Rattus_norvegicus Locus Pabpc4
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Pabpc4
Rattus_norvegicus
Pabpc4
5
SNORA55, SNORA55
9107..9238, 10764..10896
17389
TGTCCTCTAAGGACATCTCTAGATGGAGCTCCCTTAGACAAGAACCCACCTTTCTTTTC
CTCTTCCTCCTTTTGCCTGCAAAGCATGAACTAAGTTGTAGGAGTTCCACCAGAACTAAA
CCGGAGGGGACGGATGAGTTTTGTTTTTATCAAAGCTTTGCTAAGATGTGTTCATCTTTC
CAGAAAAGTCTTATCACCTAAGATACTACCACCATTTCTAATGACCTCCACAATCCAACC
TCAAGGTTATATGTTCTTAAAACTTCCGTATGTCTTGCGTATTCAGCTCACCATGTATTG
GGTCACCTGTTAGCTGTAATTTAGCATCGCTTTGTGTAGATGTAGGCATTTCATGGATGT
TTTAAACATTATACCTGTGTGTGGGTGTTGGGGAGGATATGGCTCAATCCATACATCGTG
GAAAAAAGAATCATACAGGTGCGAACGACCGGTCCTCCAAACGCAAGGGGTCGCTGTGAC
ACCTTTCGGCCGCTCCAGGTCACTCTCGCGTGGCTGCCCCGCCTTGGGCCCCCGGGCAGA
GTGGGCGGGCACGACTGCGCCCAGGTCGCGAGGCGCCCTTCGACCAGCAGCGCCCGGGGC
GGGAGGGTATAAATGGAGCGGTGGCTGCTTCAGCCGCCTCTCTCCGCCCCGGGTCGCAGT
CGCTAGTGCTGCGTTTGGGCTCAGCAAGCCTAAAGCAAAAAAGAGAAAAAGCTTAAAAAA
AATTTAAAAAAGCCTCAAAAAACCCTAAAAAAAAGAAAAGAAGAAAAGAAGAGAAAAAAA
AAGAAAAAGGAAGGAAAAGAAGAAAAAGAACGAGACCGCGACTTGTGCTGGGAGCCCGCG
GGGAAGTGACTTTCACAGCTTCCGGCCTGCCTGTCCGTCGGCGTCTGTCTGTCCGTCCCG
TGGTGAGCCGTCCCCCAGGCCCGGCCCGCCCCCGCACGCCTCCGCGCCGCGTGGCAGCCC
CGCGCCCCGGCTGGCCGCACCACGTGTCCGCGCTGCCCTTCGCCGGCACCCGCAAAGATT
TGGTTTCCCCCTTCCCGGGCCGCTGTAATTGTAAACCGCCGGGAGCCCGGGGCCTATATT
TATCGCGAAACGCGTGTCCCCAAGGCCGCTGTGAGCGCAGCATCTGGCTGCCTCTAGAAA
AAATTTTTGCCCCCTCTGCAAGGGGATTCCCTACTTCAATTTTTATCTTTTAAGCTCCAA
GCCAGGACAGCTGGAGAGTACAAACTCCAGGAGAGGGCCATATTGTTTTTGAGAGCCTTT
TGTCTTGGGGCTTTTGCGGTCCGGTGTAAGTCGTCCCGCACTCCGGTCCCGCCTCGGAGC
CTCCCTGCTCCAGCCTCTCCCAGCGTCGCTGGTGCCACCTGTGCGCTGCGGCGCGTGCCA
CAGCTCTTCGGAGCCCCTTTTGTCCTGCAGTAGGCCCTGCAAGAAGTCCTGGCGGGGCTC
GGGGTAGTAGGGGGTGGGGAGATGAACGCTGCGGCCAGCAGCTACCCCATGGCCTCCTTA
TACGTGGGCGATCTGCACTCCGATGTCACCGAAGCCATGCTGTATGAAAAGTTCAGCCCT
GCGGGGCCTGTGCTGTCCATCCGGGTCTGCCGCGATATGATCACCCGCCGCTCTCTGGGT
TATGCCTACGTCAACTTCCAGCAGCCAGCTGACGGTGAGTAGGAGCGGTGTGCACACATT
CGGGAGATTCCTGGGGACCTTGGGAGTGCTGTAGGCGGAGGCCAAACTGCCAGGGCTGGG
GAACATACTAAATAGCATGTAGCCAGAGAAGCCTGGATGGAAGCACGAGGCAGAGGTTGA
GCCAGGCATGTGGTCACGACCCCGGCTTCAGTCTTCCACCACTTGGTAACCTGATGACCT
TGGGCTACTGGGTGGGGGTGGGGTAGAGCAGGGATTGGAACCCAAGGAGATTGGAAATCG
GGATCCGAATAAAGTGACTTGGCTATTCTAGTGTATATATAACCCCCTTCAAGTAGAAGT
GGATCTGTTGTAGACCCTGGCATGAATTGGCACTCCTCAATGGATTGAAACAACACCCTC
AAAAGTATAGGTTTCAAGACTGCTGGCCCTAACCTAGACTGACGATTTGAGATGGCTTTA
GGAAGCAAGGTGAGCGGTTTCCTGCTGTGGTCTTGAGAGGGGAGTAGCTCCTAGTGTTGC
CAGCAGTTTCTATCAGACCCCCCACCTCCTATCCCTTTGGTAAGGGGTTTGCTATGCAGT
TTTGGTGACTTGCTCAGCTGCATGAAGCTCTAGGGATGTAGAGAATGGTACCCAGGAAGT
CTAGGAAGGTGTCACTTGAAACAGTACTGGGCAATTATTCATCTCACCTGTGCTCATCAA
GTTGGGGTGCCAGGGAGTCTCCTGCCATCCCTGTGCGGGGAGGGTGCAGGCAAGCCACAA
GCCCAGAAGAAACCCAGTCAGGGGCTGCACATGACTCCAGATTAAAAGGAACCAGCTGTA
GAAACTGGCGTAGGGGTGGGACACAAGCCATTCTGTAGCAAATGATCTTTAGTCCCTACC
CCTGTCTGTCCCCACTCTTGGTGAGGCAGAAGCTTCCTTGCCCAAGTTGCAGCTGAGACC
AGAGAGGTAGGTCTAGTTGAGATGCTAGGTAATTTCTAGTATATTGATCAAAGCACTTGG
AGCCTAGTTCTGTTTGTCCCCAGGATATAAGGGGGTTGTGATGGAGTCCCTTAACTGCCT
GCTTTCTTGACTTCTGAACAAAAGTCCTGTCTCTTAGAAATAGCAGAGGCCATTGGTCAG
TGTGTCTGCCAACACATACCTCTGTAAGACTTCTCCCTGCTATAAATAAGTTCAGCCTGG
TTTGTCAAGCTAAGCTGACTCCGACAGTGTCTGAAATAGATCAGGAGAATTATGTTGGGG
TGGGCTCCTTTCCTGCTAATATGATGGGATAGTTTGAGTTTGTAAACTCCTGCAGTCACT
TAAAGGCACGTTCCTACCTGACCCTTCCTGATCTGTCCTGCCATCCCCTCTGCCTAGCCA
CCGTCTCCCACACATGCCATGGGAAAGGTTGGGTGTAGATCCTCTTGGCTGATTGGACAG
TTGAGTTTGCTGGGCAGTTTTAGGGAGCTTTTTCTCTTTTCTCTTGGCAGTGCTAGGGAT
TAAACCCAGGGTCTCAGCACATTGAGCAACTAACATATGCTAGGCTTTGTCCCTCCGAAG
TACCTGTGGTAGGCTGAGAGGTTTTGTTTTTGAGACAAGGTCTCTATGTAGTCCTGGCTG
CCTTGGAACTCACTATGTGAAGTAGACCAGGCTGACCTTGAACACACCTCCATAGACTTG
TCCTATGACTTTCCTGGGGAGATGCAAGTCTTCAAGACAGGATTTCTTTATGTAGCCTTG
GTTGTCCTAGAACCGTCTCTGCCGATGTGGCTAGCCTATAATTCACAGATGGCCAGCCTC
CGCCTCCCAAGTAAGTGCTGGGACTGAAGTATGATACCATGCCAGGAGACTTAGAATTCT
GTACAGCACATAGCCAGGGATGACTGAACTTGTGGTGTTTGTCTACTCACCGCACATGGG
AGCCCATGACAGACCAAAAATACAAATACCACCAAGTCCAACTTTATGAATTTTATCAGG
GTTACTTGGAGGAGTATGGGTGAGGGGTTGCTTACAGAAAGCTGGGAACCTGGAACACAG
TGCACAGCTGCAGGCCACAACAGATTGGAGAGTGACCTTTCCAGGTGCCTCAGTTGTCTA
GATCTCTTCCAGGCCGCTTGGCTCTTTCCTGCTTTTTCCAGGAAGCTGGTCTGGTCCTTA
ACAGTTTTTACAGCTTTTCTCCTGAGTGTCTTGGCAACCCAGCTTCCTTCCCTCTGAGGG
GGGGCTATCAGCTTTTTATTGTAGGGTTGGCCCTAGTGAATCTGATCAGTTTCAGGGACT
TCCTGAAGCTAATTAAGTTTTCATGTTCCTGCTTAATAAGGAGCTTTCTTCAGGTTGGGA
AGTTTGTACCACAGTGCCACTGGGATTAAGAACCCCATGCCCAGCTGTCTAATTTGACTG
ACAGTCACCTCAACCAGGCTGACCTAACTTTGTAATCTTTCTGTACTGTGGGTTTAGACT
TGTCACCTCACTCTACCTTAGACCCTGTTTTAATCTCATAGAGGGTGCTTGCTTAGGTCA
TGACACTGCTTCAGTGAAGTCACTGGTCATATCCTTGTTGCCACCAGCAAAGTGTGGCAT
TGTGGCATCAGGACTTTTGGTCCTTCCAAGTCTCAGGTGCCTGGTGGGCTTCCTTGGGCA
GTCAAGGAACAACCCAACCAGCTAGAAGGAAAGAGTAGCTAAATTCTTAGGATTCTAAAG
ATTTCCAATTAAACCTGAGCCCTGGGATAAAGGTGTGGCGGTTTATCCTACTTTTAAGTT
TTGTTTGGTTTTCAGTATAAAAATAGACAAGGCGTGGTGGCACATGCCTTTAATCCCAGA
ACTCAGGCAGTAGCAGACAGCTCTCGAGTTCAAGGCCAACCTGGTCTAAATATAGGTTCT
AGGACAGTTGGGGCTATAGAGAGACCCTGTCTGGAAAGTAACAGTAAGGATTAAAAAAAA
GTGGATGGGGGGCTGGGGATTTAGCTCAGTGGTAGAGTGCTTACCTAGGAAGCGCAAGGC
CCTGGGTTCGGTCCCCAGCTCCGGAAAAAAGAACAAAAAAAAAATGGATGGGATCTAGTT
TTCGATGCATTAACTAGGAACATGAGCTTAGTCCATGGTGAGAGTCTTGGTTCCCTGAGG
CCATCTTGATACTTCAGAGATCTTTCTGGCATGGCAACAAGTCTTCTTAGTTGATTGGCA
TTCTTAATGAGTGAGTGTTCCTCCTTGACAGCTGAGAGGGCCTTGGACACCATGAACTTT
GATGTGATTAAGGGGAAGCCAATCCGGATCATGTGGTCTCAGAGGGACCCCTCTTTGAGG
AAGTCTGGTGTGGGAAATGTCTTCATCAAGAACCTGGACAAGTCTATAGACAACAAGGCA
CTGTATGACACTTTCTCTGCCTTCGGAAACATCCTGTCCTGTAAGGTAAGCGTCCGCCAA
GGACTGTTGGCCGAATAGGAGTAACTGCTGCTTCTTGAAAACAAGATAAATGCTATGGCT
GGGTGTGGTTTGTGCTCAAGGCTGCTGATGGGAGCTATCTAGGGAGTTCAAGGCCAGCCT
GGGGATAGCATCAAAGGGAGGGTACCTTAGAATTCGGGACAATTGGGTGTGATAACTTTC
CTATCACTGAGGGTGTTTTGGCTTGGTTTTAGTGTTAGCATTTTGGTGACCTGTGGTTTC
GTTAAGGCATTTCACACATGTGCATATGTATCTTGATCATGTCATTCCCCAATTCTTAGC
CTACTCCCCATAACCCCATCCTAATTCTCGACTAACCCACTGCTATCTTTGTGTGTGCGA
CCCAATGCATTTCATTAGGGTTGTTTACAACCCCCTCCCCCATTGCTATGTAAACCTCGG
GTCTAGTGAGCTTTACCCACAGCCCTCTCTACTTTTTCGTATCTCACCAAGGTGCCTAGT
GTGGTCTTGAACTTATGGCTGCCCCTAGTCTCCCAAGTAGCAGTTAACTCACCCACTAAG
CTGGATCCCACTCTGGGAATGGAATTATCACAGAAGAGCATGTGGGGAATCTTAGCCACA
GGTTTTTTGTTTTGGGTTTTCGAGACAGGGTTTCTTTGTGTAGCCTTGGTTGTCTAGAAC
CATCTCTGCAGATGTGGCTAACCTATAATAACTCACAGGCGGCCTGCCTCTGCCTCTCGA
GTGCTGGGATTAAAGTATGACACCGGGCCAGGTGACTTAGAGCTCTGTATGGCATATAGC
CAAGGATAACTGAACTTCTGGTGTTCGCTAAGATTACAGGTGTGTGCTGCCGCCCCCAGC
TTGTATGGTACAGGGTTGAGGCAAGCAGTCTGCCAGATGAACTCCAGCTACTTGTAAGGT
GTTTTGTGTACTTTCATGGTACCGACTGTTGAAAGTTTCCATTTGGGATTGGGGTCAGCA
GCCCCTTGTTTCTGGGAACCTTACTCAGCCGCTAACCTTCACATGGTGGCTGCTGACACA
CTCAGGACTTGACTTTTGTGCACTTGGAAAGCACTTTTCTGAGCACCTTGGTTTGTACCT
GATCTTTCTGGTTTTTCCCTGTTTTCTATGCTGTGATTGAACCCTTTGCAGTGCTCGAAT
ACTGAGCTAGCCTCCAGTCCTGCCCCCTCTTTCATTAAGTTTTTATCTATGAACAAGTTG
TATCTGGGTGTTGCCTGTGGATCCCAGGGAATGAGCCAAAGACTTTTACTCATTGAACCT
TCTTTCCCTTAAACCCCCGCCCACCCCCATACACACTTTGAGCAGCATCTTACTGGGCTG
GCCTCAGATGGCATGTTGTGTGGGTGAGTGACCAGGAAGATGATCAAGGTTCCCATCCCA
AGTGCTGGTATTACTTTCTTTCTTTCTTTTTTCTTTTTTTTTTTTTTTTTAAATAAAGGA
GCACTTGAGGGGAAAAAAGGAAATTTCCTGGGCTAGGCAGGAAATTCATTTGGTAAAGTG
TTTGCTGCATGGGAAAGGATCTGAGTTACATTCCCTAGAATCCTTGTTAAAAACTGGGCA
GGGGGGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCGCAAGGCCCTGG
GTTCAGTCCCCAGCTCCGAAAAAAAGAACCAAAAAAAAAAAAAAACTGGGCAGGGGACCA
TCCACCCATGAATGCATGATACCAGTGTTGCAAAGGCAGAAACAGGATTCCTGGGGCTTG
CTTGTCAGTCTGGAGGGAACCTGTATCCAAAAAACCCCCTGAGGCTCACCTTGCTGGCAC
AGAAACACAATGTGGGCCAGAAATAGACTAATCATGGCAGCCGTTGGAAAGCAGGGTACT
TGGTAGTGCTGGGTCCTGTGAGGTCCGTACATCTGGCCAGTGGCCCCCAGGTGACCTGCC
TCCTCTTCAACAGGTGGTCTGTGATGAGAACGGCTCTAAGGGTTATGCCTTTGTCCACTT
CGAGACCCAAGAGGCTGCCAACAAGGCCATCGAGAAGATGAATGGCATGCTCCTCAATGA
CCGCAAAGTGTGAGTGTCCCAGTCTGGAGCGACAGCCATCGCATGAGCCAGCCATGGCCC
CACCTCGGTATTAACTGGCACACACAAGGCGGCTACTGGTTCTCTCGGCCCAAGTGTGGC
CTGCTCCTACCTCTCCACTCCAGGGCTGGTGAGTCTCCCTGCCCGAGCCATGGCAGCCCT
TTTGACTTGCCACAGTCGGCTCCCTGCCGAGCCATGGCCTGCCTGCTGCCTCTCCCTTAA
GGCATTCATCTGGGTTTTGTGAGCGTCAGCAAGTGGGGCTGGCTAGAAGACAGCTCTGAG
CCCACTCTGAGCAGGGGTCTCGGCCAGCGGCAGAGTGGAGAGGCCCTGGGCTGACCAGGA
GCTGGATATTAGTTATAACCTCAGCTTTCCTTCAACTCATTCCTACCCGTGGGGCTCTTG
CTAGTTTTTGGCACCAAATTGTCCTCTAGTCTTTCCTCTGAGCTGTGACATTTCACTGTC
CGTTGTTTAATTGGCATACTGTGAAAAAAAGCTCATCCCTTTTCGGATCATTACTGTGGG
GTTGGGGACAGCCATGGGTATTTTTTTTTTTTTTTTTTTTTTTTTTTGCATTTTGTACTA
TTGCATTTTGGCTATTACAAGCAACAATCATTTCTGTCCTTTGGGGTGTGGAATAGGCAA
GGCTTCGTGTATGTCTGTGTCGGGTGTGTGGACATATTTTCCTGTCAAGGTTACCGAATG
ATAAGCAAAGGTCACCTGATTGCGGCCGTCCCGCTGCTGGACTTAACCACTGTTAACAGT
TTGGTTTATATCCTTCCAGACGTTTTCTATGCATTTACATAGATGCACAGAAATGAACGT
TTTAAAAACATGGTCTTCTGGTTTCTTCACGAAGGCAGTGTGATGTGGTAGGAGTGGCCC
TGGTCTGAACCAGGAGCCCTGGGGCTGGTCCCTGCCAGACAGCCCCTGTCTCTTTCTTTT
TCTGCTGGGGACTTGGGGCATCTGAGCTTGTTCTTGTGGTGGATGGGGTCCTTGTGTGTG
TTAACCTCTCCTGCCGGCCTTTAATCTGCATTCCTGGAAAACTGTGTTTCGTTCCTTCTG
CGTGATCACCGTTCTTCGTGGTTTCTTTGTAGGTTCGTGGGCAGATTCAAGTCTCGCAAA
GAGCGGGAAGCCGAGCTTGGAGCCAAGGCCAAGGAATTCACCAATGTTTATATCAAAAAC
TTTGGAGAAGAGGTGGATGATGAGAATCTGAGGGAGCTATTCAGCCAGTTTGGTAAGTTG
AGGCCTGGAGCCCGCATGCCCACTCTTGTACTGACCATACCAGGCTTAATCCGTTTTTCT
TTCGGCAAGGACACTAACCTCAGGGGGTGGAGGGTGAACATAAAAGTCCAGGCCTTTTTC
TCTTGGCTTCATCTCCGCTTTTTCCTTTGTAAGGTAATCCCAGAAGCTTGGTGGGGTTTT
AGACCAGATTTGGTACCTCTTTCTGTCTCAGACCCATCTGGGCTCATCTGGAGATTTGTT
CCAGCTGAGTTAGGAGCAAGAAGTCCTCGTGAGCTGTGGCAGACGTCACTAACTGTTCTG
TCCTGTGGTGATAGGTAAGACCTTAAGTGTCAAGGTGATGAGAGACTGCAGTGGGAAGTC
CAAAGGCTTCGGCTTCGTGAGCTATGAGAAACATGAGGATGCCAATAAGGTAAGAGCGCT
GTGAGGGTCGAGAAGAAACTGGGCGGCACCTAGTGCAAAGTAGAGTAGCTAGAGGGGGCT
CAGTGGGTGTGCAGCTCTGCCCAGCATCCAGTTAATGATCTGTTAACTGTCAGTTCAGAT
ACTGATGGAAGATTGGGGCAGGTGGTTGTCCCCATTCTTGGGTAGAGAAACTGAATCCTT
TAGGTAGGGCAATGTGCTGGACCCTTAACCTACAGAGGGGCCTGAAAAGTTGAGCGTTAT
CAGATCATCAGTCAAGACTCACCAGCCCTTGCCTAATTTTTATACAGATACTGTGTTTAG
AGACCACCACTCCCCACCACCGTACACACATACCCTTTACACCCTCTGCACTCAAATCTT
TCCCAGGCCTGCTGCTTGGTGCCGGTCTGGGGACAGGCAGTGCAATAGTAGAGCAGAGGA
AATCCAGACGGGTTGTTTCCATCTGTCCTGGGGCCTGTCTCTACAACTCTGCCACACTCC
TTGAGAATGAAGGTGTTTTTGAAGATGCTGAAGCTAGGGGTGGGAATTAAGGGAAAAAAG
ATGTCTGCATCAGTAATGACCAGTAACTCATTTAGGTGCTGACTCCACTTCCCTCCTGAG
TGGGGTTATAGTGTAGCAGACTTCAGTGTCCATCAGTCCATCGAGAAGCATTTTCCTTGG
TGTGCTGGGCTCTGCTACAGAAGATGGCCAAGTCTCTGTGTTACGTATGTCTTCAATTAA
AGACGTACATCTTCTCTCTCAGGCTGTGGAAGAAATGAATGGAAAAGAAATGAGTGGGAA
ATCCATATTTGTAGGCCGTGCTCAGAAAAAAGTAGAACGTCAGGCGGAGTTAAAACGGAA
ATTCGAACAGCTGAAGCAGGAGAGGATTAGTCGGTACCAGGTGAGGCGGCTGCCTTCTCC
AGGGTGTGGTGCCAGTGGTGCTGTAGACTTCTGTGGGAAGGGGCATTCCCCTGCAAAGTC
GGGTTTAAAGGCTGGCACCTGCCAAAGCATTGCCGGGTAGGGCCGGTGATACAGGCCTCT
GTTCTGAAAGTGTCCACACACTGCTCTTGGCTGTGTGGGTTCATTTCCCTAAGATGCCCC
TTTAGGCGCAGCAGCTGAAAGAGCCCTGTAGGGTGAGTGGTTGGCCAGAGCGCGTATGGG
AAAGTGATGTGGCTGTATCCATGGCTCTAGGGCAGGAGTTTCTCACCGTGGGCTAATGTC
AGTCCTGCAGGGGTGGGGATGTTTGTCCTGATTTGAGGCAGAGTTTACTATAACTCGGGG
TGGCCTGGGGGAAATCATTGCATTAGGCTGACCTAGATCTCTAGCAACCCTCCTTCCTCA
AAACGGGTTAGAGCCCCAACTCTGGAGCCTCTAGGTTTTGTTTTTTAAGGTAGGGTCTTG
CTCTGTATCCTAGGCTGGCCTCAAACACTCAATAGTCCCTTGCCTTGGCCTCCTGAGTAC
AAGAAGGGTCACAGGCAAGAATTGTTTTTGGTTGGTAGGGTGGTTTTTGGTGAGACAGGG
TTTGTTGTGTAGCCCTATCTGGCCTGGAACTCACTCTGTAGATCAGGCTGGCCTCAAACT
CACAGATCCACCTGTCTCTGCCTCCCAAGTGCGGGATTAAAGGCATACACCAACCACTGC
CTGACTTCAGGCAAGAGTTTTAACTTGACAGGTCCCCAAGTGTGTTGGGAAATAACTGTA
TAGAGATGTATTTAACAGTAATCCCCTCTCCAGGGAGTGAATCTCTACATTAAGAACTTG
GATGACACCATTGACGATGAGAAGTTAAGGAAAGAGTTCTCACCCTTTGGATCAATCACC
AGTGCGAAGGTAATAACGTGTGCTAGCATGGGTTTGGAAACAGTTTTTTCTGTCGTTGGG
TCAATGGCGTTAGTTAATTGTGTTGGTGGTCCAGAGTACAATGTTCTAGCATGTTCCTCC
TTGCTTCAGATATCTGGAGAAGGTTTGTGATTGTATGTGTTGTCTACTTGCACTGGGGCT
TGGAGTCTGGCCCAGTTCCTCACAGCACTCAAATCTTTCCCAGGCCTGCTTGCTTGGTGC
TGGTCTGGGGACAGGCAGTGCTATAGTAGAGCAGAGGAAATCCAGACGGGTCGTTTCCAT
CTGTCCTGGGGCCTGTCCCTACAACTCTGCCACACTTCCCCCCTTGAGAACAAGGTTTTA
AAGGTTTAGTGGGCCTTTGACAGGAAAGTTTGGCTGGACAGCCAAGATCATGCGGGCATG
GTCTGCAACGGGACCTTAGCACTTGGGGAGTGACACTGGTCGAGGTAGTGGCCTGACACT
GCATATTGCTTGGTGGAGCACACAGCAGCTACCACACAAGGCCTTTAAGTTGTGAAAAGG
GTTGAGTGGTGGCCAGGTAGGGTTTGGCCTTCTGTGTAAGGTGTTGGTATTGGTATCGGT
TTTTCGTTGGTTGTATTTTCATACAGGGTCTTGCTATGTAGTCCTGGGTGATTAGAATTC
ACTATGTAAACCAGGCTGACCCAAAAACTCAGATCTGCTTGCCTCCTGGATGGCTGGCAA
GATGGTGTATGCCACTATGCTCTGCTGTGGGTATTTTATTTAAACCTTTTGGGGTGCTGG
CAAAAGAACCCTCCTTGCTTCAGATATCTGGAGGTTTGTGATGGGGGGTGGATAGCCCTG
GCAAACATTTCCTGGTTCTTCTTGGTGTCACCCACTTAACTGGCCCTGTTGGTGTATGCC
TCTGCAAAGCCATATACCTTTAAAGACCAGGCAGATGACAGGGCACTGTTCCATGGGTAG
AAGACTGTTGACCTAGTAACACACTGACCTTGGAGGATTAAAGAGGCCAACACACAAGGC
ACAGGAAAGCAGTAACCCCTTCAGTAAAGAGAAAGACGTTAGAGGCTGGCTCTGCAGAGA
CTGTGATGTATTCAGAGTTAGTTGTCTTAGAGTGTGGGAACCAGGGCTCAGAGGGGCTGG
TAAGACTGATTAGACTCTGTTTTCCTGTCCTGCCTCCCAGTGACATCCAGTCTCTTTCCG
TAGGTGATGCTGGAAGACGGGAGAAGCAAAGGGTTTGGCTTTGTCTGTTTCTCCTCTCCT
GAAGAGGCAACCAAAGCGGTCACGGAGATGAACGGACGCATTGTGGGCTCCAAGCCTCTG
TACGTCGCCCTGGCCCAGAGGAAGGAGGAGCGGAAGGCTCACCTGACTAACCAGTATATG
CAGCGTGTGGCAGGAATGAGAGCGCTCCCTGCCAACGCCATCTTAAATCAGTTCCAGCCT
GCAGCTGGTGGCTACTTTGTGCCGGCAGTGCCACAGGTAGATCTGCTAGGCAATCTCGGC
AGCTGAGGGAGGGGTGTTTGGGGACTAGTGTTGAAGTAAGAGAGATGAATTAACCTGTGG
TTACATCGCCAATGAGGTGGAATAACTGTCCATTGACAGTCCTTCCACTTTTGAGTAGAA
TACTAAGTTAATCACCCAAATATTGACCCAGTGTCCGGGTGAGGGCAGTGGGTGCAGGTT
CTTAAGACTTGGATTCTTTTCCCCTACAGGCCCAGGGAAGACCTCCATATTACACACCTA
ATCAATTAGCGCAAATGAGGCCTAATCCACGCTGGCAGCAAGGCGGGAGACCTCAAGGTA
GGTAGCAGGAAGCAGAGCCTTGTTCCTCGGGCTATGCCTGTCCAGTAGTTCACCGGCTTC
TCCTGCAACCCAGCACCTGGTCCATCCTGGCTGGTCCGTGCTGAGTGCCCTTGTCTCTTC
AGGCTTCCAAGGAATGCCAAGTGCCCTGCGGCAATCTGGGCCTCGTCCAGCTCTTCGGCA
TCTGGCTCCAACTGGTAATGCTCCGGCCTCTCGTGGCCTTCCTACTACCGCTCAGAGAGT
CGGTGAGCAAACTGGCCTGTAGGCGCATGGCCGGGGAGGGGGGATCCAGATGACTGGCTC
TGATCTGCCCTGGCTTGGTCAGTCTGGGTCTCGTTTTTCCTGCATCCTTAGCTGTGTGCT
TAGGTAGTTGCTTCTGCCTTCACGAGCAGTGACTGTGGGTCCTGGTGTGTTGGTCACTCT
GAACACTGTCTGCTCAGCGGGTGTCATGTGAACGGTCACCCAGAAGTACTCTGTCTGGAT
GGATATACAGGCACCACGCTGTTGAGGGTGGAGGGACGAGGAGACTCTCATTCTAAATGT
GCAAAGACGTCTGTGGTGTCCTTTGGCCCTGTGAGGGACATGTGTGGTCATGTGCTGGAG
TTCTTCCATGGGACGTGGCCAGTTGGGCATCTGCTGTCAACACTGATGTGCATTTGCTGG
TCTGTTGTAGGGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCC
GCCCAGCAAGGGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGGTGCACACAGAAG
GGGGAAAGCTGGGATTTTGACGGGCCTTTGCCCAGGCTGATGCGCTTTAATTACACTTGT
TCTCTCCACAAGGCGTCCCTACGGCTGTGCCAAACCTTGCACCTCGTGCTACAGTCGCTG
CTGCTGCTCCCAGGGCTGTGGCTCCATACAAGTATGCCTCCAATGTCCGCAGCCCTCACC
CTGCCATTCAGCCGCTGCAGGTGAGGCACAACAGAGCTGTGAACTGTGAAGGGATTTGTC
CTATTTCTGCTCCATTTTAAAGATGCCATGTTTTTTGATTCCTCTTAAGTGTTAACAGGT
TCTTACGACACCTGTGCACGCTCAGCTCTTGCCTCTGGGTTACCTTCACATCTGGTGACC
TAATTGATCCTTGGCTGTTTTACAGGCAGTTGGTAACCTCTAGCTTTTCTTCAGGCTAGG
GACTGACAGCTCAGTGGGCAGCCCGTTAAAGGCGCAAGCTCAGACTTGGATCCCCTGAAC
CCATATGAAAAGGGGTGGGGAAGTGGACAGTGTGCTGTGTAAGCATGGAGACCTGAGTAG
TTCAGGTCCCAAGCACACATGTAAGAGTTGGCATTGTGGGGCCAGAGAGAGATGATGGTT
CTTGGATCTGCAGGCTGGCCAGGAGAGCCAGAGTGAGCTCTAGGTTCCACGAGAGACCGA
GTCTTAGAGAAGACACCTGACAGTTCTCTGGCCTACGTCTGTGCACATGCCACATATACA
CACATAACACAGAAAAGGCTGGACAAGGTGAGAAATCTAAACAGGAATCCCTGAGGCCAA
CCTGGCCTGGCCTACTGGGCAGATTCCAGACCAGGGAGGGAGATGACTTCCTTAAGAAAG
TGGTGGTGATGCCTGAGGAACCAGGCCCCAGGGTTGACCTCCCCTACATCGTCAAACACA
TATACAGAACACCCAACAGAAAGCTTCCCAGAATATTCAGAGGTTAAGGTGCCTAAGCTG
TGACCTAAAGCATAGCCACTTTCAGAACTTGGTGGCAGTTTGCTATGACTGGGCCTCACC
TGCCCAGACAACTTCAGGAGTAGAAGCTGCTTTGAATTATTCTTAATAATAGTCTCCCTT
CTCATCATTCTCTCCAGTGGGGGTTTCTTGGAACTTGGTGCTAATTCACCTGTAACACCT
TTTTATGGTTCTAGCAACACTGTTGCATATATTAATGATCCTCAAATAATTGCTAATATA
TTAAAAACACCTAGACCAAGCCCCAGTCCTGTAAAAGAAAAGGTTGAATTTACCAGGGTA
TTATTAGCATATCCCAGAATCCAGGTGCTGGGTCAGTAGAGACAAAAGGATTAGGAGTTA
AAGGTCAGCACCTACTGAGGCCAGCCTGGGTTCGGAGAGGGTACACAGAAAACCCAAACA
TCCTGTACCGGGGGATAATGAAGTATGGTTAGGAATGTTTTGATTCTCACTCTTTGGCTC
CTGCCTCTGTATGTACTGACAATAACGTAAGGGAGGCATTGAAGAGAAGTGCATAAATAC
TGTGAAGTACGCACGTGTAATCCCAGCCCTTGGCCCTTGGCAGCAAGGGGATCAAGGCCA
GCCAAGACTACATGAAAATCACAAATTATGTCTCCCGGGGCCTGGTTTTGACTGCAGGGC
CTTGTGTTGTGAGGCAGGTTTGTTGGTCAGCATCTTCCCCTTCCAATAGCTTACAGTACA
CAGCTAGCCAGCTTTGTCTTTGAGCACAGGACTGCCACCTCCGCTCCCTTTCACATAGTC
TTCCTTAGTGCTAACCCCACTGCCTCTCCTGGTTCACAGGCCCCCCAGCCTGCAGTCCAT
GTCCAGGGTCAAGAACCCCTGACTGCCTCCATGCTGGCTGCAGCTCCTCCCCAGGAGCAG
AAGCAGATGCTGGGTAAGTTCCATGCTTGGGAAAATGTCAGTCAGTTGGTGCTCACTGGG
ATTGGACACTTTTATGATGGCAACTGTTCTGCCCACAGGGGAGCGTTTGTTCCCACTTAT
CCAAACAATGCATTCAAACCTGGCTGGAAAAATTACAGGGATGCTGCTAGAAATCGACAA
CTCTGAGCTGCTCCACATGCTGGAGTCCCCCGAGTCCCTCCGTTCCAAGGTGAGCTGCCT
TTCAAGACCCTGTGACATCACGGTTTAGCTTCAGGGAATGAGCTTGGGGGCCGTCCAGAG
AGAAAGGTCTGTGGCCCCCATGGCCACCCATGTCTGATTTGAGCTACTGCTAAAGTTGTT
GAAGAGATAGCACCAGGAGGAGCCCGCCTGGGGGATCTTCTACTCATTGACCACGTCTGT
GTGCCAGGAGAGACAAGTGGGTCACTGAGCACCTGGGGTGGCTCCCCTCAGTCTCTGAAC
ATCTGGGCGTCTTCCACAGGTGGATGAAGCTGTGGCAGTCCTGCAGGCTCATCATGCCAA
GAAAGAAGCTGCCCAGAAGGTGGGCACTGTTGCTGCTGCTACCTCTTAAACCAGAAGTAT
GTTGACAGTTGACATTTTCTGCCTCTCTGGTGTTTCACATAGGGCCTTACTTAGCCTATG
CCCCAGGATGATTCACTCAGCCTCCAGGATGCTGGGGGGCTACGTCCATGACTATGTCTG
TAATCCCAGCTGTCCACGTTGGGGAGGCAGAGCCCTAGTACCCAGCTGCTCAGTCTGAGC
AACCTAGAAGCACCTGATCACATGCTTGGCCACCACATAGAAATGAATAATCTCCTGGCC
TGACATAGTGGCAGTCACATCATAAGACCTACCTGCATCTATGCATATCTTATACCTTGC
TAGCTTGGCCTGAGGTGGGTGAGATTGTGTCCTGCCAAGCTGGGAGAGCAGTGTGCAGAG
GGATATTGGTCTTGTAGGACTGGTACCTGAGAGGTGATGGACAGTTGAAGTCAGGGCGGG
ATGGGGCAGCTGATGCTGATGGAGTTCTTATAGCGGGCTGCTTATTTGTGTTGGTGCTGC
TCTCTTTCAGGAGTCAAAAGCCAAATAACCCCTCACGGCATTCAGCTGAGGTCTGAAGAC
TTCCTAGTTTGTCTGTGGACCTCTTTCAAGAACCAAGTTACAAATTCAACAGGTCATTTT
GTATCAAAAGGTCAATTATGAAGCACCTAGAATTTTTCAATTATAAGAATATATTCTCTG
GGTTCTGTTGTGGCCCAGATGATGGTAACTTTTTTTTCTATTATGAGTTCTGTTTTTTTT
CCCCTCTCCCAGAAATTGGTTTTGATGTACCCAAGACTTAAGTTTCTCAATAAAGGAAAT
AAAATCTCCAAGTCTGGCTGTTTTTATGTGTTGCCAATCAGTTTTATTCTATATCTTGGG
CTTTTTTGCTAGAACTACTGTTAGTATTAAATGAATTTACTTTTTCCTTTTTAGGAGGAT
TGGGTAAGCAAGCATGCAGTAAGTTAATGTGTCACTGGGGTGGAGCTTGCCTGGCATGTG
CCAGGCCCTGAGCTCATGGCTGACACCTATGGTCCTAGCTGGAGTCAGTAGGAGCTACAG
GATAGTGAGACCCAGTTTGAAGTCAGCTCAGCCCAAGCCTGAAAAAATGAGCTGAATTGA
GCCATCAGAATGCTCTGCATACCATGACAGTATACTTGAATGTAGAATGCTCAGACCAGC
AAAGTCTAGGCCCCTCGGGATTGCTGCAAACCCTAGGGATCCCTAGTCAAAGCCTCCACT
CTCTTCCTGGAGTAAAGTTTGTCTCCTGGAGTTACCTGCTCACGTCAGCAAGTGCAACAA
GGCTTCAGCTCTGGGAAAATGCTCAGAAATCCTCTGATAATTCTGTCTTAACAGCCAAGC
CTGCCTCCAGGCTATGGGTAGGTTCCCTTAAGAGTTCTCTCTTTAAGTAACTGGTCCAAA
AACCCAAACTGGAGTCTTTTTTTTTTTCTTTTTTCTTTTTTCCGGAGCTGGGGCGCAAAC
CCAGGACCTTGCACTTCCTAGGCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCCAA
CTGGAGGCCTTTTCAAGTGTATGTGGATATTCATGGGTCCAAAGACTGTAGGAGCTGGAG
GCTGGAGTAAGGGGCAGTTGAAGATTCTGACTCCTGCCTCAGGTCCTCTGCCCTGAGGCT
GTAGCTAAGTTGCTAGTCTTAATGTGTAATAAAACAGCTCTAATATTTCTGGACACATCG
AAACCACCTTAACTCCAGAGGATCTGAGTCCTGCCCTTGGGCACCTTCACTGGTGTGTAC
ATAGAGTTAAAGCTTAAAGATGGGGGTTGGTAGAGTCACCTGGCCCTTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1653, 4831..5024, 6973..7088, 8192..8331, 8654..8748, 9502..9639, 10473..10568, 11763..12035, 12269..12356, 12482..12601, 13030..13116, 13212..13339, 14919..15012, 15098..15228, 15499..15595, 16090..16389
1461..1653, 4831..5024, 6973..7088, 8192..8331, 8654..8748, 9502..9639, 10473..10568, 11763..12035, 12269..12356, 12482..12601, 13030..13116, 13212..13339, 14919..15012, 15098..15228, 15499..15585
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved