Rattus_norvegicus Locus LOC684322
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus LOC684322
Rattus_norvegicus
LOC684322
4
SNORA36
18408..18530
25317
ATGTATCACATGCAAATACAGGCATTTTCTATTGTTAATCCTGCCCTTTGACTTTTCAG
TTAAAATTTTTAAGAATCATTTTACTATCTGCCTCTTGAAGTACCACCTATTTCCCTATA
TCCCACCCCCTTTAGGTAGGGTCTCCCCTTGTGGCCTTGGCTGGCCTGGAATTCACTGTA
TAGACCAGGTTGACTTCACACTCAGAGTGCCCACAGTGCACTTTGTTTAAACATACTAAG
AATCCTTGTACACCTTTAATCCCTGCACTCTAGAAGCAGAGGCAAGTGGATCTCAGTGAG
TTCAAAGTCAGCCAAGGTCCAGCTACACAGTCAGACCCTGTCCTCACTCTTTGTTATTTA
GGAGTTCAAAAAAGTTGGTGCATATCTATAAACATATAATCCCAGCACCTTGGAGGCTGA
GGCAGGAGGATCATGAATTCAAGACCAGCTTGGGCTTCCTAGTGAGACACTATGTAAAAC
AAAACCGAAGAATTGGTATTTAAGTATTTGCTATCTGTTTCTGATATGAACTTACAATAT
GGTTGTGGTGTGTCTTTGTGTGTGTTATAGTTTAAATGTACTTAGTTCTTAGGATTTTAT
ACCTGCCAGATACTTGGTGGCATTTTGAGCCATATGGGCTGTGAACTTATAGAAAAAGCA
TGTAATTACACCTTTTTCTGGGATCACAAGCTACTTTGAACAAGGGCTTTTACATTCTTG
AAATATTTGGAGACACCCCTCATCCCCATAGCATCTCACTGTCTAGTGACCTATGAACTC
TTAATTTTGCTCCAACCACGCACAACTTGAGGTCATCTTCATTAGGATTGACCTTTCTAA
ATAAGGAGTTTACCGTACTTCGAGGATTGCTTGTTTCACATGTTTTTGCTGGTCATGTTT
GAAAGGCTATCTGGGCCAAATGAGCCTTTGAGCATTTACACAGTTGATGTAGTAAGTAAC
CTTTTCTAGCTGCTAATTGAAGGTGCTTCTTCTTGTTTTATAGGTGTCAGCTGTGATGCA
TGTTTAAAAGGAAATTTTCGAGGTCGCAGATATAAGTGTTTAATTTGCTACGATTACGAT
CTTTGTGCATCTTGTTATGAAAGCGGGGCAACGACAACAAGGCATACAACTGACCACCCG
ATGCAGTGCATATTGACAAGGGTAGATTTTGGTAAGTCCATTTATCATTCAAGGGCTTTC
TATGGTTATGAAAAAGCAAAACATCCTGAAACTATCCCCATAAGCCTATCCAAGGGTCCA
AAGTCATTCAAACTAAAACCATCTTCCCTGTGTCCCTTCTTCTGTCTCTTGGTTATAGTT
TTCTTAAGAAGCCCTTTGAAAAAAATCCACAGTGGTGAAGGATTAGGTAGAGCTTCTGTG
GAAACAAGCAGTGAAGTCAGGCTGGGCTGTTGCTAATAGCATGCGAGTGCACTGGCAGTC
AGTTAGGAACGCTGTCTGCTTCAGGACCTAATTACTTAACTAGCCTATACCCTTATAACA
GTCTTTGATTATAGCCTTCCTGATGGGCATGAAGCACTGTCTCAAGTGGTTTTGATTTGA
TAGTTAATGATCCAAGCATTTTTTCTTAATGCTTATTAGCTATTTGTATATTTTTGAATA
AAATGTTCAGATTCTTTTCCCATTTTAAAAAAAATACATATAATGCCTTTATTGCTTAAT
TATAGCCGATCTTTATATATTAGATACATTTCCTTAACAGATAGGTGATTTGCAAAAATT
TACTCCCAATCTGTTGTCTTCTCACCATCTAGGTGCTGTACTTTGGAGTACAGAAGTTTT
GCTTTGAATGCCTAGTTTGTTCTTTTTAATTACTTGGTGCTCTGAAGTCACCCAAAGCAC
ACAGCCCAGGCTAAGTCACTGGGAAGCTGTCTTCTGAAGGTTCCACTTGGTCTGATTTAA
ATCATGCACTTAAGATCAGTTTGTTTGTTTTGTTTTCATTTTGAGACAGGGTCTCAACTA
TGAAGCTAGATTGGCGAACTCACAGAAATCCTCCTGCCTCTAGCTCCTGAGTGCAGGAAT
TAAGATTAGGTTTTCACGTGAAGTTGAGGTAGAGGGTACCCAGCTGTTCTGGGATCATTG
AACTATCTATCACTTTTTAGTTTTCTTCTGGCTTAAAATAAGTTGCCCATAAACAAAGGC
TTACATAGGACAGTCTTGGGTTGATGTGTGTGGCTGCTCATGACAGGCCGTGCTGTCTGC
ACTTGCAACGCTCTGTAGACACTGCTGAAAGGTCTGCTCTCCTGATCCGGTTCCCATTCA
GATCAGAAGTGCACACTCTGGGTCCCTTGAGTTCCTCTGAGTTTTAGGAACACTGACCTT
TTTTTTTCCACAGAAGCCAAGTAGATGTTGATAGTGATTGTGTAGAGCTTACAGATTTGT
TTGAAGAGTGTTGCTATTTTGGTATTAAATCTGATCCACGAACATAAAATACCTATTTAT
TTTAGGGCTTTCATTTTTCTCTATAATTCCCAGAGAATAAAATATATTTCATTAAACATA
CTCGTAAGTATTCTTTGGCTGTTGCAAATAAAATTGATTTTATCTTTGGGTTATTTGTTA
TAAATGTTATTAAAAAACAACTACATAAATCATATAACTATGTTGCTAAATTGGCTTATT
AATTCTAATATATGATTAGTTCTAACCTAGTGGATTCTTTTTTTTTTTTTAATTAACTTG
AGTATTTCTTATATACATTTCGAGTGTTATTCCCTTTCCCGGTTTCCGGGCAAACATCCC
CCTCCCCCCTCCCCTTCCTTATGGGTGTTCCCCTCCCAACNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNCACACATATATATGCACACATGCACATGACACAGATACATATGCATACAC
ACACATATATATATCCACACCATGTACATATATACATATATAGCAATGACACTTTGAAGA
TAGTTTAAATATCTCTTAAGAATTATTATCTCTCTCCTACCCACCTCATTTTGTTTTAGG
CAGGGTCTCGTGAGAGGTGGACAACAAGCAGATTCTAGGATTATCTTTCCAGGCACATTC
CCAGTGACTTAATCTCTTTAACCTGGCCTTGTCTCTTTAAGGTTTTGCCACTTCCCAGCA
GTACCATACACAGGCTAGAGACTAACTTATCCATGGGCTTTGGAGGAACACTCTAAACTA
TGGCTTAGGGAAATGTGTTTGCTTTGTTTTTCCTTTCTTGCTATGTAGAGAAAAAAAATT
GGAAGAGTGTCCTAAGTTTCATATGGAAATGAAGGTTTTTATAAATGTTAAGAGTTATTA
AAACCTCATTGAAATCAAGCTTCCAACTGTAATCTTACACTCTTAAATGCACCCCATCAC
ACAACTATACTCCCTTAATCCCAGCAGGGGCAGGCAAAGTTGTGAGTTTCAGGCCAGCCA
GGGTCATTTTAGAAAGCAGAGCAGATGCAGTGGCACTTTGAGCCACACTGTTCCCTTCAC
ACTGCGTGGACCTGACCGTATTGTACACTTGAGAAGGAGCATGGGCATTCCTCAGTGCAA
CTCCACTTTGTTTTTCAGATTTGTACTATGGTGGGGAAGCTTTCTCTGTAGAGCAGCCAC
AGTCTTTTACTTGTCCCTATTGTGGAAAAATGGGCTACACGGAAACATCTCTTCAAGAAC
ATGTTACTTCTGAACATGCAGAAACATCAACAGAAGTGGTAGGTGAAACATTTTGCTAAA
TATGATGAAATAAATATGTTACTCCTGATGTTGCTAAAACTAGGCACTGTCGTCCTCTTG
CATGGTATAATGGACTGTGTAGTAATAAAAAATTATTTCCAACAGCAAATTTTAGATCCC
TAAGACGCTGCATTTCTTCCAGGTGCCTCATCAGAGGCAATGGAGAAGGTTGAAAGGACC
CAGCCAGCCTTCTTGTGCCTTTTTAAAGGGTTCTTGTATTGCTCTGTGCGTTTTTGTTCT
TTTGTGAGGAACTTTTCCTGGGGGAACCTGCAGCTCTTTACTTGTGGACTAAGTAGTCCC
GGACTGGTCTTCCTTAGATTTCACCACATCACCTCTTAGCTTCCCAGGTCAGAACTCAAT
GCTTCTCAGTTCTTCCTTCCTGATCCCCCATCCCACACTCCCCCATGACTAAAAGACAAA
TACCTAGAATAAACTATGAAGTCTAGGGCTGGAGAGATGGCTCAGAGGTTAAGAGCACTG
TCTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGGCTCATAAACAT
CTATAATCAGGTCTGGTGCCCTCGTCTGGCCTGCAGGCATACATGCAAGCAGAAAGCTGT
ATGATTATACATAAATGTTAAAAAAAAATATGAAGTCTAAACTTGAAAACTTTGAACATT
TCTTATTTATCTCACATCTGAGTCACTATGCTTCTGACTTTAAGCAGTGATAAATACACC
CAAAAGAGTTTCAGAAATGAGTTCATTCAATCAAGATAGTGGATTGCAGGGAAGAACAGA
TCAGGGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCGCAAGGCCCTGG
GTTCGGTCCCCAGATCCGAAAAAAAGAACCCCAAAAAAAAAAAAAGATTTATTTATTTGG
GGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTATCGAGCGCAAGGCCCTGGGTTCG
GTCCCCAGCTCCAGGAACAAAAAAAAAAAAAAAAAAAAAGAACAGATCAAAGGAGACTAT
CGAGGGGGACAGTAAAGGAAGAGAAGGGACTAAAGGGAAGAGGACGGGATGTGGCTATGG
GGTATGTGAGCTAGAGCTGACTTCTTGGTGACATTAGGTAAAGTGAAGTGTCTGTGTGCA
GCTGTAGATCCTGACTTTGGAGAATTTGCATACATGTCAAACAGTAATTCTCTACATGCA
CTTAAAACGGGTACCGTTCATTCAGAGAAACAAAGCAGTGCTCTGAGGGCCTGCACAGAT
GAACGCCTGGCCAGAGGCCGCTGAACAGGTTAATTTTCACTCCCAGGGACAGTGTCAGTT
TTGCTCCCAAGTTCTATAAGATTTAAAGGTGGAGGTTTGATTAACTTCATCTGATCCTCA
AACCAAATTTCCCTTTAGAGTACACCAACCAAGGGGACCTCAGAGCACCGTTGTCCCACT
ATTCGTTGGCTCTTGTTCTTGTTGGATAGCTTTGCTTCCTTTGTGCCATCCAAGGTCATA
GCACAAAGAGTCCTGACACTGTCTGTCCCCATCCCAACTGCTGGAGAAACTTTTGGTCAT
TTTTCTGTTTTAATTTCTGCTGGATCTTTTTATTTAACTAGATGCACTGAGTTCCTTAAG
GAGAACTGGACATCCCTAAGGTCCTTGACGCCAGCAAGCTCTGGTGTACTTTGATTCCTT
GGGTGGGCAATTTAACTATACCATTTACCACATTCAGGATTGGGTAATCCAGACCTTTCC
GTGGTTCACTCATCTTCATGAATAACAATCAAGGCATAAACTTTTGGTAAAGCAACTATT
GTTGTGTTACAATCCTCCATTCTGATGAGTGTGGAAACTAAGTACCCACCATTTACAGTT
TTACAAGTTTGTTCAGTCACTTAGCCACATTACTTTCCCAAAGGATCCAGTACCTGGTCC
AGGGCACCATTCTAGTTTTTCATATTTGTTCTGTGGGCTATGTTTTAATAATTTCTCCCT
CCTTAGCCCTTAGTTTTTACATGAGTATCAAATTACACTGCAGTAACCAAGCCCCAGAAA
TTTCAAAGAGAAAAATCGCAAGCAGACAAGGACTTTTGCTGTGAAGGTGCAGGGTCATGA
ATGTCTGGGTCATGCCAGGACCTGCATGTGTGGCCTACATACTAGTGTCGATTCCAAAGG
AGTAATGCCAGTGCCACACCGTGCTTCTGTCTACTCTCTTGTAAATGTGCACATCACCTC
TTAACCTACAGTGTTTCGTTGTAGGTTAAGCCATGCAGTTGTTTGTTTCGTGTTTTTGTT
TTTATCAAGATAAGGTTTCTCTGTAGCTGGCTGTCCTGGAACTCACTCTGTAAAGGAGGC
CTCAAACTCAGAAACCATCCTGCCTCTGTGTCCTGAGTTTGGGATTAAAGGCATAAACCA
CTGCCCAGCCCATTTTTGTGTGTCTGTTTGTTTGGTTTGTTTGATTGGGTTTTGGGGTTT
TTTTTGGGAGGTGGGGGGAGTGGTTCCCTCCATCATTGTGTGTATCCTGGATATTGAACT
GAGCTCAGGTCATCAGGATTGGCAGCACTTGCCCTATCCCAAACCAGACATTCTAAAATT
GAATCATAATCAAGAGTAAATCCCTTTATTTTGAACTGCCCAATTCATTATTGTGCCTTT
ATTCCAGCAGGACTGTAAGTGTCCTCAGACCAATTCCTACTTTGCCATAGGACTTAGGAC
CCATGCCTTCTGATAATCAGCATTCCTTTGGAATGCTGTAGGGCTGTAAGAGACTCTGTC
ATCCTAAACAGTTGCTACATCTCACTGAGAGTTGGAGTGGCTAGAAAGAGCGTGTGTACA
TAATACATTTTGATCATATTTCCTTATATTTTCTCTCATCTCATACCCCATCTCAACCAG
CTTGTACTTAATGTTATTATTATTTTTAAATCCAGTAAGTTTCATTGGGGTCTTTAAAGG
AATATGGCTGAGGACTGTTTAGAGGGGCATAGGCATCTTACCAGTGGTTGTACCACAGAA
GAAAGTGTTTATCCTTCCCCCATTGTTTTAGTTAGGGTCTTATTGTTATGAACAGACACC
ATGACCAAGGCAAGTCCTATAAAGACCAACATTTAATCGATGCAGGCTTACAGTTTCAGA
GGTTCAGTCCATTATCATCATGGCGGGAAGCATGGCAGAATCCAAGAAGACATGGTGCTG
GAGAAGGAACTAAGAGTTCTACGTCTTGATCCGAGGGCAGCCAGAAGAAGACTTTCCTCC
TTAGGCAGCCTGAAGGGGTCTCTCTTCCTCCCTGGGCAGATATTGAACACTTTTCCCCAA
CAAGGCCTGATAGTGCCACTTTCCATGGACCATATTCAAACCACCACACCCATCAGTCAT
TAACTGCTATGAATTCTGAAGGAGGGCAGGGTTTGAGTCCTCCTTCCTTCAGTGGCAGAG
TGTTGACAGCTCCAGTCTTTAGCACAAACTAGACTTGTCTAGGGCTGTCTGTGAGAGGGG
AGAATAGCAGGGTAGAGAATAGAGCATGTAGGAGAGACGGAAGCAGGAGCAGGGCATAGA
GGGAACATACGAGAGTGGAAGGGGCGCTAAGGAGAAGGAGTAGAATGCGAGGGAAACCAA
TGAGCTGGAGAAAACGAGAACTGGGATGCTCTGTGTACTTTAAAACATAACAGGTACTCA
TGATATTTATTGAAGGAGCTTGGAGGCTGGCATATATTTTGATACACTGATAGATGCTAC
AGATAGCCATGAGTCCCTTCTGCTAGAGACAGATGACTCCTTTCGTTAGAGGGGACCTGG
CCTCACAAGTTTCTGAGGAATGCTGGCTTATCTCTAACCACCAGAAATCCTCCTGTAGTC
CACATGAAGCTCACACCATTCCTGGATGTTTGGGCTGCCTCTGGGGTTTGGGAATTGGGA
GTTTCCTTTGGACCTAAGAGTGCCCTCTGATGCCTCCACGTCTTCCCTACCCATAGACAG
TGCATGGCGTTTAACTGAGGTCGAGCACATCCACCTCCTTGAGCATTTGCCGTGCCCAAA
GAGAAAACAGTCCTTTCTTGTAGCCTCTGAACTATGAGGCATGAGTCATCAGATGCGAAT
GCTTGAGAGCAGCAACTACAGAGGCTAGAAGAGGGCATTGGATTCTTACTGGAGGGGTGT
GGGGGAAGTGGGGGGAGGTGTTTGGTTTTGTAAATGGTGGAGGTTTTTTGGGTTTTTTGT
TGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTGGTTTTTTGTTTGTGTTTTTTTATTTT
TCCTTTTTGAGGCTGGCCTAAGAACTCAAGAAATAAATCCACCTGCCTTTGCCTCTCGTG
TGCTGGAATTAAAGATCTGTACCACAATGCCCGGAACAAGCATTATATTACATGTATGTA
TGTAAGTGTTCATTTGCTGAAGTTAAAGAATTCCTCGAGTTGAGTATAATGGTTCTTCAT
AGGAACAAATGCAACACATAATCGGTACACATAGATGTCAGGGTCGGGGAGACAGAACTG
TAGCTTATTTGACTCAGTGAGAGGGCAGTGTAAGAAGTAGTCAGCGGAGGCCTTGAAAGT
TTGTGGTTTTGAAAAGAATGGGAAGGAGACAGCATAATTCATAAGGAAGAGACACAACCA
AGATGCATTGTTAAGAAGAAAATAACTGGGCTGGAGAGACAGCTCAGCAGTTAAGAACAC
TAACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACTACATGGTGGCTCATATCA
ATTCCCAGCAACAGTGTTTACATATTTAAAATAAATCTTTAAAAGAAGGGGAAGGAGGAG
ACGGAAGAAAATAACCAACAGTGGTGCATTGGACTAGGAAATAGAAATGGATCTTCAGTG
AGAACAGATAGCAGAGAACCACTACAGCCAGAAAGCTGTGCCCTGGTTTACATGTAGACG
TTTCAGCTCCTCTACAGAAAAATGGCGTCTCTTTTGTTATGCCACTACACTTGTCTGAGT
TCCCTCTGCCTCTGCCTCTGCCTCTGCCTCCGCCTCCGCCTCCGCCTCCGCCTCTGCCTC
TGGAGTGCTCAAGGTGTTTGCCACCACTCCCTGCCAGAAATTTCTTAGGAAGGCTGAGAG
AAACACATTGCATGGTGGAAGGAACTTAAACTCCTCTCATTATTTTTAAGCTGTACATAA
TACGCAGAGAAGAAAGTCTGATATGATTGTATTTGGTGGTAGAAAGAAACCAGAGGAAAT
CCAAACCTGCTTGAGACTGAAAAACAATTGCATGGGAATCTATGGAGTGTGGGGGGTTTT
GTTGTTGGGGTTTTTGTTTGTTTTGTTTTGTGAGGATAAGTTTTTTGCTAGCTGGAATTC
ATGAGTAAGCTTGACAGCCAGTGAGTCCCAGAATCCGCTGTTTCCCCTCCCACCACTAGA
CTTAGAAGCATGTGGCATCAAACCCAGCAACTTTTCTTAGCATGGGTTCCTAAAGGATCA
AACTCAGATCCTTGTGATTGAAGGCACCTTACTGACTTGAGTTATCCTCCTAGGTCCCTA
CTTAAGGTGTTTTCCAGTAAACAGATAGCCTGTGTTGTCAGGGAGGGTGTTTCCTACGTT
CAGTAGTGACATAAGATCTGTGTGGAATGATGACATCGAAAGTCTGTTAGTAACAGCATG
TGTAGAAATGTGCACCAACTGGTTGCTTGCTGGTGATCCTTTGAGAAACTACAGAGACTG
CAGAGTCCGGCCGGCCTCATTTGGTAAAGGCTGTCAAGAGGGCGGCAGGCAAAAGGCAGG
ACCGATGAACAGAAGAGAGTGACCTAAACAATAGCAGAGACAAAAATTTGAGACACAGGG
ATGTTTGTGATGAGAGGACTTTTTGGTTAGATAAGTAACAATAGCATTTGGCTTTTCATT
TAATTGGGAGATAGACATTTAAAAACTGCAGGTTTTTGTTTTGTTTCCAAGTTTATTTGT
CAAATTTACCCCAGCTATAAGACCTGGGATTCTTGTTCAGAAATACACGTCTGCCCCTAT
CCAATCTTTCTCCAAGGCTTAGGAGAAAGCATTTTTCACAAGTTCTCCAGGTGGTTTATA
TTCTTAGCCAAATTTAGGAAACACCAACGTAGGCCAATTCAGTAAGCCGTATTGTTGACA
GGTTGTTTTAACTTTCAACTAATGTGTTAATGGAATTCTCATGTGAGAATAATAGAGATT
ACTGTGCTTTGTGGCGGTGGGAGTATGATAATTATTTGCGTTGACAGACTGTCACATTTA
GAATGAATGGCCTATCCTATATGTAGAATTTTCCCATGTTGTAAAGGACTTGAGTCCATG
ATGGTGAAGGCCCATTCAAAACCAGCAGCTGTGCACCTAACAGGCAGCTCTGGCTCTCCT
TCAACCCCACCTGACTTCATTTCGACTCCTTTTTGTCTTCCCACCCTATTTTTCCCTTTT
ACCTCCTCAGTAAGTGCAGCCCTGCAGGACACTGGGACCTCAGGCGTGCTCAGATTGCTA
AGTGTAAAACTGACAGTGTAAGAGATGACCAGGTCTCTGTTCCCATGGGCTCTGAAGCTT
GATTTTCTTGTATTAGTTTCCAGTGGCGCAAACATGGCAGCATTTTCTCTTGGATTCCAA
ATCTGGTCTCTTTGATTTTCTGGGCCAGTTTCTAAGCCAAATGACCTTTTCTAGTAAAGG
CTTCATCCTCAGTAATTCTTTACCCCAAATCTTTATGAAAATTAAGTGGGATGTTTTTAG
TTACTTCTGCATGAGTACCTTTAGCCTAGCAGTGAACCCAAAGATTTTGAGTATAAATAC
TTAATTATGAGGAACTTGGTTATCTTTGTTTTTCATCCCCATCTCCCCTTAAGACAGTTT
CTCTGCGTAGCTCTAGTTGTCCTGGAACTCATTCTGTAAAGCAGGCTGTCCTCAAGGTCA
GAAATCTGCCTGCCTCTGCCTCCCAAGTACTGGAATTAAAGGTGTATGCCCCGCCACCAC
CCAGCTTTAGTTAGGGCATTCTTGCTAGCTTTCTTCTAGGAATATGTATCTTCAAAGGAG
ATGTTGATCTGACTATACATCTAACAGTGTATAAAAGTCCTGAACCTCATCCAGCTGTCT
TATTGCAGTAGAGTCATACACTATCTCAGGGGAAAGGAGCTTTCCATGTGGTTATTTTCC
CACTAGATAAAAATGTTAGATGGTCTTAGGCTGGACATACCTTTAATCCCAGCACTCAGG
ACAGCCTGGTCTACACAGAGAAATCCTGTCTTGAAAAAACAAATTAAAAAACCTTACATG
GTTTTAATGATCCTGTAATAAGACTGTACACAGTTTAGTGCTTAACTGCTGAAAAATGAA
ATCTCAAAACTTGTTTAATCTTTAAATCACTAGAATTGTTGGGGCTAGAAAAATGGCCCA
GTAGATAAGAGTGCTTGCCCACATGGCAATCAGAACCATCTCTAAATCCAGTTCCGAAGA
TGACGCCCTCTTGTGGCCTCTGCAAGTACGAAAACAAGCAGGACATCGTATATACATATA
AGTAAAAAATAAAATCTAAAAAAACGGGTTGGGGCTTTAGCTCAGTGGTAGAGCGCTTGC
CTAACAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGGAAAAAAAAAAATCTAAAAAA
ACTAGACTGATCCTGTTTTTTTTAAAACTTGCTTTGCTTTTAATGTTTGGCCGTGATTTG
GAAAACAAAGACAAATCATCCTTCAAATATTTATAATCTCAGAACCAAGCATCATAGCAC
ACACTTGCAATTCAGAAGGCAAAAACAAGAGCGCCTCCGCAAGGTCAAGACCAGTTAGGG
CTATATATTTTTGGTTATGAGCCTCGCCTTTAACGGCTGAGCCATCTCTCCAGCCCCAGT
TAGGGCTATATAGAAGACCTTGGCTCCAAAACACAAAAGCTTATAATCTAACTAGGCACC
CAGAAGCACCTAGAAAGTTGAGTGAACAGATCACTGCAAGGCCTTTCAGAACATAGCAGT
GGCAGCAGGTGGCCCGGGTGTCTAGGGAAGAGTTCACAGTTTGTAAACTTGAGCAGATAC
CACTGCTTTTCTCTTCAAGGGAAGGAGCAAAAACCTGACCATTGTAAAGCAGACCTGAGC
GTGTGCTGGCTCCTCTCGTTTCCCGTGGGCACAGCCCACACTGGCCTCTCTGACTCTGTT
TTCAGGCCAGCTGCTTCCTTGTTTTCTTGTGAGCATCCTTAGATTTTCTTGGTTATTTTT
CAGGCTCAAGGCATAAGTAATCAGGACAGCCAGTTGGGCATTAGAGACTAGTCACACTCA
GTGCCTTCTGCTCTCAGAAAAGACAGGAGGTGTGTTTGCTTGGGAGCCCGGAGTCAGATT
GGGCAGTCTTCTGCTCCTTGTTTCAGCATTGACTTCTGTATGCCATCTTGCCAGTTTCCT
CCTCAAGAGTCACTAATGGCCTGAGTCTTAAATTTGTTACGTGTACTAGTGAGGTGATTG
ACATACTGAGAGAGAAAGAAGCACACACCTCAAGTTTCAACTGCATTTCTTGGTCTGGTC
TGTCTTCTCTATTAGACCCTCTTTCTTGTTAAGATTTGGAAACTTTCTATGTCAAGGATG
GAATAACTTACTTTTTCTGTCTTCCACCTCCTACTCACTAATTGTGATTAAAAAGTATTT
CAAAATAGCCTTTCCAGCAATTGGCTAGAGATTCTCAGCAACCAATCCTGCCCACCTCTG
TAAGTTCTAACCCCAAAGCATAACCACTCCTTTCTCTCCATTTTGGCTCTTTGGATACTG
GCACAATCTGAGCACCCTTGCCTGGCACTCTCATTCCCACCCATCTCTGAATCTCCCCAC
ACCCCATTCAGTGGCTCACTCCTGTTGCTGTGCACACGCGTGCTTTCTTGGACCCTCTTT
GTCTTCTCCATCGCCCCCTCCTGGCAGCTGCCAAGATTGCCTGCTTACCTGCCCTATGGT
TTTCTCTCAAACAAACCAATATAAAATGATCCTCAAGCTTTGGGGAAGGGAGGGAGTTCC
TTCCCAACAATCAACTCCTCTACCTTTGTGTACATTGTTTTATTGTTTCTTTTGTTGCTT
CTGTCTCTGGCCAAGGAAGTTAATTAATTCCTTGATCTTGATCAGGTTATACACTCTCAC
CATACTGACCATCCCCCTGGGAAATAGAGTTCTAGACTGGTATTTCCCTCCCCTCCTCCT
GTTACTTCAGAATGACCAGTGCTCATTACCTCACTGTCCATCTTACTCTATACACATCTA
TACCTGTCTTGGTTGGGGTTTCCATGGCTATGAAGGGACACCATGACCTTGGCATCTCTC
ATAAAGGAAAACAGTTAATCAAGGCTGGCTTCTAGTTTTAGAGGTATCGTTCATTATCAT
GTCAGGAAGCATGTTTAACATGCAGGTAGACATGGTGCTAGAGAAAGAGCTAAGAGTTCT
ACATGTTGATTGGCAGGCAGCAGGGGCTTGGGGGACTGTGTCTCACTGAGCATAGTTTGA
CCATATATAACCTCAAAGCCTGCCTTCACAGTGTCACCCTTCCTTCAGCAATGCCACACC
TGTCCCAACAAGGCCACACCCCCTAATAATGCCACTCTCTATGGGCCAAGCATTCAGACA
CATGAGTCTATGAGGACCAAACCTATTCAAACCACCATGCTACCTTTTTCATTTTTTCTC
TTTTCTTTCTTTCTTTTTGAGACAAGATCATTCCCTGGTAGTCTACTTGCCAGGTAGACT
AGATTGGCTGTTCAGGAAACCCAGGTATCCTCCAATCTCTGTCTCCAGATCACAGCTATA
TTTTAGCCAAGCATTTGCTGCTTTTTTTTTTTTTTTTTTTTTTTTTTGTGGAGCTGAGGA
CTGAACCCAGGGCCTTGCGCTTGCTAGGTAAGCGCTCTACCACTGAGCTAAATCCCCAAC
CACATTGCTGTTCTATTTGGGAATTGACCCTCAACTACCTTTGGAGAAATATGCCTTATC
TTATGTCTGTTATTAGCATTCAAGGCTGAATTTTAGGTAAAAATGTTTATTTTTAAAGTT
TTGCCCAGAACTGTCTGACTAGACCAGACAAATGTGTCTCAGCCCCACCGATAGACGACT
CTGCTGGAAATCGGATTTAGAACTACTGTGTGCGACCCTGCGAGATGGCACTGCAGTTGA
GTGACAGCAGTGCTTGCTCAGACCTGCAGTGGCTCTGCTGGGTTGGGACTGGGCCTCAGC
AGCTCTGTACTGATCCTCGTGCTTTATTTTCATTGCAGATTTGTCCCATATGTGCAGCGT
TACCTGGAGGCGATCCTAATCATGTCACAGATGACTTTGCAGCTCATCTGACACTTGAAC
ACAGAGCCCCTAGAGATTTAATATCCTTCCAGGAGGGTTTGCTGGTGGTATTGGTGCTTT
GATTGTTGTTGAGAATAGTAGTCTCCAGGAAAGACTAATCTCTAAGTTATTTTGTTTGTT
TGACCTTTTCATAAAAGTGACTGTTGTTTGTAGACTCATTGTGCTGCCTTCAGGTTATAA
ATTGCCTCCTCAGTCTCTCATCCTTTAGGTTTCTGTTCATATGAAAGTTTAGGTCAAGTC
AAAGTTACTCAACCTTTCTGTCTGCCAGACTTTACTCATGTTCTGTAATCCAAACTAGAC
CTGTTGTGGAGCAAAGTGGTAGTGGTCGGTCTGTAGCTCTAGTCTTTCATCACAGCCCTG
CTTTCCTCACTGGAGACACAGACTGAGGCAAGGTGGAAATTACTGGAAAAGTGAAGAAAA
TGGAATAAACCTGGGAAATTAATGCCCGGGGGACTAACAGGCCTCAGACTCACAGATCCA
CCGCCTCTGTGCTGGGATTAAAGGTATGTGTCCCCTACACCCAGCTGGGGGGGGTTGTTT
TTGGTTTGTTTTTTGTTTTTTGTTTTTCTTTTTAATTAGGTCTGGAGAAGTGACTCAGTG
GTAAAAAGCTCAGCTGCTCTCTAGAGGACCCAGGTTCCATTCCGAGCACTCACGTGGGAG
CTCACAACCATCTGTCACTCCAGTTCTAGGGGATCTGACGCCTTTCTTGAGCTGTGGCTA
AGACCACATATACCCATGATCCATGTAGTCAAAATACCCATACACATAAAATTTAAAAAA
TTTAAGATGGAAAAAATCAAGTGGGCTAAGAATAAACACCTAGGTCTTTTGAATAACTAT
GCACTTCCTGGGGGAAGCTACAAATGCTGACCTGAACTTTTTTCTTCACAAATTCCAACA
CTTGTGATGCTAACAGTGTGTGCATTCAATAAAGACTGACCCCCTCATCTGAACCCATTT
TGTAAGCCTTCTACAAATGTCTTTGGTTAGTAAGGAAAAGATTAAATTTTGAAAAGTACA
GGAATATGAAAGGTATTTTACATATTTTTATTTACTTATTTTCTACCAAACTTTAAAACA
CAGAATGCTACATTAGCAGATACATGAAAGGATGTGGAGCTTTCAGATACCTGTGGTATC
ATAATGTACTGATGGTGTTGGGACCAGTGTCTAGTGTATGCCTGTGGGCAGCAGTTGATG
GATGTCTCCTAACAGTGCCCTCTCACCCAGCCACTTCTTAAGAACAACACGTGCCAATAA
CCTGCAGAGCCCAGAGTCTCATCCTAAACACCACAGTGAGACCCTGCATATAGAAGTGAC
TTATGCGGGGCTCCTCACCCTGTCTTTAGTTATTCCAGAACTACCAGCCATAACCAAAAT
CAACAGGGGACTGCTATCAGCTGCTTGCCTCTGTGGAAATACAAGGTTAACTTCAACGGC
TGGTTGGTTGGTCAGTTGGTCCTTATTTCTTATCTTTATGATTTAGGTGGCTAATTGCTG
CACAAGACCTTGCTCAGTTTGGTTCACATTCAATCCTGAGAAGAATAAGGCTTCTAGCAA
TCTGCTTGAAGCATGTTAGATTAATGTGTATCCAGTGATACAGCAATTCAGGTATATTCT
GTTTAGCAACAGAGCTGGGAATAAAAGTTGAAGACAGAAATTAAAGCGGACATTGAAACA
AGCCACATTTACAGAATTTAGATTATTCAGCTTGCTCCTTTTCATTGTAGAGACTGAGTG
TCTTATTTCTTGATACATAAAATCCAGTGTTAAGAGCACCATAGATCTGTGACCAGGCAG
CTCTTTTGACCTCGCTCTGGCAGTGTTCAGGTCTAGAACCTGGAAGAAAGTTCTTGGCCT
TCAGAACATATAGAATCTATACATTGCTTTTGTATTATATGTATGTATTGTATGATTGTA
TTTATCTGGTTTTTTTGAGTCTGGCCTCAAACTCCATTGTTTTCCTGTCTTTGCCTCTGA
GTTAGGATTACAGGCATGCATCGATTCAGGATTACATCATGCCTAGCTTATGTCTGTTGT
TTCATGTTATCTTTTTTAGGATAAACGAGCCTCATAGAGTTGTGACATTTATATTCTAAG
CTAAAAGTACTATTTTAAGCTGCTCACAATTTAGGACTTCCCAACAACTTTCATTTTGTT
TTTTCTTCTTTTTGTAAACTACTTATCCTTTCCTTAACCTTGAGTTATGATGAATCGAGT
GGTGTTCGACATGTACGTAGAATGTTTCACCCTGGTCGGGGGTTAGGAGGCCCTCGTGCT
CGTAGATCAAACATGCACTTTACTAGCAGTTCTACTGGTGGACTCTCTTCTTCTCAGAGT
TCATACTCTCCAAGCAGTAGGGAAGCCATGGATCCTATAGCTGGTAAGTTTGTTTCCACT
TCTTAAAGGCAAGGGCAGAGGTTGGGGAGCTCCTTTAAAGATGGTTTGTGTAGTTTATGT
TTTACTTTTGCTTCTAGTCCTGTGCGTGGATTCCTTCAAGTTTAAGTGGACATCATAAAG
TAATCCATGTACTACTGCATTTCTCAAAGGCATTAGGGGATAAGATAACACAGAGGAAGG
GCTTTAGGAAAGATTTCAGAGTCCTTAGAATCCTGTGATTCCACCTTAAGGACTTAGGCA
CTCAGTAAGTTCTTGGGAGGAAAGTAGGAATGTGTCCCTCCTCACCATGATTAAGAACAT
AGTGATTATTGAACATACTGAAGGAGGATGTTACAATACCTTGAACAACTCCACTAAAAC
AAGAGTATGGGTTTTACCAGGCCAGAGTCAAGCGCTACAGTGGAGAGGAGGCAGAAGCCA
GAATACAAGAACCACATTTATAAACGCTCCAGACTCTGAGGTTTCATCCTGCTAACTCCT
CTGATCAAATGAGCAGAGATTTATGAGTGCTGATACCATCATGCCAGGCCCTGATCCAAG
AACTGGGAGTAAAGAGTAGACTTTCATGCTTTCATGGTGTTTCCCTTAACAGTTCTTGAT
TATGATTGGACCTGCTCTTGAGTCTAAATAGTTTTTGGGTTTTTTTTTTTGTTTTTTTGT
TTTTTGTTTTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGTTGGGTTTTTTTTTTTTT
TCCGGAGCTGGGAACTGAACCCAGGGCCTTGCGCTTGCTAGGCAAGCGCTCTACCACTGA
GCTAAATCCCCAACCCTGAGTCTAAATAGTTTTTAAAGCCACCTTTTAAGTTCTGTCTGA
AGCAGGCTTAGTTTTATGTAGGTTCACATAGGTGTTGGGTCCTTGGCAGAACTTGGAATA
TGTTGCGTGAACTTGCATTGTTTCACAACACTTCGATTTTCTCCACTGACAAAATGGTAA
CGAAGCACTAAGTTTCCCTGTGTCAAGTTGATTGATTATATGCGTTTCCATTGGCAGAGC
TGTTATCTCAGTTATCAGGAGTGAGACGTTCTGCAGGAGGACAGCTTAACTCTTCAGGCC
CTTCCGCTTCTCAGTTGCAACAACTGCAGATGCAGCTGCAGCTTGAGCGGCAGCATGCGC
AGGCGGCCCGGCAACAACTGGAGACTGCTCGCAACGCAAGTCGGCGCACTAACACAAGCA
GCGTCACCACTACGATCACACAGGCCACGGCCACAGCCAACACAGCCAACACAGAGAACA
GCCCGCAGGCCCTCCACAACTCCCAGTTCCTGTTAACAAGGTATTTCATTGACTAGTGTG
GCTGGGCTGGAGAGAGGATGTTTTGTTGACACTGTCCAGTCTAATGAGCTCTTTCCTTTT
GTGTGTATAACTTCATGAAAAACTGTCTTGGATTAAAGCATTACAGCTCTCCAATTAAAA
TACATATTTAATATTCCCCTAGGAACACAAAAACTTACTGTTTCAGATAAAGTAAATGTT
GGTGTTTGTGTTTACAAGGTATTACGGGGTGAGTGTGTGTGTGTGTGTGTGTGTATATCA
TCGTTAAAAATATTTTTCTTTGTTAATTAAACTTTGGGACATTGAAATTGGCTGAGGGAA
ATAAACTGAATAGAGAATATTACTCTATTCATATACTTCTAGGCTACATAAACAAATACA
ATAAAATTTTTAAAAGTTATTAAAAAGAAAAACTTTAAAAAATATTTTCTTTCCCATACT
ACACATAACACTTAAAATGCTGTATCATTTCACTTATATTTATACACCTTTATTAGCTAA
TTTATTTAATAATGTCTGTTCTAATCTTCCATTAAAGTCTGCTGAAACATTAGAACAGAA
GAGGGCTTAATGGAGATGGTGCAGTGGGTAGTGTTCAGTGCATGAGGGCCTGAGTTCAGA
TCCTCACACCTAAGTAAAGAGTATTCTGTTGTTCCAGCCCTAAGAGTGCCCACCTCTAGC
CTTCAGAAATACGAACAGGTACACATACCTGTGTCTACACATGTGCACATGCATGTACCA
CAAGTATAGATATATAGAAGAACAAACGCTTTCATAATATGGGGGAGGGAGGAGTATATG
TGATTTCCCAAAATTAGATTTAAATTCTTAGGATTGTTACCCAAAAGTAACTTTAGAAAA
TGGCTTACCATGGTATCATTAATACTCATCACATATAGCAGACCATTTATTCCACTGGTG
GAAGTTTTCATGTATTTCTAAAACTACCTTGAGGGCTAGGAATGTAGTTCTGTTATAGAA
TGCTGACCTTACATACACAATGATGCGCAGTCTCTAATCCTCGCACTTGGCTTGTAATGT
CAGCACTGAGAAAAATCAAGGATATCCTCCCACATTATGAGTTTGTGGCCAGCCTGAGAC
ACATGAGACCCTATCAAAGGGGCTGAAGAAGTAGCTCAGAACTTGGAGCCTTGCTGTTTT
TCCCTGAGGAGACCTGGCTTCAGTTCCCAGCACCTAGATGGCAGCTCACAGACTGTCCAG
TGACCTGACTTCAGAGGTTCTGGCAGCCTCTGCTGGCCCCTTCAGGTACCAGGCGTGCAC
AGATGCACATGCACACATGCCAGCAGACACTCATTCACATACAGAAGTCTTTAAAAAGAG
TAACACGAGGGCGGGAGAGCTGGCTAGCAGTTTAGAGCACTGACTGCTCTTCTAGAGGTC
CTGAGTTCAATTCCCGGCAACCACATGGTGGCTCACAACCATCTGTAATGGAATCTGATG
CCCTCTTCTGGTGTGTCTGAAGACAGCGACAGTGTAGTCACATACATGAAATAAATAAAT
AATTTTTTTTTAAAATAATAACATGAAAATTGGTCTGTGAAATAGTTAACTTGGGCTCGG
GAATGTAGCTCAGTTGGAATAGTACTTGCCTAGCATGCACAGAGCCCTGGGATGAGTCTC
CAGCATTAAATGCCAGCCATGGTGCTTCCCTGTAATCCCAACACTTGAAGAAGGGAGGAA
GATCAGGAGTTCAGGATCATCCTTGCCTACATAAAGAATCATCCCTGATGATTCTTTGGG
ACTGTACAAGAAACTGTAATTCCTCCTCCTTTCTTCTTGCACTTAAATCCCACAGTGCAG
TAGTACAGGTGCATAGACAGAAGTAGAGTGCATAGTGGAGTGCTTAGGTAGGCATAGAAT
GAAAACACTCAAACAAGAACCCCTTTCCCCTTAGAAAAGTCATTTCCTATCTTTAGTTTT
ATCATCAGTATCCTACCCAGGAATCCTGCCAGTGTATGAAAGAAGATTATCAAAAATACC
GATCATTGTCATTTATTGTGAATTTAAGGAGGCATTTTGCACAGAGTGGTTTATCTTTGC
AGTAGCCTTCATGAGGCGAGTGAGTGCCACCAGGCAGAGTGGTTCAGTGTAAGCTGCAGA
AGGCTCTGCCTGATGCGGTCATCACCTTCTACCGAGACTGAGCAGCAGCAGTGCCTTTTG
GAATCTGAGCACTCACCTGAAACCACGAGCCAGTGTATGTCTTCCTGAAAGTTGGCTGCA
CTATGGGTGGAATATCTTGCCAGGAAAAAGACATCTTTCCAGCCAGGCAAGGAGTTTCAT
GTTTTTAATCCCAGCATTCAGGAGGCTGAATGTAGAGAAAATCCCTTAAGTACCGTGTGG
AAGAATCAGCAGTCAATAAAACTGATGGCTTATTAGCTGACATCTGGCAGAGAGAGAGGA
TTCTGGGAAGAGTTAAGAGTAGGAGAGTCACCCCATATTCTGAAGATGCATGGAACTGAG
GAGAGGTAAACAACTGTGTGACACAGACTAGAACAAACGGGCTATATAAGGTATGAGCTC
GTTGGAGAATGAGCCAAAGCCTATGGCCTAGGCGTTTATTTTATAGGCATATATATATAA
TTCTCAGTCATTATTTCTGGGAACAAAGGACAGCTGAAGCCAGAGTTCAGGGCCACCCTA
TGGCATGTACTGCAAGATTGTGCATCAGGAAAAGGTCAAAAAGAGCTGGCATGGTGGCCC
ACACCTTTAATCCCAGTACTCAGGAGGCAAAAGCAAGTAGATCTCTGAGTTTAAGGCCAG
CCTGGTCTACAAAGGGAGTTGTCAAGGAGCTGGAGAGATGGTTCAGTGGTTAAGAACATC
TGCTGATCTTGCAGAGAACCAGAGTGTGATTTCCAGCAACTTTATCAGGAGACTTAAAAG
TGCCCGTGAATCCAGTTCCGTGGTACCCAGTTTTCTCATATGGCCACCATAGACACCTGT
ACTCGTGTGCATGTAACTACGTACATGTAATTTTTTAAAAAGTCGAAAAGACATTACTGT
ATATTTTTGTTTGTGTTGTATATCTTTTTAAATCCCAAACTACTTGGTAAAGTTAATATG
ATATTTCATTTCCTGTGTATGTAAAAAAAGATTTTTTAAAAATTACCAGCGCATAGTATG
TGCTATCTCTTGGTGCTGTCCGTGATCGCACGCACGCTGTCCTGGAAGGACGGCTGTCTC
CTGCAGCTGTGGAGTAGATGCGTGATGGCCTGTGGTCCACATTCCTTCTTCTCATACCTT
TCCCTTCCAAAGCCTCATATGTAACTAGGCTGGCCTCGAACTCATCCTCCTGCCTCAGCT
TTCAGCAATGGGGCATGGTAAAATATGCCTGAAATCCTTGTAATTCTCCACGTGGAGGTG
GGAAGATGAGAATCCTAGGTCACAGAGTAGTTAAAGACCGGTATCAAGCTTACTTGTTTG
GGGCTCCTTGGAACTTCAACTATACTAGCATACATTATAAACTTGGAACAAGCAACTGCC
GTGTCAGCGGGGGAGGGGAGGGGGCACTTTCTGCTGTGCAGGAGTACTCTTTGTGACGTG
TTCATCTTATCCCGGAGCTGACTGTAAGGACATAGTTATGTCCAGGGAGGTCAAAGATAG
TTGACATGTTAAGTGTTAAGTCAGAGTTCTGTCTTTTGGTAATAGACAGCTAGTTTGAAG
ATCTTTAGCTTAGCAGCTCTCTTTGGGTCTCTACCAAAACTGACTTGCCAAAATATTGAG
CCCTAGCGCCACATTCATCTTCCCCTCAAGCATTAGACACTCTCTTAGCTAGTTCCCTTA
AAGTTAGAGCAGTATTGAATTCTAGTGCCTCCCAGGAGCGAAGACCCCTTCTTGAGTGTC
TCTGACACGTTCATCTGACACGGTGATTAGTCTTCTATCCACCCTGTATCTGAGTTGACT
TCTAGGTCCCTCTCCCAGCATTGACCAAAGGCCTTTTCCAGAGCTGAGAACTTCGTGATT
GTTGGGAATATGTACCTATGACTCAGCCTCCAGTCACTTAGTGTTCTCATGACACGTTCT
TAAAATGCTCTTAACCATGGGTGGGACAGGCCATCTCAGTGCAGCCATAGTGGCGTTTGA
TGAACTAACTGCCCACATGCTTTGGCCCCCTTTGAGTTCTGTAGTTAGCTCTTACCTTAT
CAAGGCCGCAGAGCTCATCACTATGGTGGTTCTTAACTGAGACTTTGAGCAAGTTAGCTG
AGCTCTGCCTGAGTTTCCTCTTCCTTTAAAACGGCAAACCCCAGCTGCTGGGGCCAGAAT
GATGCGCGCAGAACAGAGTCAAGCCTGTTGTTAGTCACAGCCCGTGTTTCGCCTGCGCTC
TGGGGTGCCCTAGCCAGACAGCAGGCGCAGGGGGCAGTGAGTGAGCTGCCCGGAGGTCTG
TGTTAAGCTTGCCCGTGTTCTTGGGAAGAGTGCCCCTGCACTTTCCTGACCCAGTGCTGC
AGCTGCTTGCTTTTCTCACCACTACAAATAGAGAAATAAAATCAGTGCTGACGCTGAGCA
CAAGCTCCCGTAGTTTGGGGTTTGTTCTTTAGTGGAAAGACCTGAGCCATTTTAGCACGT
TGGTAACAATAGAATAATAGTAAGTAATGACCAGCAGTGAGTCGACCTCCTGGCTTCCGG
GTTCTGGGCTTAAAGGCATGCTCACACCACCACACCTGGCTCAGTTTTCAACTTTTAACA
TCCGTCCATGTTCCCTAGGGACGAACCTTGGCTTCATTGCCATCCTCTGGGAACTTGGTG
AGCTGATGAGGTGACATAATCAACCCAGCAGTCTGATGTCAACCCCCAGGACCCACATGA
AGGAGGAAGAAAAGAAACAGCCCCACAAACTTGAACGACTGTATACATTACTGTGGCACA
CACACATTTAAAACAAGAAAGCAAGCTAGGCATGGCGATGCTGGAAAGTCAGAGGTAGAC
GGATGGATCGCTAAGAGTTCTAGGTCAGGTTTCCTGATCTACATATCAAATTGCAGGCCA
CCCAACAAGACCCTGGCCAAAAAAGTGGGGAAGAATAAAAGAAAATGGCCTGGCATGTGC
TTCCTTGAGTTTTTGTGCATAGCTTTATTTCAGAGAGTAAAATGGAAAGTGAAAAGTCCT
CAGTGCTTAGGACTCAGTGCTGGAGCCGCACTCTTAGCGCTGGAGTGAGCCACGAGCAGG
ACCACCGTGACTGACCGCCGGCACGGAAATCCTGCTTGGGGAATTCTTCTTCCCAAGCAT
CCATCCATCAGCAGTCTCTTGCTTGCTTTGTTTTGTGTTTTGGTTTTTTCAGAGGAATTT
CCACCAGGGTTTTCTCCAAAGCTAGTCTAGACGGTCTACATGGCTTAGTTTCCGTGTTTG
CCTGTTTGGGTTTTTTCTTCTCACTGCATCTGCTGAACTCTGGTCTGCACACGGTGTGGG
GATTTATCTGAACTAAGGTGTCGGTCGCCAAACAAAGCATCCCACACAGGCTGTAGAGCT
CGCCTCACTGTTTGTTCCTGATGGACTTGTTACTAAGAAGGTCTTTCCTTTCTTACCTGT
GCAGGTTGAATGATCCCAAAATGTCTGAAGCAGAGCGCCAGTCCATGGAAAGCGAGCGTG
CAGACCGCAGCCTGTTTGTCCAGGAGCTCCTTCTGTCTACGTTGGTGCGTGAAGAGAGCT
CGTCCTCAGACGAGGATGAACGGGGGGAGATGGCAGATTTTGGTGCTATGGGCTGTGTAG
ATATTATGCCTTTAGATGTCGCTTTAGAAAACCTAAATTTAAAAGAGAGTAATAAAGGAA
ATGAGCCTCCACCACCTCCTCTTTGATGACCTCCCCACTCGCAGACAATGTCCTCTGTGC
TGTATTTGCCAATGAAAGTGGACAACAGCTATCCTGGGTTTGTGTGGTGATTGTAATTTC
AGGTCTGTCACTCTTGTTACATTGTGTACATTCAAAAGGAAGAGAGAAATATATATGATA
ATCATTTCCACTTAACTAATTTTTACTTCTAGCAGGTAAATGTAGGTAGCAGTGCAGGGT
GATCTCTGCTTCCTGTACCTTGACATGCAAAAGGCTCTCCTAATACTCCACATTCAAACT
GAAGAGGAAATTGAAATCTCTAATGAAGCTGCTGTGTGTATTTATGAATATTAATGAATA
AAAACTGCTTGGATGGTTTACCTAACTACTGCATGAGGTTTTTTGCAGCGTGCATGAGTT
TCAGTGGCCTTGTTATTTAAAAATTAAATACAAGGAGTAAAACTTTCAAAAATAAAATTG
AAAAATAAAAATAAAATACAAAGCCCAAAGCTTTCCCAACGTTATTCAACGGTTACTGGG
CGAGTGGCTTCCCAATAGTGTCTGCCTGACTCACCCTCATAGCTGTGCCTCCGCACAGAG
CCAGCTCTGCAGTGGAACCTGGGGGTCCTAGCCAGGTATGGCTCTCCACTGTATGACTGT
CCTGTCGCCTGTTAACCAGAGTCCAGCCTGTCTCTGACTCGTCACTAGAAAACACACCAG
TGAAGACAGGGTCTCTGCAGGGCGACTGTGTGCCCTCTAGACAAATCCTGTTTGTGTTGG
TTGGAAGTGTTTACTTTTTGTGGTGGTTTAAATCTTTTTGATTGTTAAGCATGTTCGTTC
AGGTATAGATGGATTTCATTCACTCACTGTTCAGCGAGGTTAACCTGAATTACGTTGTCT
TGCTTTTGAAGATCTCTCGTTCTCAATCATACTTTGTGCTGTTTATGTATCTGTGGTTTG
CTGAGACAGATTAGTGTCAGGGGAGCCATGAGGGTTTGCATTCGCCTTCCCAGATCTCAT
CACCCAAATCTTAATGCTAATCTTAGCTCCTTTTATTTATTGGTTTTTTTTCTGGCATAA
AAAGTAAAGTCTTTTAATTGAATCATGCCACCTATATGCCTATGTTATTAATCCTGTGTG
TTTAAAAAAAACAGTAGCTCGCCTTGGGTCGTGGTGTGGAGGATGGGTGCTTCCTATCTG
CTTCCAGTTTCACACGAGCTCCAGGAAGGGGCAGTGGGACTGGAGCATGGAGCAGGTTTT
GGAATGTAATTTAGGACTTTTAAAAAAAGATTCGCAGCTTCTGATAAATTTCTGTGAGAC
TTAATCTAATCGTGTCTGGCTCCAGTCCTCTTCCCTGTGAGCCATTCTCTGTTGGCTC
  Untranslated Region
  Coding Sequence
  snoRNA
<1001..1170, 3978..4117, 14378..14479, 16668..16842, 17877..18159, 23704..24317
<1001..1170, 3978..4117, 14378..14479, 16668..16842, 17877..18159, 23704..23965
AC_000072.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved