTCTAACGTGCTCCTCAAGGATGGGATAACATGAGAGA
CCTGCACACAGGAGGAACAGCGCAGAGGAGGGAGCTGTATGAAGTCTTGTTCATGAGTTA
CAGTGATAAGCTTTATACACTGAAAATGAATAGCTCTTCCCATTCTCATTCGCACAGTCT
TAACACGGATTGATGTGCTCGCCCAGGCTGCTGTGCTTGAGAGTGCCACCTAGATTTTTC
AGAAAGTAGTGACAGCTTTTAGCGATAAGACCTACACAGTTGGGAGGACCACATTAAAGT
ACGTTCTCATGCCTTTGGCTGCTTCTGATAACATAGAGGAATGGAAATGTGCACTGTTAG
AGAAAAATCTGGTTGCATTTTTGCAACAAATCATTGGAATTTTTTCTTTCTTGCTTCGTG
AACCCTCTAATTAATAAACTTCTAAAGAAAATTGGGGCCCCCTCTTTTCCCACTACTTTA
GGATTATATACTGACATATGTTTGTTTTCAAAAAATGACAACAGAGTATTTTTATGTTAG
TAAGAGCATTAAACAAGGTATGTTTTTATTGAAACTATTTTGTGATTATGTTTTTCAGCT
AGAAATTAGTAACCTAGAAAAAACTCGATCCATAATGTCCGAAGAGCTAGTTAAATTAAC
AAATCAGAATGATGAACTTGAGGAGAAAGTGAAAGAGATACCCAAGCTTCGAGTTCAGCT
GCGAGTAAGTATTCTTCACTTAGGGATAAATCTAAGATATTTTAATTCAATTATTAAATT
TCCTGTTTTTAATTTACATAAAATGCATATGGATGACTTGGTAATTTCGTTGAGAATTAA
GGCGTTAGTAGTTGAATAGAGAATGTTAAAGATGACTCTATTGCCTGTGTTACTGTCTGT
CTAAACTGTCTGTGTGTGTGTGCCTTTATAGTATTGGACTTGGTGTATGTTTCATCCCAT
CACTGTAGCATATTGACTGTTAGGGGAGACTCGTCATATGGGATAAATGCCAAGCAACTT
AACCCAAGTTAATCAGGAAGACAAAAGGCTCATCAAGGATACTTAAATTCATGGGAAGGA
GACTGACTAAATCTTATTTGGAGAGAATTGTACAATTCATGGAGAAATATGGTTTGGCGT
GTGTGTGTGTGTGTGTGTCCGTCTGTCTCTAGGTGTGTGTGTGTGTGTGTGTGTGTTGTG
TTTCTGTTTGTATGTGTTATATACGTATGTGCTAGGATGCACGCTAGGAGGTGGGAAGAA
TAAGTAGCTGTCTGGCTCTACCACTCTCTACCCTTTTTTTTCCTTCACACACAGTCTCGC
TGAGCCTGGAGCTTGCTGTTTTGTGGGTAGGCTGGCTGACTGGCCAGCTGCTCCAGTGAG
CCTCCTCCCAGGTTTGGAGTTACAGGCCTCATGGCTTTTGATGTCAGTGTTAGGCTTAGA
AGCAAGGTCCTCGTGTTTGTTCAGCCAGTGCTCCTCCTCACTGAGCCCGCTCCTCACTGA
GCCCGCTCCTCAGGCGTCCATCTAACTTTTAATAGCAGTTCCTCTTTTTTGTTCTAGATA
GACTGGCTATGAGTTTAACTTTTAAAAGAGACGAGTTTATATTTTTATTCAACTTCTGCA
ATCTTTTTCTAGTGACTTATAATAACTGTAAATGTTTGTATGATCATTAAAAAATATAAA
TGTATTTTTTAGGATTTGGATCAAAGATACAACACTATTCTGCAGATGTATGGAGAAAAA
GCAGAAGAAGCAGAGGAACTTCGCCTGGATCTTGAAGATGTAAAAAATATGTATAAAACT
CAAATAGATGAACTTCTAAGACAAAGACTCAGCTAACTTGTGAAGTTTGTGTTCCATCAC
ACTAATGTAAACACTTATATATAAATGCAGACGTACAATAAATTCTTCTACAGAATTAGA
AACTTGGATTTGCTGTAGATTGTAAAAAAAACTTTTTAAAAATTCTTTTATAGTACATAG
TGATATTTGCAGTTAAATTATTTTATGTAATATTTGAATTTTATTTTTGAAATTGTTCTT
TAAAATTTTATTTTTTAAAGCTTTTTTTTTCTTTTTGGTGCCTTGAACAGCACAGAGATT
TATTACTTTATCCACTTATCAGTACAGCTAGGAAAGGAGATTGGTGTTTCGTATTATTGT
GGATACATAATTAATTGTATTATATCTAATTTGTATGTGTTTGTACATATTGAGAGATTT
ACAGAGTAATGTTAACATGGAAATTTTGAAATCTTTCACATTGAAATCTTCAACATATTT
CTTAAAAATGTTTTAAACATTTGAGTAAAAAGATTATTAAGCCTATGACTACTAAATTAT
AAACTAAGGTTTTCCTTTAAAAGCAGAAGTCACACTGACATGTCTAAAATTTAAAGAGTA
ATTTAAACTTAAAAAATATCTCTGTTTTGAAAATTTATTCCATGTATCTTCCACAATGAA
GTATGAACAAATGTGAATGCATTTTGTTACTTATCCAAAGAAAGCTATAAACATTGACTA
GGCTTAATTGGGTAGTAGGAAATGTTGCTTATAATAAATTGTGATAGATAGCATCAGTAG
CGGATAACTTTGAAATATTTTACTACACTGTTAAATGAATCTAACATAATAAAATCATTA
ACAAAATTTACTTTTAAAATTAGTCAATTTACTCTTTAAAAATTACTTGTCTAGTTTTGT
ACAATATTTTCAAACATTAAAAATGAATGTTTTAAAACAATCTGCATAGCGAAACATAAA
AGTAATAGGAGTCCACTTAAATTGGGGATTTTGTAATTTTGTGTAGTTTAACATTTTTTC
CTTGAACCTTTAACAAATGAAAAAATAGCAAAGAGTAGTATAGAATAACATTCTTTAGAA
TATAGGTTTTCCCTCTTCCAAATGTTACTTTGTTTAAAAGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1219, 3172..4376, 6246..6349, 7418..7544, 9152..9257, 10716..10858, 11401..11567, 11960..12116, 14915..15007, 15368..15524, 17301..17493, 18174..18243, 18452..18544, 20753..20854, 21075..21227, 22198..22323, 23292..23521
1078..1219, 3172..4376, 6246..6349, 7418..7544, 9152..9257, 10716..10858, 11401..11567, 11960..12116, 14915..15007, 15368..15524, 17301..17493, 18174..18243, 18452..18544, 20753..20854, 21075..21227, 22198..22323, 23292..23435
AC_000072.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved