Rattus_norvegicus Locus Rcc2_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rcc2_predicted
Rattus_norvegicus
Rcc2_predicted
5
SNORA15
13321..13450
15790
GTGTGACTGCTCACACCGTGTATGTACAGATCCCCTGGAACTGGAATTACAGACGGTCG
TGAGCCAGTGCTTGATCTGGGTGCTGGGACCTGAACCCAAGTCCTCTACAGGGACAGTGA
GTGAGTGCTTTACCCATTGTGCCATCTCTCCAGCCCTGCAGGGTGTGTTTGTAAACCAGG
TGTGACCCCAGCATTTGGAAGGCTGGGACAGGAGGATTGTACAAATTGATACCACACTGG
GCTACAGAGTAAGATCTTGTCTCAGAGCAAAAAGTGTTTTCCTCAGATACACATTTGTCT
ATTGTTTGTACATGGGAGGGGTGTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTG
AGAGTTGGGGATTTTGCTTCCGGTGGGTCCGGAGGACCAGGACTGGGGCTGTCTGGCTTA
CATGGTGAGTCCTTTTACCTCACTGAGCCCATCGCTGTAGTCCACAAGTATAAGTTGGAA
GAAAAGGAAAACGTGTTTTGACATTTAAGAAGCCAGAGAGAATGCGCGCACGCATGCGTG
CAAGCTGATGATATGGGCATGACCTTTGAGATGTGAGGTCTGTATGGGAGTCGAGGCTCG
GTAGCCCAACTGAAGTACCCTGACTGGACAGGTATGGTCCTACACCTGAAGTCCCAGTAC
TGAGGAGGCTGAGGCAGGAGGACTACTGAGAGTTAGAGGCAGTCAGAATTATATAGCAAA
ATTGGTCTCTAAATATGGAGGGGTAGGGAGTCAGGCTCCAGTGAGGGGGCCCTTTCACCT
CTTGTGAGCAGCATCGTATGAGCCTGTGTAAGGCCGTCTGCCTCAGACCCTGCTGCCCCA
CCAAGCTGTGCCCTCCCTGCCTTACCCCCTTCCTCTGTATTAAAGTCTCTTGGTACTGGG
GCAGCACACAGGACTGATGTCATGGTAACCCTGCAGAGGTGATGCAGGCCTGGCTTGAGG
TATGAAGGCTGCCAGTGCACCCCGCCACTCGTAGTGGGGACTGTATAGCTGGCCTCAGGG
TGTGAGGTTCCTGGGTCTCCTGCCTTGTGGGCTGTCTTGTGCATGACTCTAGCATGGAGT
CAGTGGAGGTCCTGGCTTTGTCTCAGAGTTAGTGCAGAGCTGATTTAACAAGGGGAATTC
TGAGGCCGGCTTTAGGTCACCTACCTTGGAGCCTGTAGATGAGGGGTGATTGAATAGGAC
CTCTAACCATAAACAATCATTAAGCCGGGTGTGATAGTGCACACTTGGAACCCCAGCTCT
TGGCTGAGGCTGGAGATGAGCATTCAGGGTTCGTCTGGGCTGTGGGAGAGACCTTGTCTC
TTTTATCAGATGGCTGTGGGGTGCCAGCAGCGTCCTTAAGCTCATTCTCTTCTCTCTCTC
TTTCTCTAGAAACTTGAAGGGTCTAAGTGCAAGGGGCAGCTTTTGATCTTTGGGGCAACC
AACTGGGACTTGATTGGACGAAAGGAAGTGCCTAAACAGCAAGGTAAGAGACTTGGTTCT
GACCCATGATTGGCTGATGCTTAGAAAGCAGGGGGCGGGTGGGGTCCTGGCCCCGCCCAC
CAGCTAGGTGTTGAGAGAGGCCCTGGGGATAGAATAGCGGCTTGGGACCACAAAGCCCCT
CTGGTGGAGGATGCTGCAGTAGTGCTGAGCCTGGCCTCCTGCATGTCTGTGCCCTCGGAG
TTCGGTGTTGCTCAGGGAAGTTGTGTCCTCAGACAGCCAAGACCCCCTGAGTCTCAAGAT
CTGGTCCTATTCTGTGGTGTCATGAGGCCCCAGACACTTGTCAGACATGATAGCCATTGA
TGTACAGGCTGCTGATTGGCTTGTCACAACTCGGCGGAAAGGGAAACAGTTCGCCACGTA
ACCTGTATCCAGCTGCCTGTAGAAGACGGGGGCCTTCCTGAGGGGCCCCTTGGAGAGAAG
AGGAGCTGGCTCAGCGCCACATTTTATGGCTTGATTTCATTTGGAAACACTCCCAAAGTG
CTTCCCCAGCATCGCTTTGTCTGTGAACAAATATTTGAACACCGGCACACCCTAGCACCC
AGACTTGGGGGCCTGCATGGTACAAATGGAGCTGACCAGATGCCCTTCCTTTTTGTGGAA
GATACCCATCTTTCACCACAGCCATGGACACCAGTCCTGAGAGCAGTGGCCACTGCAGCT
AGACCACACAGGGTTCCTGCTATCCGCTGTATCCATTGCCCTGCTGATACGGCAAGGGCG
CCTTGACCTGACTCACCCTCTGCTTCCGGTGCTCTCTGTGGCCCGGAAGCTGTGCCTCTA
GTCCAGAGCAGACCGGGCTACTTGGGGCATGGCATCTTGCCAACCTAGCCCATCCCAGGG
TACCTCCTGCCTCCATCTGCACAGGCTTCCTGGCCCACCCCACCCTCTGCCTCCCAGTTG
GTGTGAGTGGTTTTACTTGTTTGTTGTAAACACTTAGGTCTGGCTAGGCAGCCTGTTACC
TGGAGCTGTTAGGCAAAATAGAGGAGGGGACACTTACCTTCCTACCCTGCTGGACATTGC
TGCTCTCTGCTCTTAATGTAGCGTGTGGTCCCTGCTGTAGCGTGTGGTGAGGACCAGGTC
CTGGGATCTGGGACCGTGGGATTAGTGTCTACCAGACTGGCTCTGAAGCTGGGGCCACTG
TCTGGTTGTGGCTTTGACTTGAGTGGTTCTGACTGAAACAAGGACGAGGGTTCCTAGTGT
AGGAAACACCCCCTTATGTTATTGTAGCTGATGTGGCACCCTCTTCAGGAGACAGGCACT
GTCAGGGATGATGGAGAGCAGCCATCCCTCTGGGCCAGCTGGTTCAAGAGCCAGGCCATT
TTCTTTTCTCCGGCTGACGCCCAGTACTGCTGTAGCTCACAGTCCTGAAAACCACCTTCG
CTTGCTTGGTTTTCCCCAGTGGCAGGCATGCAGTTCTGCCCCTGGTTTTTCTCCCTGTGT
GTGTTGTCCTCCGTGATTCAGGGCTGATTGGGGCTTCTCTTCAGTTTTGACCTCCTGGGA
GGCCATCTTTTCAGTTCGTCCCTTGGACTAACGATGCTGTTGGGCTTTGCTTTAAAGTAC
TTTTCAGTGGGGCGGCTGCAGCATCTGAGGGGTGCTCTCTGATGCTAGGGACCTGGTATG
CCACAGAGGACTGGAAGGAGGGGTTTGCCGTCTGAATTGTGGCTAGCTGCCCAGATGCCC
ACCACCACCATTCTGGATGTGAAAGAAGAGCCACACCCCTGCCTCAGGGACATGGGAGTG
GCAGCTTCTTGTACCTCTTGGGCCAGGCCCTGGTGAGGCCTGGCCCTTGCTGCCTGTCAT
GGTGGAGGCAGTTGCAGTAGGTGGGGTGCAAATCAGAAGTACAGTACGAAGTCTAATGTG
GGTCTCCCAGAAAGCCCAGGAGGACATGCTTGGGGAAATGAAGGCGGCTAGCAGTGTGGG
CTTCCTGGGTGTAGGTGGGACTCGCTCGGGCAGGGGTGGATGACATCAAGGCCTTCCTCT
GAGGAAGCAGGTGGTTCTGAGGAGGAGGGCACTGAGCCCACTGAGAAAGACCTTTTTCTG
GCTATGGGGAGATCTGGGGTACACTCAGGAGGGTAGACAGAATCCCCAAGGATTCTGTCA
CAGCCCTGCCCTGTAGCAGGATTAGACCAGCAGCTGTTTGTAGGTCTGAGGGAGAGGGAT
TGGCGCCATTAGTGTAGGCCAGTGCCCCTGAGTAGGCTTCTGTGTTTGCGACCCCTGGGT
GATACATTAACCTCAACCTGCCCGGCGTGTTCTGCGGTGCTTGACGAGTGTTCTTCCCTT
TGCAGCTGCTTACCGCAACCTTGGTCAGAATTTGTGGGGGCCCCATAGGTATGGGTGCCT
GTCAGGAGTCCGGGTGCGAACCGTGGTTTCGGGCTCCTGTGCTGCCCACAGCCTTCTCAT
CACCACAGAAGGGAAGCTCTGGAGCTGGGGTGAGTGCTGGTGGGGACAGGCGTGACCTGG
AGCAGGGCTGAGGCCACCTGCAGAGGCCCTGTCTTTTGTCTGCATCCATGGCTGCTCATT
GTGTGTGTGTGCGTGCACCTCAGTTCTTGACTGCCACATGTATGTGGGTTTTAGGGATTG
ACCCCAGGCCCCAGGCTTACTTGGCACGTCCCTTTACCCATGGAGCATCTCACTGGCTCT
GTTCTCCGACTCTGCCTTGGTGAACGTTTTCCTGAACTTGGAAACAAGTGTGGTTTTTCT
GACCCTACTGTCCCTCTGACCAGACTGGCCATCTGTCCTCAACATCTGTCCTTTCACCCA
GCCCTTGTTCTGCTTCAGCACCTCGTGTAGGGAGGTCCATGTTCCCATAACCAAATGCTA
CCCCTGGCTTTTGTGGCGGGTGTGTCTTGAGGCACAGCGGCTGAGCCCATGTGGTTCCCA
GCCTCAGGTCGGAGATTGGGCCATTGTCCGCTCAGTTCCTCCCGAGTCTCCACCTCCCTC
AGCCAGATTCTGATGGCTCTCAGCTGTCCTTTTGCAGGTAGGCCAGGAGGTATTGCCCAA
GGCTCATGTCATCTGACACTCAGGGCTCATGCAGCTGGGGGAGTTGTTTCTAGCCTTTGA
CTGGCTTCTAGTTCATACACTGTTTTTATTTTGGTCTGTTTGAGCCTTTTTTTTTTTTTT
TTTTAATTTCATGAACCGCTGTACCAGAGTCCAAATATATTAACATCTGCCGTCTTCTCT
GCACTTGGCTAATTTTATAATTCTGTTGGAAAAAAATCTAACAAGTGTGTGTGGCCCAAA
TTTATCCTCCCAGGCTTTGGGTGACATACAACATCTGCCCCAGTTCTGTTTCGGTCCTCC
TACTGCTTTGTCCTCAACACTGGCCACGGCCTTCCATGTCAGTATCCCCAGCTTGACACA
CTTCTCTCTGTTCTCCTTCCACTGACAGCAAAGTGCTAGGTTGCATCTCAGGCTGACTGA
CCTTGTGACAAGAGTCAGAGAGGGAGCTCCCTGGAACAGCAGCTAGGGCGTGGAGCCCTG
CCAGGAGGTGTCACATCTCCTGTGAGAGTTCCCCCTGCGAGGGAGGCCAGTCACCCGGTC
TGCTTGCCTCCCTCGGGTGCCTAGGGCTCAGCTGTCACGACACTGAGGGAGACGAGTGTA
AGCCCACCTGGCCTGTGGCTCATAGTCTGCAGCCTTGTGCAATCCCTATGTTGAGTTTCT
TGTGTGCTCTTCTGGGACAGGGTCCTGGGGGCTCTGGTGGGATCTTGTTTTGTATCTCTG
TGGGACCTAGGTAGGATTTTAGGGCTCGGACTGTTCTGGGACCCGCCCCTTGTCCACCCT
AAGCTGAACTAGGGCTCCTAGAACTCCAGTGCACTGTGAAGGCCTTCACAGGGACTGTCC
CTGCTTGTATTTATGTTGAGAGCAGGCCTGTCCCTTGTCATGAGTGTTCATGGGGGTCTT
CTAACAGGTGTGTGGGAGGAGTGGGGAATAGATAAGTAGATATGACCAACAGTAGGCGCA
TCAGACTCCCTGAGAAGGAGGGGACTGTTCCCAGCCACTATTGGGAATGGAAACTGATTC
TGGAGCTTGAGGCCTGTGGAGCACCCAGGTTACACCAAGCATTGCCTGGAGTAGCAGAGG
CTGGGGCTGTATTGGGATGGTCCTAAGCTGACCACTCTCTGTTGGGATATAGTTGGGGTG
GCCCATCTCATGGGGCCCAGCTCCCCTGGCTGGGGAGAGTAGCTGTTAGGGTTTGTGAAT
GGTTTACGAGGGACGAGCGTGGGACCGCCCCAGCCTGTCCTTGCACTGCTTACCTGGCCT
GCGGTGATCTCCTTGCAGGTCGGAATGAAAAGGGGCAGCTGGGCCATGGTGATACCAAGA
GGGTGGAAGCCCCCAGACTCATCGAGGCTCTCAGCCATGAGGCAATTGTGCTGGCTGCGT
GTGGGCGCAACCACACCCTGGCGTTAACAGGTAAGAAGGCTCTTCCTCAACTATGGCGAA
AGGCTCCAAAGATGGTCTGGGAGTGAGTGACAGAAAGATGATGCTTGGTGAGTTAGCGAG
GTGGTTGGTTAGTTAGCCAGGCAGTTAGTCAGGCGGTTGGTCAGTTAGCTGGTTACTTGC
TGAAGGCAGTGAGAGGGCTACGGTGGCCCTGGGAGCCCAGACCAGGGCCTGTGTGTGGCA
GGGCTCAGCTCAGTTCTGCACTCTTGTCCTTGGGATGGACAGACACACAGCCGTGCTTGG
CCTGGTAGGTGAACTGTTTGCAAAGCTTTGATCCAAGTCCAGTTGAAACCATCCGCCCTT
AAATCCTTTTCTGTCCTTATTTGTCTCTCCTTTCAGATACTGGCTCTGTCTTCGCCTTCG
GAGAGAATAAGATGGGGCAGCTGGGCCTCGGGAACCAGACAGATGCTGTTCCAAGTCCTG
CCCAGGTATCAGCAAGGCTGTGGGCTGTGGACTGGGCAGTTTGAGAAGTGATGCTTTGCC
AGGGAAGGTGGAGAAGAGAACCTGTGTGTGTGTCAGCCCAGGAGTGGGGGTGCCAGGTCT
CTTCTCCCTGCAGACACAGCCAACCTGTCTTGCTCCTGAGGCCAGCGGTTGTTGGGGGGT
GGGAGGGTGGGGAGCTGAACCTTGTAGCTGCAGTGCAGTTGGGTGCGAGAGTGAGCAAGG
AAGGAAGGAGCCCAAGCACCAGGTTCCCCTGGACCACCGGGTTAAATGCTTGCTGCTTTT
GTCTGGGCTGAGGTCTGGCCTTTCCTGGGTTTTGCATTTGGTTTCTGACCAACCTTGTGT
TGTGGGACCAGCCTGCCACTCACCCCCTGTCTTTGTCCTTCCTTATTTGAGCCGTTTCAC
ACCTGGCTCCCGCCTTACTGACTGAGCTCTGCGGATGAACTGGGGTCTGGGGGGGCTTGT
TATTCCTCAAGTTGAACCTAATAGCAGTGTTTGCCCCAGAAGTGACCTTTGGTGGGGTCA
CTTGGGTTTGCACTGTCCGTCCCTGTGGTTGAATCGCCAGATGATGTTAACCTCAGCCTC
TGCTGTCCAGGCAGGGTGGGGGTTGCCAGCAGTTAGGAGTCCTGGTACTCTGAGCTCATG
GATACCGTCCGCTTGAGTGGCAGCTCCTGAACTTCGGAGTCCACTGTTGCGAGCGGCCAC
TGTTCCATGCCGGGGCAGATTGAGGAAGAGACTTGTCGAGCTGAAAGTTGGCTGTCTTCT
CTTTGCAGATTATGTACAATGGGCAGCCAATTACCAAGATGGCCTGCGGGGCAGAGTTCA
GCATGCTGATGGACTGTAAAGGGAACCTCTACTCCTTCGGGTGCCCTGAATATGGCCAAC
TGGGTATGGGTCTCTTTCTTAAAAGCTCTGTGATCTCACTGTCAGTGTGGAGCCAGAAGG
CAGCTGGGGCTGTGCTTGTGATTGATCCAGACAGCAGCATCTCGGGCTCAGCAGCTTGCG
GTTAACTCACAGGTTAGAGGGGTCAGTGAAGGCTCGGGGCTGAGTCTGGCTTGGAAATCC
ATTTGTGTCAGTCTCAGGCAGAAGGACAAAAGCTCAGCCCCCTTCATCCGGGTTCACGGA
TAGAAATGAGCCTTTATTGGAAGTGAGAATTACCTAAGACTGAGGTGGTTCTGTTTGAAA
TTCTGGCCAGACAAGCAGCTCATCCCTCACCCCACTGGACTCCGCACTGCACAGAGCAGA
AGAGAAGTGAGCAGGCCTGTTAGAGCTTGCCATGCAAGATCTCCATTTTCCTTTCCCCTC
TGACTCCCAGCCAGTTCTTCCTGGTGCTTTCTGCAGTCCTGAGCAGGAGGTGAGGTGTGG
GCGCCACCTCCTGGTGTCTGAAGAGCCTGCAGCAGTCCGGGATCTGGGTTGCTGGGTCTT
GGCGTCATGAGAAGTGCGCAGATGGGAGGATATAAATAGAAGCAGAGCACTGCACTGGCC
TTAGACTGCAGGAACAGTGACTCTGTGGAACTAAATATACCTCAAGTCAGAGTGGATACG
GAGGACCGGCCCCTTACGCACATCACTGCTGGTTGCCAGGGAGTTCTCAGGGCTGTGGAT
AAACGGTTTCCATGGCCACAGGCGAGCCTCCTGCCATACCCAGGCCTAGTACAGGAAGTG
TGTTTCTGTTGTGTGTGCAGCTTCTCTGCTACTCAGACAAGCCTCCTGCTGCAGCCGGCC
TGTTTGCCTTTGGGGACTTAATCTTGGCAGTTGGATGGTAAATGTGGAGTGGTTTTGGAG
GGACAGTTAAGTACAGTGTGCACTGCCTCCTACCGAATTCTCGTTGAAGTCTAGTAAGGG
ACCTGGCTGCGCCTGCATCTACAGAACCTCTCGTTCTGAACTCGGCAGTTCACTCTGAGG
CAGGCTGGACACCTGTGGTCCCAGCCTCTGAGGGCCAGAGGCAGGACTGTCGCAGGTTCC
AGGGTGGGTTACAGGCGAGTCGGGGTCTCGGAATGAAAGTTGTCTCCAAAAACAAAACAC
AAGCCTAATCCCCCCGTTCTGTTCTTGTCTCTGTTCAGACACTGCTTTTAGAATTCAGAC
ATGATTGCAGGACAGGGCCCTGCAGGTGGTTAGAGCAGTGCTGCTGCCTGGGCAGGGACT
GAGGGTGTCTGGTCTATAAGCAGCCAGCATCCTGGCTACCAGTCCGGACTGGGCCTCCTG
ACTTGTTTTGTTGTTTGGTAGTTCTGTTTATATTTGTTTGGTGGCTTTTTTGAGACTGTG
TCTCACTGCGTATCTCCAGCTGGCCTAGAACTTGTTGTGTAGACCAGACTGGCTCCAGTC
CGATCCACCTGCCTCTGAGTACTGCGGTTAAAAGGTGCGGGCCACCAGGCCATATCCAAT
TTGCTTTTTTTTTGAGACAGTTCATGTAGTCAATGTAGTCAGAGCTAGCTTCAGATTTCC
TGTGTAACCGAGGATGGCCTTTGCTTCCTGCTCTTCTGCCTCTGTGTCCCAAGAGCTGGC
ATACACTACCAGTGCAAGAAGCCAGAGAGGGCTGGGTTCTTGGGCCACAGGCATGTGGTC
CAGGATCAGACTTGGTGCGGTGCTGGGTTGGAGCATGCCTGGGATGTGCCAGGCTGCCTG
GTCTGTCGTGACTTCTCGAGCGTGGTTTGCGAATTCCAGGTTTTTATGTCCTTTGCAGGT
TGCTTAAATCACTGCTAATTTGTAGGTAGAAGTAGAGAATTGTACACTGAATCATCTTGT
CCCCCTTTCCCTACTACTGGTCCTCAGTGCTCCGCTACCTGGGAAACTGTCCTTCAGGTG
TGAGCTGCGCACTGTTGTGACCCTCAGCCACAGGAGGGGGCACAGTCTCCTTTACCTCCC
CATCCATGTGAACACATACAGGGTTTTCCTAAGTTACAGCCTGTGGCATAGGGGGTCCTT
GTTTTCTATGCATGTTTAAAGAATGCCCTGTGTTACCTACCATCTTGTGAGCAACTGGGC
AGGGGCACAGTGGAGTCCTGGGCCTGTGTCTTCGTAACTGACAGCCTGTTGTGCTTACCC
CAGGACACAACTCAGATGGGAAGTTCATCGCCCGGGCGCAGAGGATAGAGTATGATTGTG
AGCTGGTGCCCCGGAGAGTGGCCATCTTCATCGAGAAGACCAAGGACGGGCAGATTTTGC
CTGTCCCCAACGTGGTGGTTCGAGACGTAGCCTGTGGCGCTAACCACACAGTAAGCCTTG
TATTTTTAAGAGCCGAGCTGGTATAGATTGGTTTTACTCAAGCTATGTCATTTAGCTGAG
TGCTGAGTGAGTCTCCCATCAGGATATCCTTTCCTCAACAGACAACATGCAAACCTGAGT
ATACATGTATGTGTCTGCACCCTACCACTGAGGGTACATGTATGTGTCTGTGCCACTTGT
ACGCAACACATAGGGTGTGACTGGTTACCTGTTGCGGTGTCTCCTTAAGGTCCCTAGCAG
AATGACTGGAAGAACATGCGTGCATGTGCTGTTTGTGAGCTCCTTTTTTTGGCATGTGCA
CATGTGCTCATAGTGTGGGTGTGTGTTAAGTCAGAGGATACTTTTCTTCCACCTATGTCT
CAGGAGTCAAATGTCAGTCATCAGCCCTGCAAAGCAAGGACCTTCACCTGCTGGACCCTC
TGGTTTGCTTTGGTGGTGTTGTGGTTATTTTTGCTTTGTTTTTAAGACGGGGTCTGAGTG
TGGCCCTGGCTGTCCTTGGAACTTGCTGGTTCTCTGGGTAATGGGTATGTGCCCTTCATG
GTCTCCGGTTGAGAATCAGTGGGCCTGGTCTGGGCCTTTCACTTTGGCAGGAGAAAGAAG
GCCAAGGGCTGAGCCCCAGAGCTGAGCCTCTTGCCTGCTTGGTGGTGCTCAGTGGATTAA
ATGCAGGTGTCCCAAGCCTGCAAGTCCATAAATCAGCACACTGCTCTCTCCTGTCTCCTG
TGTTGTGTGTTTTGCAGTGCTGGGTACGGAGCCTGGGGCGAGTGTTGTCGCCCTGACCTG
CACACCTTCCGTCCCATGCCGAGGTAGCTAGTTGCCCATTTGCAGGGTTTATTTCAGTAT
GAAACCTCAGAGGCAAAAGACAAGGCAGATTATAAACAGCTGGCACATCTGCCTGCCTCA
CCTGTGTGCACCTGTGGCAGGCAAGCGCAGAGCGGCGACGGCAGCCTTCCCTCCTGTTTC
TACAATTTAGACAGTGTTGTCACCCACAGACAGCCATTTGTCTTCTGCATTTAAAGAGAG
AGAAAGGAAGATCGCACCCTCATAAAGAGAGTGCACACTGGCCCTGCTGGCTGCCATGTA
TAGGCTATGGGACTCCTTTGCTTCCTGCTGCTGTCCCAGACCCTGTGGTCAGAAGCAGTG
GCCCATGCGTCTCAGCCTTGTGTCTCCTCTCACTGCAGCTGGTCCTGGATTCACAGAAGC
GAGTCTTCTCCTGGGGCTTTGGTGGCTACGGCCGGCTGGGCCATGCCGAGCAGAAGGATG
AGATGGTACCTCGCCTGGTGAAGCTCTTCGATTTCCCGGGACGTGGTGCAACCCAGATCT
ATGCCGGCTACACCTGCTCCTTTGCTGTCAGTGAAGTGGGTCAGTGCCTGCACCCTCTCC
AACTTCTTAGGTCCCCGCGGTTGGAGCCAGCCAGGTGCAGGGTTTCCCTCCTGGGGATAG
CTGTCCCCACAGCCCACAGCCGTGTCCGTCCCTCCCTGGCTCCTTCTCTGCGGTGTCCTT
TTGAGCAGCTGTCCCTCAACCTTGGTGTTCTCTGATGATGCTTACTCGTGACACTGCTGT
GTTTTGCTTTTTTTCCAGGGGGGCTGTTTTTCTGGGGGGCTACCAATACTTCTCGAGAGT
CTACCATGTACCCAAAAGCCGTGCAGGACCTCTGTGGCTGGCGGATCCGGAGCCTTGCCT
GCGGGTAAGGGGCTGTCTCTGGGGCACGTGGTGTGAGTGTGGGGTGCTCTGTGCCAGCTG
GTCTGGGTCTTCCTGGCTAGACATAGGAGACACCAAACCCCAAAATGTGGGAGACAGGAG
AGTTCAGGCTTGGTAGATGCTAGGACAGGTGGTGGCTCCTTCCTTCACAGAAAGTAATTT
TGAAAGTTTTGGGAGAAAAAAAGTAGAGGTTGGCAGTTTTCCCTCAGCTTGGAAACTGTA
GGCTTTTAATTTGTTAGCACCGCTGGAGGAGAGAGGAACTTTTTATTTATTTATTTTAAT
TTATTTATTATATATAAGTACACTGCTTATATATACTGCTGTCTTCAGACACACCAGAAG
AAAGCGCATCAGATCCCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGA
ACTCAGGACCTCTGGAAGAGCAGTCGGGGCTCTTAACCGCTGAGCCATCTCTCCAGCCTG
GAACATTTTATTCTTAGTGAAGGACACCTACTGAATCACCCAGTACTTAGAGGTGATAAA
TGTAATGTGTATGAGTTAACTTGGCTCTGAGTTATTGCTTCCTGGTCCTTGCATCCCTGT
CTGTCCCCATCCCAGAGGATCTCCCTCTGAAAGCCCCAGGACAGATATAGGCAGTGAGTA
TTGATCTGCAAACAACTGTGGCCCATCCCTGTCCGGGAAGAGCCACTCAGTACTGAGTTA
GCAGGATAGAGGTGGGTGTGTCACAGTGGGAAGTGAGTGTCCTGGTCTCTGAGGGGATGG
TAACAGCATCTGCCCATTTGCAGGAAGAGCAGCATCATCGTAGCGGCCGACGAGAGTACC
ATCAGCTGGGGCCCATCACCAACCTTCGGGGAATTGGTGAGCCATGGCAGGGCCTGGGAA
CAGGGATGCGGATGGGTGGGCACTGTCCTTGTCACTAAGGACTGTCCCAACAGTCGGTCA
CATTTGGTTTTAAGTGTTAAGACTCTCCTGGCTGTTGCTGCCCATGCTGTATGTAGAAAG
GATGGCAGCTATGTGGCCAGACATGTTCCTGCAGTTGGGCATTGTCCACACTCCCAGGAA
GCAGTGTCGTCCTAAGCTGCGTGCGTCGCCCTGGTGCCTGTGACTTTGTGCTTCGTAGGC
AGACGGGCCACGGTTTGTGGTCTGGGTCAGTGTCCTTAGGCCAGCCACACAGGTCCCTGG
AGGATTTTGTTCTCCCATTTTCCCCAGATCGGGTTACTAGTTTGTTCTCAGCCCCAAAGA
CTGGAGTAAGGGCGGAAGCCACTGCCCTTACTGCTTTCTGTCCAGATGTCCTGCCCATAG
GTTCCAGAGCTCAGTGCACTTTAACCTTTGTGAGGAGGCCAAGGTTGACTGAGTTTTGTG
TATCTCCTGTGGCCAGGACTGCACACTCAGTGTGGTCTGGCCCTTGACTCTGTTTTGTTT
TGGTTTGAGACAGGGTTTCTCTGTAGCCCTGGCTATCTGGGAACTCATTTTGCAGACCAG
GCTGGCTTTGAACTTACAGAGATCCGTCCACCTACCTCTGCTTCCCAAGCGCTGGCATTA
AAGGTCTATGCCACCACACTGGCCTGGCCCTGACATTTCATCCATTTTCTTACTTTATCA
TCCTTTTGGGAGTGGAAGTTTTCTCATGGGACCCAGCAGAGCAGGGCTCTGTCCTTGTCC
CTCAAGATGTCACTGAGCTCCAAGGGACCCCTTGTAAGGCAGCAGAGCAACTGTGGGCCT
TCCTCTGTTTCTCTTTTCTCAGAGAAGGATGGATGCTGCACCCACCCCAACCCCCACCCC
TACCCCCCAAAGATAGCAACTCATCATGTAGCTGTGGCTGGCTTGGAACTCACACTGTAG
ATCAGGCTAGCCTCAACAGAGGTCTGCCTGCCTCAGCCTCCCAAGTATTGAGGTTAAAGG
TGTTCGCCACTACACTTGACTGATGGGTAGTTTTGGAGACCATCAGAAATGGTCTTCACA
GGCATGGCTGAATACTGTGTTCTTTAGTCAATAATTTACACAGCCAGACACCATGCAAGA
GTAAAGTCTTCCTTTAAGATGACCGATATGCTGTAGTTTATGGTATATCACCATCACAAG
TGAGTACAAGTAGGAAAGAAAAAGAAATGGTCTTCACAGTAGAGCGTCAGTGGCATTGGG
GCTTACAGGTCAGCCCGGGCTCTATAGCAAGCCCCTGCTTAAAAAATACTATTGATCTTT
GGGGGCTCGAGATGGCTCAGCGGTCAAGAGCACTGCCTGCTCTGGTGGAGGATGCAGGGT
GATTTCCAGAGCCTATGTGGTGACCACGACTGTCTGAAGGTCCAGTTCTAGGGGACCCAA
CACCCACTTCTGGCCTAGGTAGATACTGAGCACACACGTGGTGCTCAGTCATAGACGCAG
GCAAAATACCAAAACACAAAAAACCCAATGTCTAAAACCTCCTGAACTCTGTATCCCAGT
GTGCTTGGGAGCCTCGGCCAAGAAGGGACGAGCCTGGAGGAGCTGCCCTTGCGGCCCAGT
GCTCCCCAGCAGTTCTTGGGTCAAGGGCTGTCAGGGCCAGGATGTGTTGGGCATGTTGTA
ACATGTTGCTTAGGATTGTGTAGGCCTGACCGCTGTGGGCACTGTCACCAAAGGATCTGC
ACACTTTGTCCCATAACCCACGGTGGCTGGTATACCGGAAGACACACACTTACTTCCCTT
CTGTGGGAACATGCCACAGGCCGTATTTGTCATCACTTCTTGTCATCTCTGTAGGGATAT
GGGGACCACAAGCCCAAGTCTTCTACTGCAGCTCAGGAGGTGAAGACTCTGGATGGCATC
TTCTCCGAACAGGTGAGAGGCGTCCCACTGTTTGTGTCTGTGCTTGTGTAGCATGTGGGA
AGGGTACGTCCCTCCTCAGCAGCAGAAAGGCAGAGAGAAAGCTAGCCAGGGGGTTGGGGA
TTTGGCTCAGTGGTAGAGTGCTTGCCTAGCAAGCACAAGGCCCTGGGTTCGGTCCCCAGC
TCTGAAAAAAAGAAAAGAAAAAAAAAGAAAGAAAGAAAGCTAGCCAGACCCTGGTGAACT
TCCGGGTGCTGTGGTCATCACACACTACCCGTCCTCCCAAACTGGGATCCTTGCCACTGG
GCTAGGACCAGGGACTAGTCCCTGAACAGACAATACATTTGGCATGTGTTTGGTGGCAAG
TACAATGTGGAGCTACACCCCAGTAAAGGTTCTTTGAGCTTCCTGTGGGCCTGGGGGTGG
GGCTTGGGTTAGTGGGGAGGAAAGGGTTTCCCTTCATGCAGACCCTGATTGAGCCAGGCC
AGCACATGATATCAGACATACATGATGTACCTGTTTGTTTCTGCAGGTGGCCATGGGCTA
TTCACATTCATTGGTGATAGCACGAGATGAGAGCGAGGCTGAGAAGGAGAGGCTGCAGAG
GCTGCCTGAGTACACCCCACGCACGCTCTGAGCAGCAGCAGGCCGGCACTCCCCTCGTGG
CAGCTGTCATTCCCACGTGCACTGGGACCAGACGTCAGACAAGGAATTTAGGAAGCAAAA
GTTGACCAAGGGTGCATTGGGTTAGCCTCCCTGAGGTTCCGTTTCCAAGCGATTCAACGT
TAACTACCTTTTCTGTATGCTTTCCAAAGTGTTTTCCCTCAACGTTGATTAAAACATTTG
CTCATAGCCAGCTTGCCTTTCTACGAGACAGGCAGGAGCTCCGGGCGGTTTAGGTTTTTT
TTTAAGTTGTATTTCTTTTCTCCCCTCTCTCGAGTACCCTTGTGCAGCCCTCCCATTCCA
GCCATAATTAGCATTGTGATCCGAGTGGGCGCCACATGGGAGAGGGATTGCCACTCTCCC
AGACAGAAACGGCCCTTCCAGGAACCAGCAGCAGCTAGGCCAATCCCTGCCTGCCCGCTG
TGAGAGACCAGTCACTTGCTTGTGGGCCCACCCACCTGCCCTCTGACCCCCTCTCCCCCA
TAGCTATTGCTGGCTTGCTGTCTGCAAGGCCCATGTGGGCCTTTTGGCTGAAGCATTTGT
AGAACCAGCCATCTCCCCCTGGTGGGGCTCTGGGGTCTGTGTTTAGCCATTTGTATCTCC
TTTAGCTCTCAAGTCCAAATGAGAATGGGGACCATGGGGTATGGGGTGGGCAGTTAGAGA
TTGGTCAGCTAGCAGTCAAATGTGTTCTCAGTCCTCTGTGACCCGCAGTTGCCGCCTTTG
CGCTTTGCCTGTCTGCTCCTGCTGTCCCCTCTGCCTGGGATGGCCACCCTATCCTGAGAC
TTGGCCATTGTTCTCCCAGCCTCAGTGTTCTCTGGCCGCTGCTTGCGTTTGCTTGGCTCT
GGTACCAAATAGTTGGGATTCCTGATGAAATTCCCTGCCCTGCGTGTCAGTTCAGACTGT
CACCACATCCCCACAAGTGCCCTCTGCCGAGCCCATCCTGGCATTGACTTTGTGGCTGAG
TTCCAAGGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1018, 1449..1542, 3845..3988, 5838..5969, 6336..6424, 7208..7322, 9483..9649, 10838..11018, 11238..11343, 12143..12215, 14094..14171, 14686..15790
1001..1018, 1449..1542, 3845..3988, 5838..5969, 6336..6424, 7208..7322, 9483..9649, 10838..11018, 11238..11343, 12143..12215, 14094..14171, 14686..14790
AC_000073.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved