Rattus_norvegicus Locus Rcc2_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rcc2_predicted
Rattus_norvegicus
Rcc2_predicted
5
SNORA15
12873..13002
15342
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATGGTGAGTCCTTTTACCTCACTGAG
CCATCGCTGTAGTCCACAAGTATAAGTTGGAAGAAAAGGAAAACGTGTTTTGACATTTAA
GAAGCCAGAGAGAATGCGCGCACGCATGCGTGCAAGCTGATGATATGGGCATGACCTTTG
AGATGTGAGGTCTGTATGGGAGTCGAGGCTCGGTAGCCCAACTGAAGTACCCTGACTGGA
CAGGTATGGTCCTACACCTGAAGTCCCAGTACTGAGGAGGCTGAGGCAGGAGGACTACTG
AGAGTTAGAGGCAGTCAGAATTATATAGCAAAATTGGTCTCTAAATATGGAGGGGTAGGG
AGTCAGGCTCCAGTGAGGGGGCCCTTTCACCTCTTGTGAGCAGCATCGTATGAGCCTGTG
TAAGGCCGTCTGCCTCAGACCCTGCTGCCCCACCAAGCTGTGCCCTCCCTGCCTTACCCC
CTTCCTCTGTATTAAAGTCTCTTGGTACTGGGGCAGCACACAGGACTGATGTCATGGTAA
CCCTGCAGAGGTGATGCAGGCCTGGCTTGAGGTATGAAGGCTGCCAGTGCACCCCGCCAC
TCGTAGTGGGGACTGTATAGCTGGCCTCAGGGTGTGAGGTTCCTGGGTCTCCTGCCTTGT
GGGCTGTCTTGTGCATGACTCTAGCATGGAGTCAGTGGAGGTCCTGGCTTTGTCTCAGAG
TTAGTGCAGAGCTGATTTAACAAGGGGAATTCTGAGGCCGGCTTTAGGTCACCTACCTTG
GAGCCTGTAGATGAGGGGTGATTGAATAGGACCTCTAACCATAAACAATCATTAAGCCGG
GTGTGATAGTGCACACTTGGAACCCCAGCTCTTGGCTGAGGCTGGAGATGAGCATTCAGG
GTTCGTCTGGGCTGTGGGAGAGACCTTGTCTCTTTTATCAGATGGCTGTGGGGTGCCAGC
AGCGTCCTTAAGCTCATTCTCTTCTCTCTCTCTTTCTCTAGAAACTTGAAGGGTCTAAGT
GCAAGGGGCAGCTTTTGATCTTTGGGGCAACCAACTGGGACTTGATTGGACGAAAGGAAG
TGCCTAAACAGCAAGGTAAGAGACTTGGTTCTGACCCATGATTGGCTGATGCTTAGAAAG
CAGGGGGCGGGTGGGGTCCTGGCCCCGCCCACCAGCTAGGTGTTGAGAGAGGCCCTGGGG
ATAGAATAGCGGCTTGGGACCACAAAGCCCCTCTGGTGGAGGATGCTGCAGTAGTGCTGA
GCCTGGCCTCCTGCATGTCTGTGCCCTCGGAGTTCGGTGTTGCTCAGGGAAGTTGTGTCC
TCAGACAGCCAAGACCCCCTGAGTCTCAAGATCTGGTCCTATTCTGTGGTGTCATGAGGC
CCCAGACACTTGTCAGACATGATAGCCATTGATGTACAGGCTGCTGATTGGCTTGTCACA
ACTCGGCGGAAAGGGAAACAGTTCGCCACGTAACCTGTATCCAGCTGCCTGTAGAAGACG
GGGGCCTTCCTGAGGGGCCCCTTGGAGAGAAGAGGAGCTGGCTCAGCGCCACATTTTATG
GCTTGATTTCATTTGGAAACACTCCCAAAGTGCTTCCCCAGCATCGCTTTGTCTGTGAAC
AAATATTTGAACACCGGCACACCCTAGCACCCAGACTTGGGGGCCTGCATGGTACAAATG
GAGCTGACCAGATGCCCTTCCTTTTTGTGGAAGATACCCATCTTTCACCACAGCCATGGA
CACCAGTCCTGAGAGCAGTGGCCACTGCAGCTAGACCACACAGGGTTCCTGCTATCCGCT
GTATCCATTGCCCTGCTGATACGGCAAGGGCGCCTTGACCTGACTCACCCTCTGCTTCCG
GTGCTCTCTGTGGCCCGGAAGCTGTGCCTCTAGTCCAGAGCAGACCGGGCTACTTGGGGC
ATGGCATCTTGCCAACCTAGCCCATCCCAGGGTACCTCCTGCCTCCATCTGCACAGGCTT
CCTGGCCCACCCCACCCTCTGCCTCCCAGTTGGTGTGAGTGGTTTTACTTGTTTGTTGTA
AACACTTAGGTCTGGCTAGGCAGCCTGTTACCTGGAGCTGTTAGGCAAAATAGAGGAGGG
GACACTTACCTTCCTACCCTGCTGGACATTGCTGCTCTCTGCTCTTAATGTAGCGTGTGG
TCCCTGCTGTAGCGTGTGGTGAGGACCAGGTCCTGGGATCTGGGACCGTGGGATTAGTGT
CTACCAGACTGGCTCTGAAGCTGGGGCCACTGTCTGGTTGTGGCTTTGACTTGAGTGGTT
CTGACTGAAACAAGGACGAGGGTTCCTAGTGTAGGAAACACCCCCTTATGTTATTGTAGC
TGATGTGGCACCCTCTTCAGGAGACAGGCACTGTCAGGGATGATGGAGAGCAGCCATCCC
TCTGGGCCAGCTGGTTCAAGAGCCAGGCCATTTTCTTTTCTCCGGCTGACGCCCAGTACT
GCTGTAGCTCACAGTCCTGAAAACCACCTTCGCTTGCTTGGTTTTCCCCAGTGGCAGGCA
TGCAGTTCTGCCCCTGGTTTTTCTCCCTGTGTGTGTTGTCCTCCGTGATTCAGGGCTGAT
TGGGGCTTCTCTTCAGTTTTGACCTCCTGGGAGGCCATCTTTTCAGTTCGTCCCTTGGAC
TAACGATGCTGTTGGGCTTTGCTTTAAAGTACTTTTCAGTGGGGCGGCTGCAGCATCTGA
GGGGTGCTCTCTGATGCTAGGGACCTGGTATGCCACAGAGGACTGGAAGGAGGGGTTTGC
CGTCTGAATTGTGGCTAGCTGCCCAGATGCCCACCACCACCATTCTGGATGTGAAAGAAG
AGCCACACCCCTGCCTCAGGGACATGGGAGTGGCAGCTTCTTGTACCTCTTGGGCCAGGC
CCTGGTGAGGCCTGGCCCTTGCTGCCTGTCATGGTGGAGGCAGTTGCAGTAGGTGGGGTG
CAAATCAGAAGTACAGTACGAAGTCTAATGTGGGTCTCCCAGAAAGCCCAGGAGGACATG
CTTGGGGAAATGAAGGCGGCTAGCAGTGTGGGCTTCCTGGGTGTAGGTGGGACTCGCTCG
GGCAGGGGTGGATGACATCAAGGCCTTCCTCTGAGGAAGCAGGTGGTTCTGAGGAGGAGG
GCACTGAGCCCACTGAGAAAGACCTTTTTCTGGCTATGGGGAGATCTGGGGTACACTCAG
GAGGGTAGACAGAATCCCCAAGGATTCTGTCACAGCCCTGCCCTGTAGCAGGATTAGACC
AGCAGCTGTTTGTAGGTCTGAGGGAGAGGGATTGGCGCCATTAGTGTAGGCCAGTGCCCC
TGAGTAGGCTTCTGTGTTTGCGACCCCTGGGTGATACATTAACCTCAACCTGCCCGGCGT
GTTCTGCGGTGCTTGACGAGTGTTCTTCCCTTTGCAGCTGCTTACCGCAACCTTGGTCAG
AATTTGTGGGGGCCCCATAGGTATGGGTGCCTGTCAGGAGTCCGGGTGCGAACCGTGGTT
TCGGGCTCCTGTGCTGCCCACAGCCTTCTCATCACCACAGAAGGGAAGCTCTGGAGCTGG
GGTGAGTGCTGGTGGGGACAGGCGTGACCTGGAGCAGGGCTGAGGCCACCTGCAGAGGCC
CTGTCTTTTGTCTGCATCCATGGCTGCTCATTGTGTGTGTGTGCGTGCACCTCAGTTCTT
GACTGCCACATGTATGTGGGTTTTAGGGATTGACCCCAGGCCCCAGGCTTACTTGGCACG
TCCCTTTACCCATGGAGCATCTCACTGGCTCTGTTCTCCGACTCTGCCTTGGTGAACGTT
TTCCTGAACTTGGAAACAAGTGTGGTTTTTCTGACCCTACTGTCCCTCTGACCAGACTGG
CCATCTGTCCTCAACATCTGTCCTTTCACCCAGCCCTTGTTCTGCTTCAGCACCTCGTGT
AGGGAGGTCCATGTTCCCATAACCAAATGCTACCCCTGGCTTTTGTGGCGGGTGTGTCTT
GAGGCACAGCGGCTGAGCCCATGTGGTTCCCAGCCTCAGGTCGGAGATTGGGCCATTGTC
CGCTCAGTTCCTCCCGAGTCTCCACCTCCCTCAGCCAGATTCTGATGGCTCTCAGCTGTC
CTTTTGCAGGTAGGCCAGGAGGTATTGCCCAAGGCTCATGTCATCTGACACTCAGGGCTC
ATGCAGCTGGGGGAGTTGTTTCTAGCCTTTGACTGGCTTCTAGTTCATACACTGTTTTTA
TTTTGGTCTGTTTGAGCCTTTTTTTTTTTTTTTTTTAATTTCATGAACCGCTGTACCAGA
GTCCAAATATATTAACATCTGCCGTCTTCTCTGCACTTGGCTAATTTTATAATTCTGTTG
GAAAAAAATCTAACAAGTGTGTGTGGCCCAAATTTATCCTCCCAGGCTTTGGGTGACATA
CAACATCTGCCCCAGTTCTGTTTCGGTCCTCCTACTGCTTTGTCCTCAACACTGGCCACG
GCCTTCCATGTCAGTATCCCCAGCTTGACACACTTCTCTCTGTTCTCCTTCCACTGACAG
CAAAGTGCTAGGTTGCATCTCAGGCTGACTGACCTTGTGACAAGAGTCAGAGAGGGAGCT
CCCTGGAACAGCAGCTAGGGCGTGGAGCCCTGCCAGGAGGTGTCACATCTCCTGTGAGAG
TTCCCCCTGCGAGGGAGGCCAGTCACCCGGTCTGCTTGCCTCCCTCGGGTGCCTAGGGCT
CAGCTGTCACGACACTGAGGGAGACGAGTGTAAGCCCACCTGGCCTGTGGCTCATAGTCT
GCAGCCTTGTGCAATCCCTATGTTGAGTTTCTTGTGTGCTCTTCTGGGACAGGGTCCTGG
GGGCTCTGGTGGGATCTTGTTTTGTATCTCTGTGGGACCTAGGTAGGATTTTAGGGCTCG
GACTGTTCTGGGACCCGCCCCTTGTCCACCCTAAGCTGAACTAGGGCTCCTAGAACTCCA
GTGCACTGTGAAGGCCTTCACAGGGACTGTCCCTGCTTGTATTTATGTTGAGAGCAGGCC
TGTCCCTTGTCATGAGTGTTCATGGGGGTCTTCTAACAGGTGTGTGGGAGGAGTGGGGAA
TAGATAAGTAGATATGACCAACAGTAGGCGCATCAGACTCCCTGAGAAGGAGGGGACTGT
TCCCAGCCACTATTGGGAATGGAAACTGATTCTGGAGCTTGAGGCCTGTGGAGCACCCAG
GTTACACCAAGCATTGCCTGGAGTAGCAGAGGCTGGGGCTGTATTGGGATGGTCCTAAGC
TGACCACTCTCTGTTGGGATATAGTTGGGGTGGCCCATCTCATGGGGCCCAGCTCCCCTG
GCTGGGGAGAGTAGCTGTTAGGGTTTGTGAATGGTTTACGAGGGACGAGCGTGGGACCGC
CCCAGCCTGTCCTTGCACTGCTTACCTGGCCTGCGGTGATCTCCTTGCAGGTCGGAATGA
AAAGGGGCAGCTGGGCCATGGTGATACCAAGAGGGTGGAAGCCCCCAGACTCATCGAGGC
TCTCAGCCATGAGGCAATTGTGCTGGCTGCGTGTGGGCGCAACCACACCCTGGCGTTAAC
AGGTAAGAAGGCTCTTCCTCAACTATGGCGAAAGGCTCCAAAGATGGTCTGGGAGTGAGT
GACAGAAAGATGATGCTTGGTGAGTTAGCGAGGTGGTTGGTTAGTTAGCCAGGCAGTTAG
TCAGGCGGTTGGTCAGTTAGCTGGTTACTTGCTGAAGGCAGTGAGAGGGCTACGGTGGCC
CTGGGAGCCCAGACCAGGGCCTGTGTGTGGCAGGGCTCAGCTCAGTTCTGCACTCTTGTC
CTTGGGATGGACAGACACACAGCCGTGCTTGGCCTGGTAGGTGAACTGTTTGCAAAGCTT
TGATCCAAGTCCAGTTGAAACCATCCGCCCTTAAATCCTTTTCTGTCCTTATTTGTCTCT
CCTTTCAGATACTGGCTCTGTCTTCGCCTTCGGAGAGAATAAGATGGGGCAGCTGGGCCT
CGGGAACCAGACAGATGCTGTTCCAAGTCCTGCCCAGGTATCAGCAAGGCTGTGGGCTGT
GGACTGGGCAGTTTGAGAAGTGATGCTTTGCCAGGGAAGGTGGAGAAGAGAACCTGTGTG
TGTGTCAGCCCAGGAGTGGGGGTGCCAGGTCTCTTCTCCCTGCAGACACAGCCAACCTGT
CTTGCTCCTGAGGCCAGCGGTTGTTGGGGGGTGGGAGGGTGGGGAGCTGAACCTTGTAGC
TGCAGTGCAGTTGGGTGCGAGAGTGAGCAAGGAAGGAAGGAGCCCAAGCACCAGGTTCCC
CTGGACCACCGGGTTAAATGCTTGCTGCTTTTGTCTGGGCTGAGGTCTGGCCTTTCCTGG
GTTTTGCATTTGGTTTCTGACCAACCTTGTGTTGTGGGACCAGCCTGCCACTCACCCCCT
GTCTTTGTCCTTCCTTATTTGAGCCGTTTCACACCTGGCTCCCGCCTTACTGACTGAGCT
CTGCGGATGAACTGGGGTCTGGGGGGGCTTGTTATTCCTCAAGTTGAACCTAATAGCAGT
GTTTGCCCCAGAAGTGACCTTTGGTGGGGTCACTTGGGTTTGCACTGTCCGTCCCTGTGG
TTGAATCGCCAGATGATGTTAACCTCAGCCTCTGCTGTCCAGGCAGGGTGGGGGTTGCCA
GCAGTTAGGAGTCCTGGTACTCTGAGCTCATGGATACCGTCCGCTTGAGTGGCAGCTCCT
GAACTTCGGAGTCCACTGTTGCGAGCGGCCACTGTTCCATGCCGGGGCAGATTGAGGAAG
AGACTTGTCGAGCTGAAAGTTGGCTGTCTTCTCTTTGCAGATTATGTACAATGGGCAGCC
AATTACCAAGATGGCCTGCGGGGCAGAGTTCAGCATGCTGATGGACTGTAAAGGGAACCT
CTACTCCTTCGGGTGCCCTGAATATGGCCAACTGGGTATGGGTCTCTTTCTTAAAAGCTC
TGTGATCTCACTGTCAGTGTGGAGCCAGAAGGCAGCTGGGGCTGTGCTTGTGATTGATCC
AGACAGCAGCATCTCGGGCTCAGCAGCTTGCGGTTAACTCACAGGTTAGAGGGGTCAGTG
AAGGCTCGGGGCTGAGTCTGGCTTGGAAATCCATTTGTGTCAGTCTCAGGCAGAAGGACA
AAAGCTCAGCCCCCTTCATCCGGGTTCACGGATAGAAATGAGCCTTTATTGGAAGTGAGA
ATTACCTAAGACTGAGGTGGTTCTGTTTGAAATTCTGGCCAGACAAGCAGCTCATCCCTC
ACCCCACTGGACTCCGCACTGCACAGAGCAGAAGAGAAGTGAGCAGGCCTGTTAGAGCTT
GCCATGCAAGATCTCCATTTTCCTTTCCCCTCTGACTCCCAGCCAGTTCTTCCTGGTGCT
TTCTGCAGTCCTGAGCAGGAGGTGAGGTGTGGGCGCCACCTCCTGGTGTCTGAAGAGCCT
GCAGCAGTCCGGGATCTGGGTTGCTGGGTCTTGGCGTCATGAGAAGTGCGCAGATGGGAG
GATATAAATAGAAGCAGAGCACTGCACTGGCCTTAGACTGCAGGAACAGTGACTCTGTGG
AACTAAATATACCTCAAGTCAGAGTGGATACGGAGGACCGGCCCCTTACGCACATCACTG
CTGGTTGCCAGGGAGTTCTCAGGGCTGTGGATAAACGGTTTCCATGGCCACAGGCGAGCC
TCCTGCCATACCCAGGCCTAGTACAGGAAGTGTGTTTCTGTTGTGTGTGCAGCTTCTCTG
CTACTCAGACAAGCCTCCTGCTGCAGCCGGCCTGTTTGCCTTTGGGGACTTAATCTTGGC
AGTTGGATGGTAAATGTGGAGTGGTTTTGGAGGGACAGTTAAGTACAGTGTGCACTGCCT
CCTACCGAATTCTCGTTGAAGTCTAGTAAGGGACCTGGCTGCGCCTGCATCTACAGAACC
TCTCGTTCTGAACTCGGCAGTTCACTCTGAGGCAGGCTGGACACCTGTGGTCCCAGCCTC
TGAGGGCCAGAGGCAGGACTGTCGCAGGTTCCAGGGTGGGTTACAGGCGAGTCGGGGTCT
CGGAATGAAAGTTGTCTCCAAAAACAAAACACAAGCCTAATCCCCCCGTTCTGTTCTTGT
CTCTGTTCAGACACTGCTTTTAGAATTCAGACATGATTGCAGGACAGGGCCCTGCAGGTG
GTTAGAGCAGTGCTGCTGCCTGGGCAGGGACTGAGGGTGTCTGGTCTATAAGCAGCCAGC
ATCCTGGCTACCAGTCCGGACTGGGCCTCCTGACTTGTTTTGTTGTTTGGTAGTTCTGTT
TATATTTGTTTGGTGGCTTTTTTGAGACTGTGTCTCACTGCGTATCTCCAGCTGGCCTAG
AACTTGTTGTGTAGACCAGACTGGCTCCAGTCCGATCCACCTGCCTCTGAGTACTGCGGT
TAAAAGGTGCGGGCCACCAGGCCATATCCAATTTGCTTTTTTTTTGAGACAGTTCATGTA
GTCAATGTAGTCAGAGCTAGCTTCAGATTTCCTGTGTAACCGAGGATGGCCTTTGCTTCC
TGCTCTTCTGCCTCTGTGTCCCAAGAGCTGGCATACACTACCAGTGCAAGAAGCCAGAGA
GGGCTGGGTTCTTGGGCCACAGGCATGTGGTCCAGGATCAGACTTGGTGCGGTGCTGGGT
TGGAGCATGCCTGGGATGTGCCAGGCTGCCTGGTCTGTCGTGACTTCTCGAGCGTGGTTT
GCGAATTCCAGGTTTTTATGTCCTTTGCAGGTTGCTTAAATCACTGCTAATTTGTAGGTA
GAAGTAGAGAATTGTACACTGAATCATCTTGTCCCCCTTTCCCTACTACTGGTCCTCAGT
GCTCCGCTACCTGGGAAACTGTCCTTCAGGTGTGAGCTGCGCACTGTTGTGACCCTCAGC
CACAGGAGGGGGCACAGTCTCCTTTACCTCCCCATCCATGTGAACACATACAGGGTTTTC
CTAAGTTACAGCCTGTGGCATAGGGGGTCCTTGTTTTCTATGCATGTTTAAAGAATGCCC
TGTGTTACCTACCATCTTGTGAGCAACTGGGCAGGGGCACAGTGGAGTCCTGGGCCTGTG
TCTTCGTAACTGACAGCCTGTTGTGCTTACCCCAGGACACAACTCAGATGGGAAGTTCAT
CGCCCGGGCGCAGAGGATAGAGTATGATTGTGAGCTGGTGCCCCGGAGAGTGGCCATCTT
CATCGAGAAGACCAAGGACGGGCAGATTTTGCCTGTCCCCAACGTGGTGGTTCGAGACGT
AGCCTGTGGCGCTAACCACACAGTAAGCCTTGTATTTTTAAGAGCCGAGCTGGTATAGAT
TGGTTTTACTCAAGCTATGTCATTTAGCTGAGTGCTGAGTGAGTCTCCCATCAGGATATC
CTTTCCTCAACAGACAACATGCAAACCTGAGTATACATGTATGTGTCTGCACCCTACCAC
TGAGGGTACATGTATGTGTCTGTGCCACTTGTACGCAACACATAGGGTGTGACTGGTTAC
CTGTTGCGGTGTCTCCTTAAGGTCCCTAGCAGAATGACTGGAAGAACATGCGTGCATGTG
CTGTTTGTGAGCTCCTTTTTTTGGCATGTGCACATGTGCTCATAGTGTGGGTGTGTGTTA
AGTCAGAGGATACTTTTCTTCCACCTATGTCTCAGGAGTCAAATGTCAGTCATCAGCCCT
GCAAAGCAAGGACCTTCACCTGCTGGACCCTCTGGTTTGCTTTGGTGGTGTTGTGGTTAT
TTTTGCTTTGTTTTTAAGACGGGGTCTGAGTGTGGCCCTGGCTGTCCTTGGAACTTGCTG
GTTCTCTGGGTAATGGGTATGTGCCCTTCATGGTCTCCGGTTGAGAATCAGTGGGCCTGG
TCTGGGCCTTTCACTTTGGCAGGAGAAAGAAGGCCAAGGGCTGAGCCCCAGAGCTGAGCC
TCTTGCCTGCTTGGTGGTGCTCAGTGGATTAAATGCAGGTGTCCCAAGCCTGCAAGTCCA
TAAATCAGCACACTGCTCTCTCCTGTCTCCTGTGTTGTGTGTTTTGCAGTGCTGGGTACG
GAGCCTGGGGCGAGTGTTGTCGCCCTGACCTGCACACCTTCCGTCCCATGCCGAGGTAGC
TAGTTGCCCATTTGCAGGGTTTATTTCAGTATGAAACCTCAGAGGCAAAAGACAAGGCAG
ATTATAAACAGCTGGCACATCTGCCTGCCTCACCTGTGTGCACCTGTGGCAGGCAAGCGC
AGAGCGGCGACGGCAGCCTTCCCTCCTGTTTCTACAATTTAGACAGTGTTGTCACCCACA
GACAGCCATTTGTCTTCTGCATTTAAAGAGAGAGAAAGGAAGATCGCACCCTCATAAAGA
GAGTGCACACTGGCCCTGCTGGCTGCCATGTATAGGCTATGGGACTCCTTTGCTTCCTGC
TGCTGTCCCAGACCCTGTGGTCAGAAGCAGTGGCCCATGCGTCTCAGCCTTGTGTCTCCT
CTCACTGCAGCTGGTCCTGGATTCACAGAAGCGAGTCTTCTCCTGGGGCTTTGGTGGCTA
CGGCCGGCTGGGCCATGCCGAGCAGAAGGATGAGATGGTACCTCGCCTGGTGAAGCTCTT
CGATTTCCCGGGACGTGGTGCAACCCAGATCTATGCCGGCTACACCTGCTCCTTTGCTGT
CAGTGAAGTGGGTCAGTGCCTGCACCCTCTCCAACTTCTTAGGTCCCCGCGGTTGGAGCC
AGCCAGGTGCAGGGTTTCCCTCCTGGGGATAGCTGTCCCCACAGCCCACAGCCGTGTCCG
TCCCTCCCTGGCTCCTTCTCTGCGGTGTCCTTTTGAGCAGCTGTCCCTCAACCTTGGTGT
TCTCTGATGATGCTTACTCGTGACACTGCTGTGTTTTGCTTTTTTTCCAGGGGGGCTGTT
TTTCTGGGGGGCTACCAATACTTCTCGAGAGTCTACCATGTACCCAAAAGCCGTGCAGGA
CCTCTGTGGCTGGCGGATCCGGAGCCTTGCCTGCGGGTAAGGGGCTGTCTCTGGGGCACG
TGGTGTGAGTGTGGGGTGCTCTGTGCCAGCTGGTCTGGGTCTTCCTGGCTAGACATAGGA
GACACCAAACCCCAAAATGTGGGAGACAGGAGAGTTCAGGCTTGGTAGATGCTAGGACAG
GTGGTGGCTCCTTCCTTCACAGAAAGTAATTTTGAAAGTTTTGGGAGAAAAAAAGTAGAG
GTTGGCAGTTTTCCCTCAGCTTGGAAACTGTAGGCTTTTAATTTGTTAGCACCGCTGGAG
GAGAGAGGAACTTTTTATTTATTTATTTTAATTTATTTATTATATATAAGTACACTGCTT
ATATATACTGCTGTCTTCAGACACACCAGAAGAAAGCGCATCAGATCCCATTACAGATGG
TTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGAAGAGCAGTCGGG
GCTCTTAACCGCTGAGCCATCTCTCCAGCCTGGAACATTTTATTCTTAGTGAAGGACACC
TACTGAATCACCCAGTACTTAGAGGTGATAAATGTAATGTGTATGAGTTAACTTGGCTCT
GAGTTATTGCTTCCTGGTCCTTGCATCCCTGTCTGTCCCCATCCCAGAGGATCTCCCTCT
GAAAGCCCCAGGACAGATATAGGCAGTGAGTATTGATCTGCAAACAACTGTGGCCCATCC
CTGTCCGGGAAGAGCCACTCAGTACTGAGTTAGCAGGATAGAGGTGGGTGTGTCACAGTG
GGAAGTGAGTGTCCTGGTCTCTGAGGGGATGGTAACAGCATCTGCCCATTTGCAGGAAGA
GCAGCATCATCGTAGCGGCCGACGAGAGTACCATCAGCTGGGGCCCATCACCAACCTTCG
GGGAATTGGTGAGCCATGGCAGGGCCTGGGAACAGGGATGCGGATGGGTGGGCACTGTCC
TTGTCACTAAGGACTGTCCCAACAGTCGGTCACATTTGGTTTTAAGTGTTAAGACTCTCC
TGGCTGTTGCTGCCCATGCTGTATGTAGAAAGGATGGCAGCTATGTGGCCAGACATGTTC
CTGCAGTTGGGCATTGTCCACACTCCCAGGAAGCAGTGTCGTCCTAAGCTGCGTGCGTCG
CCCTGGTGCCTGTGACTTTGTGCTTCGTAGGCAGACGGGCCACGGTTTGTGGTCTGGGTC
AGTGTCCTTAGGCCAGCCACACAGGTCCCTGGAGGATTTTGTTCTCCCATTTTCCCCAGA
TCGGGTTACTAGTTTGTTCTCAGCCCCAAAGACTGGAGTAAGGGCGGAAGCCACTGCCCT
TACTGCTTTCTGTCCAGATGTCCTGCCCATAGGTTCCAGAGCTCAGTGCACTTTAACCTT
TGTGAGGAGGCCAAGGTTGACTGAGTTTTGTGTATCTCCTGTGGCCAGGACTGCACACTC
AGTGTGGTCTGGCCCTTGACTCTGTTTTGTTTTGGTTTGAGACAGGGTTTCTCTGTAGCC
CTGGCTATCTGGGAACTCATTTTGCAGACCAGGCTGGCTTTGAACTTACAGAGATCCGTC
CACCTACCTCTGCTTCCCAAGCGCTGGCATTAAAGGTCTATGCCACCACACTGGCCTGGC
CCTGACATTTCATCCATTTTCTTACTTTATCATCCTTTTGGGAGTGGAAGTTTTCTCATG
GGACCCAGCAGAGCAGGGCTCTGTCCTTGTCCCTCAAGATGTCACTGAGCTCCAAGGGAC
CCCTTGTAAGGCAGCAGAGCAACTGTGGGCCTTCCTCTGTTTCTCTTTTCTCAGAGAAGG
ATGGATGCTGCACCCACCCCAACCCCCACCCCTACCCCCCAAAGATAGCAACTCATCATG
TAGCTGTGGCTGGCTTGGAACTCACACTGTAGATCAGGCTAGCCTCAACAGAGGTCTGCC
TGCCTCAGCCTCCCAAGTATTGAGGTTAAAGGTGTTCGCCACTACACTTGACTGATGGGT
AGTTTTGGAGACCATCAGAAATGGTCTTCACAGGCATGGCTGAATACTGTGTTCTTTAGT
CAATAATTTACACAGCCAGACACCATGCAAGAGTAAAGTCTTCCTTTAAGATGACCGATA
TGCTGTAGTTTATGGTATATCACCATCACAAGTGAGTACAAGTAGGAAAGAAAAAGAAAT
GGTCTTCACAGTAGAGCGTCAGTGGCATTGGGGCTTACAGGTCAGCCCGGGCTCTATAGC
AAGCCCCTGCTTAAAAAATACTATTGATCTTTGGGGGCTCGAGATGGCTCAGCGGTCAAG
AGCACTGCCTGCTCTGGTGGAGGATGCAGGGTGATTTCCAGAGCCTATGTGGTGACCACG
ACTGTCTGAAGGTCCAGTTCTAGGGGACCCAACACCCACTTCTGGCCTAGGTAGATACTG
AGCACACACGTGGTGCTCAGTCATAGACGCAGGCAAAATACCAAAACACAAAAAACCCAA
TGTCTAAAACCTCCTGAACTCTGTATCCCAGTGTGCTTGGGAGCCTCGGCCAAGAAGGGA
CGAGCCTGGAGGAGCTGCCCTTGCGGCCCAGTGCTCCCCAGCAGTTCTTGGGTCAAGGGC
TGTCAGGGCCAGGATGTGTTGGGCATGTTGTAACATGTTGCTTAGGATTGTGTAGGCCTG
ACCGCTGTGGGCACTGTCACCAAAGGATCTGCACACTTTGTCCCATAACCCACGGTGGCT
GGTATACCGGAAGACACACACTTACTTCCCTTCTGTGGGAACATGCCACAGGCCGTATTT
GTCATCACTTCTTGTCATCTCTGTAGGGATATGGGGACCACAAGCCCAAGTCTTCTACTG
CAGCTCAGGAGGTGAAGACTCTGGATGGCATCTTCTCCGAACAGGTGAGAGGCGTCCCAC
TGTTTGTGTCTGTGCTTGTGTAGCATGTGGGAAGGGTACGTCCCTCCTCAGCAGCAGAAA
GGCAGAGAGAAAGCTAGCCAGGGGGTTGGGGATTTGGCTCAGTGGTAGAGTGCTTGCCTA
GCAAGCACAAGGCCCTGGGTTCGGTCCCCAGCTCTGAAAAAAAGAAAAGAAAAAAAAAGA
AAGAAAGAAAGCTAGCCAGACCCTGGTGAACTTCCGGGTGCTGTGGTCATCACACACTAC
CCGTCCTCCCAAACTGGGATCCTTGCCACTGGGCTAGGACCAGGGACTAGTCCCTGAACA
GACAATACATTTGGCATGTGTTTGGTGGCAAGTACAATGTGGAGCTACACCCCAGTAAAG
GTTCTTTGAGCTTCCTGTGGGCCTGGGGGTGGGGCTTGGGTTAGTGGGGAGGAAAGGGTT
TCCCTTCATGCAGACCCTGATTGAGCCAGGCCAGCACATGATATCAGACATACATGATGT
ACCTGTTTGTTTCTGCAGGTGGCCATGGGCTATTCACATTCATTGGTGATAGCACGAGAT
GAGAGCGAGGCTGAGAAGGAGAGGCTGCAGAGGCTGCCTGAGTACACCCCACGCACGCTC
TGAGCAGCAGCAGGCCGGCACTCCCCTCGTGGCAGCTGTCATTCCCACGTGCACTGGGAC
CAGACGTCAGACAAGGAATTTAGGAAGCAAAAGTTGACCAAGGGTGCATTGGGTTAGCCT
CCCTGAGGTTCCGTTTCCAAGCGATTCAACGTTAACTACCTTTTCTGTATGCTTTCCAAA
GTGTTTTCCCTCAACGTTGATTAAAACATTTGCTCATAGCCAGCTTGCCTTTCTACGAGA
CAGGCAGGAGCTCCGGGCGGTTTAGGTTTTTTTTTAAGTTGTATTTCTTTTCTCCCCTCT
CTCGAGTACCCTTGTGCAGCCCTCCCATTCCAGCCATAATTAGCATTGTGATCCGAGTGG
GCGCCACATGGGAGAGGGATTGCCACTCTCCCAGACAGAAACGGCCCTTCCAGGAACCAG
CAGCAGCTAGGCCAATCCCTGCCTGCCCGCTGTGAGAGACCAGTCACTTGCTTGTGGGCC
CACCCACCTGCCCTCTGACCCCCTCTCCCCCATAGCTATTGCTGGCTTGCTGTCTGCAAG
GCCCATGTGGGCCTTTTGGCTGAAGCATTTGTAGAACCAGCCATCTCCCCCTGGTGGGGC
TCTGGGGTCTGTGTTTAGCCATTTGTATCTCCTTTAGCTCTCAAGTCCAAATGAGAATGG
GGACCATGGGGTATGGGGTGGGCAGTTAGAGATTGGTCAGCTAGCAGTCAAATGTGTTCT
CAGTCCTCTGTGACCCGCAGTTGCCGCCTTTGCGCTTTGCCTGTCTGCTCCTGCTGTCCC
CTCTGCCTGGGATGGCCACCCTATCCTGAGACTTGGCCATTGTTCTCCCAGCCTCAGTGT
TCTCTGGCCGCTGCTTGCGTTTGCTTGGCTCTGGTACCAAATAGTTGGGATTCCTGATGA
AATTCCCTGCCCTGCGTGTCAGTTCAGACTGTCACCACATCCCCACAAGTGCCCTCTGCC
GAGCCCATCCTGGCATTGACTTTGTGGCTGAGTTCCAAGGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1094, 3397..3540, 5390..5521, 5888..5976, 6760..6874, 9035..9201, 10390..10570, 10790..10895, 11695..11767, 13646..13723, 14238..14342
1001..1094, 3397..3540, 5390..5521, 5888..5976, 6760..6874, 9035..9201, 10390..10570, 10790..10895, 11695..11767, 13646..13723, 14238..14339
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved