Rattus_norvegicus Locus Tardbp
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Tardbp
Rattus_norvegicus
Tardbp
5
SNORA21
4156..4291
12046
GTTAGTTTCAATCCTGGCTAAAGAGTCTACAGCTGGGGCTTGGTGGTAGAGCTAGCCCT
CAGAGTTACACAGGACTTACAGAGTTAAACTAGGACTCGTCTACTGGAACCGAAATAAGG
AAACCTCCCAATATTTTCTGCTGTAGGATTCATCCTAGTGGGACCTCTTTCTCACGGATA
TTTCATGCAAGATACTTAATTCTGTGCCTCAGTTTCTTCCCTTGTTGAAAGAGGAGAGTA
TCAAGAATATCACACAGTCTGCCAGGGCAACATCAACACTCCGGAGCCTGACGATGGGGG
AGGAGGAGCCGTGACGAGTTAAAGGGTTACACAGTGACTTTGAGGTCCTTGTCTCTAAAA
CAGCATTTGGTGGCTAAGCCCAAGGTCAATGGTAGAACACTCGTTTGCCATTCACAAGAT
TCTGGGTTTTTTCCCCCTAGAGCCGGAGCGTGCTAAAGGGTACTTGGCACAAAGTAGTAC
CTAGGACAGGGACCATTTTGTAGACCAAAGTTAATGCTTCTATGTCGGAAATTAACAAGC
AAAGGCAGGAGACATCGAAGGCTAACCTTTAGACCTAAAACCCAGGGTACTCAGGGAGCC
CCACTAGCCCTTCGGCATCCAGCCGGCCCCTGGCTCCGCCCCTTCCCTCCTAGCCCCGCC
CATACGCTCCAGTCCCGGCCTACGCTAGTCTCGCGTATTTTCAGCGCGCGCGAGCTCTTC
AACTGGGGCCGGCGGTTGGTCGGGCGAAGCCATCTTCCACGTGACGTAGGGGGAACGTAA
AGCCTACGAGACCACACTGTTCTTCATTTTTCAGCATTTCGGATCTAGACCCTCTCACTC
CTGTATTATTTTCCTCTGTTCTGCACGCCGAAGGGCCTGCTAGTATCCGAGCCGCGTCGA
GGATAGAGCGTCTCTGGCGACTCTCGGAGAGCTCCCCTCCTGACAGGAAGCAATTGGGAG
AGGCCGAAGGCGGGCGAGGGCGGGAGGCGGCCCTAGCGCCATTTTGTGGGCACGAAGCGG
TAGCTCGGCTGTTGTTGGGTTCCTTTCCGTCTTCGATCCTTCGTTGTGCTTCCTAGCAGC
GGCCCAGTGGGTGAGTTGCTCGCCGAGGACGGCTTGCGTGCTTCGGGCGCTGCTTTGGGG
AGACCTGAGACGACCTGCACCGCTGGAAGGGAGCTATGGAGCGGGGCCTAGTTGGCCTCG
CGCCACCGCGTCGTTAGGGCCTAGCGCGGGCGGCAGCCGGAGCGGGGCGCCGGGCCTGCT
GGGCTGTGAAGCCGCGGGCGGAAGTCTGTCGCGGCCCCGGCGCCCCAGCAGTGCTAGTCC
TTAAAGGTTCTCGCATTTGAGAATTAACCGTTTTCACTATGGGACTTGGACCCACGCGGC
CCCACCCGGGGCCTAGTTGAAAGGGCGGGGGTGGGGGAGAAATCAACGTTGTCTGTCGCG
CATGGCCTTCTGGGAAGTGGCGGCCTACCTCAAGGAGTATCAGTCGTTGCTCCCTTGACG
CCCAAGTTTAGCCAGACCTTTCCGAAAATGAGGAATAGAACTGCGGGGTCTCTGTTCTGA
ACGTCGGTTTTCGTGCTCCACCGGCACGGTCAAGATTTAGCCAATTGAATGCATTGCTAA
TTTCTTACACTTAAAGCACGTGCTAAGCCCGATTTAGGCTCTCAGGCTTTAGAATTAATG
AAATGAGTTCAGAATAGTCGAAAAATACTGTAGACTGTAATCTGTGCACTCCAGGTAAGA
ACAGTGTTTGCCAGTGGGGAAAAAATGGGGACAGATACTTAGTTCTTAACACCTTGTTTT
TGTCTGGCTTTGTAACCAACAGGCCACATGGTAACACTGTTGCAACTTTAGCACCGGAAG
CATATAGTAAGGCNNNNNNNNNNNNNNNNNNNNACCTCACCCCCCCCCCCCCAGGGATGA
CGAAACATTTTTTGGTGGTGCTCTTTTCAGGAAATGGGAAAAAAATAAAGTGGTGTGATA
GTAACTAAGTATAAAAAAGATAATTGCTCTGATATTCTTGATCATTTCTTTTTCCTTTAA
GAGATTTAAGCAAAGATGTCTGAATATATTCGGGTAACAGAAGATGAGAATGATGAGCCC
ATTGAAATACCATCAGAAGACGATGGGACAGTGTTGCTGTCCACAGTTACAGCCCAGTTT
CCAGGGGCGTGTGGCCTGCGCTACCGGAATCCAGTGTCTCAGTGTATGAGAGGTGTCCGA
CTGGTGGAAGGAATTCTGCATGCCCCAGATGCTGGCTGGGGCAATCTGGTCTATGTTGTC
AACTATCCCAAAGGTTGGTTAATCACTTTGGTTTTGCCATATTACTGGCTATGGTTAGAT
ATGTATGCCATCCTAAGTGAGGCTATAATACCTGGGCATCCATGTTTGCTGGAGAATCCC
TGAGGGTTTGGCCTTCCTTGGAAGAATGTCCCCTAGGATCCTGCCCTTTTCACAAACTTT
GCTTAGACTAGTCTGGCAGGTCAGCAGTCTAAATAAGTGAAAATTGAAAAGCAGGATTCT
TTTTTGAGGAGCATCTATTTAAATGTTAAGCCATCAGAACATAGTCATTGCCAATTTTAG
GTGGTTAAAACTAAATGCCTTAAAGATCTGTTTTGTAAAAGAATTTGGCTTAGCCAGTTT
TCCTCGAGGCTTTTTTCTTTTTAAGACATATGTGAGCACAGTCTCTGTCTTCACACACCA
GAAGAGGGCATGGGAGCCTATTACAGATGGTTTGAGCCACCATGTGGTTGCTAGGAATTA
AACTCAAGACCTCTAAAAGAGCAGTCAATGTTAACAGCTGAGCTATCCCTCCAGTTCCTC
TCCCCCCCCCCCCCCCCCGACCCAGGGGGACCAAACCCAGGGCCTTGTGCTTCCTAGGCA
AGCGCTCTATCACTGAGCTAAATCCCCAACCCCTCTTTTTTGGTTTCTTAAAACAGGATT
TCTCCATGGTTAAACTTGATAGCTAAGGTTGACCTTGAACTCAGATCTGCCAAGTGCTGG
GTTTAAAGATGTCACCACTGCCTGGCTTTTTCTTGCAGCTGTCTCATCTTTGTCTCATCA
TTTTAAGATTTATGTTTATTAACATTGTGTTGTATGTGCACCTTGGCACTCTGTACCTGA
TACAGAATGACATCCGACCTTCTGAAGCTAAAGCTGTATGGTTGTGAGCTACTGTGTGGG
TGCTGACATCCAAACCCTGATCCTCAGAAGAGCAACAGCACCAGTGTTCTTTTTTTTTTT
TTTTTTCTTTTCTTTTTTTCCCGGAGCGGGGGACCGAACCGAACCCAGGGCCTTGCGGTT
ACTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCAGCATCAGTGTTCTTAATC
TCTTTTTTTCCCTCCTCAAAAAATATCAGTTGCACTAGCCCAAATTTTGAGTTCCTACAG
AACTAAAGATTTTCTCTGTTTCTTACTACTGATATTCTTGAAAGTATGAGAAAACTGGGT
CTGGTGGTGTACATCTTTGATTCCAGCATTCAAGGGGGCAGAGAGACAAGTGGATCTCAG
AAATTGAGGACAGCCAGGACTACAAAAGAGACCCTGTGTTGGGGTTGGGATATGAATGCA
TGTGAGTTAGTAAATGGTTATTTTTACTATGGTGGTACTGTAACAGTCCTTCCTGTACCT
GTAATCCCAACATTTGGGGCTAAAACAAGGATTGTGGATTTGAGGCCAGGCTGGGGTATG
GAATGAGTTCAAGACCCGACTGATTTGTATATAGCGGGGAACCAAGGCAGCCCACCAAGT
TTGGCCAATATGCAAAGACTGATGTATTTCTAAGAAATTCGGGAACATTTAAAGATGGGA
TCTTGTTTAGGCTGGGAAAAACTTGGATTTTGCAATGTGCAAATTAAGTCATTGGTTGTG
TAGCTCAGTGTTTACCCTGAATTAAAAGGGTACTGGTGTAGGTTGGGAGTGTTGGCACAT
ACTTGAAATTAAAAATCAGAAAGCTCAGGTAAGAGGACTATGGTGGCTATAAAGTTGAGG
TACTATGTTGAAATGAACAGGGGCTGAAGGTTAGAGCTCAGTGGTAGATTGCTTTGTAGA
GAATCTTGTGTATTGTATGGATGCAGCGCCCATCAATTAAAGCTGATTGGCCTGTAGCTA
AGACAGGAAACAGAGTCCCCTTTTAAAAGCACTCCGTGGGCCTTTTGCTAATGACCTGCT
GAGCCGTCAAGAAGGGGCAGAGTTAAAACACCACTTTTGGGTGAAGTGGCAACTTGTTGT
GTTGTTTAACTTCAATCAGTGATGTGACAAGATACAAAAAAAAAAAGGACAGGAAATAGA
AAGTGCAGCATCCAATAGGGAAAAGGATTGGGGGCAGGGGTGGTAGAGAAGGCATGAGAG
GGTTGGGCGCCCACAAACAGGAAGGAAAAGACTGAGCATGGCGCATGAGCAGAGGTGACC
TGCCATGTGTGGCAGAATTTAGAACAAACAGTATTGTTAAGTTATAAACCAATCAGGGAA
CAGCCAAAGCTTATGGCCAAGGCATTTGTAATAATATTTTAAGTCTGAAGATAGTCCAGG
AACTCAACTTCTACAGTGGCTTCCCTGGCATGTAGTTTGAGATAACATACTCCTGTAATA
ATCAGGGGGATGAAGAGGGGATTCTTTGACCAGTTTTGTTGGTGTAATGAGACCCCCATC
TCCATTAAAAAAGCAAATGTCATTTAATTCTTTAACCTGAGATCTAGGCCTGGGATCTCA
TTTTGTTATTTTTACTACAAAATTTCTATTGCTGAAAGATTGGAGAGCACAGAAAACAGT
TTACATGTAGAAAGACATGTTTCCTTTTTTAATTTAAAGATTTATATGAGTATACACATG
TGCATCAGAAGAGGGTTGTGATCCCTTAGTTATATATTTTAATACCACAAAATTAAATGT
TCTTATTTTGATACAGCTTTTGAGAAAGATACCATGCATGATTACAGTCTTGCATAATTT
CAAAACCTGATTTAGTAAAAACACTTGCAGAGCAAACCTGGCAACCTTATTAGCTCTGAA
ACCCACATAAAAGACAGTCACGGTGCTATTAGAGGCTCACGAGCCAGCCAGCCAAGGGAA
GGGTGCGAGGTACCAGGAACAACAGCAGGCCCTGCTTCACCAGACAGAAGGCGAGAATCT
GCTTACAGATGTCCTCTCCTACACTGACACATTCCACTATGTATGCAGAATCAGTTCTCG
GTAAAAGATGCAAAATTCGATTGGGAGTACCGCCCATTTGTGCCAGAAAATCACTCTGCC
ATTTGAGCTACATTCAGTCCTTAGAGGCTTACTGAAGTTTCCAGTGTCTTCACTGCTCAT
AGGTTGAAGTGGAAGTACTCTTTTGTTGTTGAGATGGAAGACAGGGTTTCTTTGTGTTGC
TTTGGCTGTCCTGCAACTTATTCCATAAGCATAGGGCTGAGCTTGAACTCTCAGATCCAC
CTGCCTCTGCCTCCTGAGCACTGGGATTAAAGTCCTGCTAAACACAATTTGTGTTTATGT
TTTGCTTTGTTTAGATAACAAAAGGAAAATGGATGAGGCGGATGCTTCCTCTGCAGTGAA
AGTGAAAAGAGCAGTCCAGAAGACATCTGACCTCATAGTGTTGGGTCTCCCCTGGAAAAC
AACAGAGCAGGACCTAAAAGACTACTTCAGTACTTTTGGAGAGGTTCTTATGGTTCAGGT
AAACTTTGTCCTGCTTTATAGGGTTTTGTTCTATGTATGTTTTGCTTGATTGTGAGTCTT
GTGTTTAGAACTTGCTCTCTTGGAGGCCAAGAGAGCTTCAAGTTTCAGAACTGAATTGCA
AAAGGTTTTGTGCCAGCATGTGGGTGCTGGGAATCAAAAACACTGGTCAGAATCACTGAG
CCATCTCTCCCACCCTCATAAACAACTGTTCTTTATCCAGGAGTGAGCACTGCTGTGTAT
GTCTGCCATCTTTTTATCAATCTGGTTTTCCAGACAGGTTTGTGGGTTTTTTGTTTTGTT
ATCTTTCCCTGTGTGGCCCTGGCTGATCAAAAACTGTCTCTGCCTCCTTAGTGCTGGGAT
TAAAGGGATGCCCCCCACTGCCTGGCTTTGTGCAGCCTAAATGTGCATTGGTGTTTCACC
TGCGTATATGTCTGTGGGTGAGGGTGTCAGATCTTGGAATTACAGGTAGTTGTGAGCTGC
CATGTGGGTGCTGGGAATTGAACATGAGTCCTGGAAAGCATAATTTAGTGCTCTTAACCA
CTGAGCCATCTCTAGCACCATGAGTTCGGACAGTTTAATGTTTTTTTTGTACAGTGTTGA
TAGGGTGCTGAAAGTAAGTAAAATTTGGTTTTGTGTGTATACTGTATATTGTCAGGAACT
GTTGTATGAAGGTTTAAAGCAGTGGTTTGCAAACAACTTTCATGGGTCGAATATCATGTT
CACATCACAGTGTCAAAATTACAGTTATAAAGTAACAGTGAAAACTTGGTGGTGGAGATC
ACAAAGGATTGCAGCATTATGTATGGAATGTCTAGAACTACTGCATTAAATGGAAATAGG
TTATATTAAAGGAAAATTTTTTTCTTTCCCCATGTTAAATTGTAACCAGATTTGCACTCA
TTTTAAACCTTTGTCGTGCAGTGGTTTGGTATGTAAAGGAGTCCTTCTCTGCTGTGGTTT
GCCTTGACCTAACTTACGTTTGCCAAGTACCTACTACCTTCAGTTGAGCCATTCAGACGT
TTTGTGGGGGTGGGGAGACAACTCTGATTGGCTGTGTGTGTGGTGTTTCTTCCTAGGTCA
AGAAAGATCTTAAAACTGGTCACTCAAAAGGGTTTGGCTTTGTTCGATTTACGGAATATG
AAACTCAAGTGAAAGTAATGTCACAGCGACATATGATAGATGGGCGATGGTGTGACTGTA
AACTTCCAAATTCTAAGGTATTTTGTTCTGTGTTTTGGTTGGGTGGTTGGTTTGGTTTTT
GAGATGGTTTCTCTGTAGCCCTGGCTGTCCTGGAGCTCACTTTATAGACCATGCTAGCCT
CAAACTCAGTTCTCAAACTCAGTTTTGCCTGCCTGTGTCTCCCGAGTGCTCAGATTAAAG
GTGCCACCCTGCTTACTTAATGTTGGCTTTTTTTTTTTTTTTTTTAAGATTTATTCATTT
ATTATATAGAAGTACACTGTAGCTGTCTTCAGATACACCAGAAGAGGGCATCAGATCTCT
TTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGAAATTGAACTCAGGACCTCTGGAAG
AGCAGTCGGTGCTCTTAACCGCTGAGCCATCTCTCCAGCCCCTTAATGTTGGTTTTAATG
TTCTGGGAAACTTAGCATCCAGTGCTTTGCTGGGCAAGCACTTGACCACTTAGCTACATC
CCCAGCCCAAACTTACCCCAAGCAAGCAAATAGGACTTACTTGGAACATTGTGTTTTGGA
TCAAAAGTATACGTTCATAAAACTGCATTTGGATTGAGGAGACAGTTTTATTTGGTCAGT
TAGTAAAGGGTTTGATCCCAGAACACTTTTTTATTTATATTGAGACAGGGTTTCTCTCTG
TAGCCCTGGTTGTCCTGAAACTCACTGTGTAGACCAGACTGACCTCAACTCAAGAGTTCA
CCTCCCTCTAACTTCCAAGAATTGGGATTTAAGGCATGAACTATTGCACCTAGCCAGATC
CAAGTTTGGGGGTTTCTTTTGTTTGTTTTTCTCTAAGAGCTGGATGTGATAGCATGTACT
TGTAATCCCACCCCTGGAGAGAGAAGGGGAGGCAGGTGAATCCTTGTAGCTTGCTGGCCA
CTGGTCTAGCCAAATTACAAGGTTCAGTGAAAAGTCCAGGATGGTGAGGGGTGACTGACA
GCATTGATTTCTATCCTGTGTGTAAAACAAGTTAAATTTAAAATGGCCTGGTGCTACATC
CCTGTAATTCTCAAACATGGGAAATAGAAACAGGAATGGGTTCAAGATTGGTCTTACATA
TCCAGTTTAAGGGCATTCTAGGGTACATGAGAACCTGTCTGAAATTCTGAGGAATGAGGA
TAGGGAAGGTGGCTGGGCGACAAATAGTATTTGTTGCTCTTGGAGAGGATTGATTTCATT
TTCAACACCCACGTGCCAGCACACAACTAACTACAGTTTGAGGGGCGATCTTTGCTGACC
TTAAAAGGCAGCACATACGCACTTGGTACAGGTAGGTAGGTACATGAAAGCAAAACACTT
TTTTTAATTCCAAGAGACCAGTCTTGTCAGTATACACCTTTAATCTCAGCACCAGGAGGC
GTGTATAGGCCAGGCAGTGGTGCACAGTGAGACCTTGTCTTTAGAGACAAAAACACCCAA
GGTGGGGGGACTTACGCACTGATTACTTATATATCTCCTATTCCCTTCTTTTGACCAGCA
AAGCCCAGACGAGCCTTTGAGAAGCAGAAAGGTGTTTGTTGGACGTTGTACAGAGGACAT
GACTGCTGAAGAGCTTCAGCAGTTCTTCTGTCAGTATGGAGAAGTGGTAGATGTCTTCAT
TCCCAAACCATTCAGAGCTTTTGCCTTTGTTACCTTTGCAGATGATAAGGTATTTTTCTT
GTTGATTTATTTGTTCCAGGGCTGGGAATATATCAGTTTGGTGCTACTATATGTGTCCAG
TGTGCTGAGCTCCGTCTCCAGCACTAAATGATAAGTGGCTTGTTCCAGCTGATTGCCACC
CTCCCTTCCATGGGATAGAGTAGCTTTAGATAGTGCAAGATGCCCTTCAGATATTTTTCA
TTATTTGGACTTTGGGGCTGTTACATGTCTTTTAAATTACAAATAACTACCATTAACATT
ACTATAGCTAAAGGTTGCTGATTGGGTTTAAGTGGAGTTAGCGTTAATCGCCTATTTTTC
CTCTTACTTAGTTGGGTTATTCTAAGCTTTGGTTTTATTGCTCTGTTGGTGTCCGAGTCG
GTGGTCTAATCGTCAGTTACATTCTTGTATCTTATAGGTTGCCCAGTCTCTTTGTGGAGA
GGACTTGATCATTAAAGGAATCAGCGTGCATATATCCAATGCTGAACCTAAGCATAATAG
CAATAGACAGTTAGAAAGAAGTGGAAGATTTGGTGGTAATCCAGGTGGCTTTGGGAATCA
GGGTGGGTTTGGTAACAGTAGAGGGGGTGGAGCTGGCTTGGGAAATAACCAGGGTGGTAA
TATGGGTGGAGGGATGAATTTTGGTGCTTTTAGCATTAATCCAGCGATGATGGCTGCAGC
TCAGGCAGCGTTACAGAGCAGTTGGGGTATGATGGGCATGTTAGCCAGCCAGCAGAACCA
GTCAGGCCCATCTGGGAATAACCAAAGCCAGGGCAGCATGCAGAGGGAACCAAATCAGGC
TTTTGGTTCTGGAAATAACTCTTACAGTGGTTCTAATTCTGGTGCCCCCCTTGGTTGGGG
GTCAGCATCAAATGCAGGATCAGGCAGTGGTTTTAATGGAGGCTTTGGCTCAAGCATGGA
TTCTAAATCCTCTGGCTGGGGAATGTAGGTGGGTGGGGGTGGTTAGTAGGTTGGTTGGTA
GGTTAGGTAGGTTTAGAATGGTGGGATTCAAATTTTTCTAAACTCATGGTAAGTATATTG
TAAAATACATATGTACTAAAATTTTCAGATTGGTTTGTTCAGTGTGGAGTATATTCAGCA
GTATTTTTGACATTTTTCTTTAGAAAAAAGAGGGAAAAACTAAATGAATTTTATAAGTTT
TGTTATATAAAGGGTTAAAATACTGAGTGGGTGAAAGTGAACTGCTGTTTGCCTAATTGG
TAAACCAACACTACAATTGATCTCAGAAGGTTTCTCTGTAATATTCTATCATTGGAATTG
TTAATGAATTCTTTGCATGTTCAGAGTAGAAACCATTGGTTAGAACTACATTCTTTTCTC
CTTATTTTAATTTGAATCCCACCCTATGAATTTCTTCCTTAGGAAAATCTCCATTTGGGA
GATCATGATGTCATGGTGTTTGGTTCTTTTGGTTTTGTTTTTAACACTTGTCTTCCTTCA
TATACGAAAGTACAATATGAAGCCTTCATTTAATCTCTGCAGTTCATCTCATTTCAAATG
TTTATGGAAGAAGCACTTCATTGAAAGTAGTGCTGTAAATATTCTGCCATAGGAATACTT
CTGTCTACATGCTTTCTCATCCAAGAATTCGTCATCACGCTGCACAGGCTGCGTCTTTGA
CGGTGGGTGTTCCATTTTTATCCGCTACTCTTTATTTCATGGAATCGTATCAACGCTATG
AACGCAAGGCTGTGATATGGAACCAGAAGGCTGTTTGAACTTTTGAAACCTTGTGTGGGA
TTGATGGTGGTGCCGAGGCATGAAAGGCTAGTATGAGCGAGAAAAGGAGAGAGCGCGTGC
AGAGACTTGGTGGTGGAAAATGGATATTTTTTAACTTGGAGAGATGTGTCCCTCAATCCT
GTGGCTTTGGTGCGAGAGTGTGCAGAGAGCAATGATAGCAGATAACTAACGTACGAGTGT
TTCTGCATCAGAGGACATCCACGTCTGTTGGAAGACTTTGAGTTTTGTTCTTAGGAAACC
CACAGTAGCTGAATGTGTTAAGTGAAATACTTGTACTTCCCTCCCCTCTGTCAACTGCTG
TGAATGCTGTATGGTGTGTGTTCTCCTCTGTTACTGATCTGGAAGTGTGGGAACGTGAAC
TGAAGCTGATGGGCTGCGAACATGGACTGAGCTTGTGGTGTGCTTTGCAGGAGAACTTGG
AAGCAGAGTTCACCAGTGAGCTCAGGTGTCTCAAAGAAGGGTGGAAGTTCTCATGTCTGT
TAGCTATTCATAAGAATGCTGTTTGCTGCAGTTCTGTGTCCTGTGCTTGGATGCTTTTTA
TAAGAGTTGTCATTGTTGGAAATTCTTAAATAAAACTGATTTAAATAATATGTGTCTTTG
TTTTGCAGCCCTGAATGCAAAGAATTCATAGCAGTTAATTCCCCTTTTTGACCCTTTTGA
GATGGAACTTTCATAAAGTTTCTTGGCAGTAGTTTATTTTGCTTCAAATAAACTTATTTG
AAAAGTTGTCTCAAGTCAAATGGATTCATCACCTGTCATGCATTGACACCTGATACCCAG
ACTTAATTGCTATTTGTTCTTGCATTGTCCAAAGTGAAAGTTTTTCTTTGGGTTATTCTG
TTTTTAATCTAGTTTTTCTTAAGTCTGGGTGACCGCACCTAAAATGGTAAGCAGTTACCC
TCCTGCTTGTTCTGAGTGCCTCTGTGCATTTACGTGGCTGTGGGAGTCCCCGCTGGGGAG
TCACCTTTTAAAATAACTATTTGGGAGAGAGGGCAAAACAGTTGACTGTTTTCAAATGCT
GTGCAGTAGAGCATATTGATGGAAAAGAAGGGGGTGATAAGCACCTTTCTGTTTGGGATT
TGAAAAGTGGAATTAATTGCAATAGGGATGAAGTAGAAGAAACCAAGAAACCATGTGCCT
GAAATCCATTAAGAAGCCTGATAGCTTTAAGAACTAGTAGGGTGGGTTGTCTTATCTGTG
GCAGTCTTAAGTGAGGTAGGCTCCTACCCTCCTGAATGTGGGGGTTGTAGTGATGAATAA
ATATGCTCACAAAACCAGATTAGACTGTCAATGCATTGTTAAGAATGTAAAAGCAATAAT
ACATTGATTATTGTACTTTTCCTGTAACTACTGAGAACTGAGGGGCTCCTTTTCTAACTG
GAAGAATGTGACAGTTTTGTGTTGGTAGTTTCCCTAACGCCCTTACCTAAATAGACTATG
ATAAATAGGTTTGTCATTTTGCAAGTTGCGTGTTTGAAAATTTTATATCCTTTAGAGACT
TGTTATGAACACATTGTTTCATTATACAGTATCCTCTGTAAAAGGATCGTGAGTTATTGT
AAATTTTTTTCTCTGCATCTAAACCTGCATGATTTCCAAACCCTGTACATCTGAATTTTG
CATTTTAGCACTTGCACTATTACTCAGCAGCAGTAACATGGTAACATTAAAATGGTTTTC
GGGGACCTCCAAAGACTAAAACTGGCAAGCCGTCCAGGAGTCCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1089, 2041..2292, 5534..5697, 6776..6916, 8398..8568, 8977..9094, 9942..11046
2055..2292, 5534..5697, 6776..6916, 8398..8568, 8977..9094, 9942..9967
AC_000073.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved