Rattus_norvegicus Locus Eif5
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Eif5
Rattus_norvegicus
Eif5
6
SNORA28
3862..3987
10041
AAAACAAAAATTGATCTTTCCATTTTAACCTTCTTAGGAATTCGACTGGCTCAGAACAA
AGGGCAGTCAGTCCCTCTTCCATAACACTGCTTTCTCCCCATCCAGAAAACCACGCAGCT
GCTGACTACACCAGGCTGCTGCTCTCAGAAGCCTTAGGAAGGTGGAACAGGTATTTCTAT
ATTATTTTAGTTGGACTCTGGTATGATTTCAAGTCTCAGTTGAAACTTGTACAAAAAAAA
AAAAAAAAAACCAACCTAAGTATTTTTTTTAAAACAATGGGAGAGTGTCTACAGACCAAA
AAGTCGGGGCTCTTCTTCAGAACATAATTGTTGGTAAATACAACATTGTTTCCTCATCGG
GTACACCTGCCAGGAGCCACAGTCACTAGCCTGGACTTTACAGATTGGGCTGTGCTGGAC
AGAGTGGCCCTACGTGGCGGCTGAACACCGAGCCAAACTCCGAGGCACAGCCGGACTTTA
CTGGGGTCGAGACCACACCACGATGCACGAGGGCCCAAGTTACACACAAAAAGTGGCGCT
TCCATCGTGGGAAACCTCAAACACTGAGTCTCGGCTAGTCGGTGGCCTTGCTTCCCGAGC
TCAGGAAGAGAGGCACCATATGGAATGACAGACACCGGACAGAGAGTGGAAAGGGTGGAA
GGGAAGAGGCAGGGGGAGCGGCACTTTCGGGAGCTCCTGGCGAGGTCTGGAAGCGCAGTT
AGGTCCAGCGTGGTCGACAGGAACACACTGTGGATATGATCGGCTCCGCCCCGCCGGGGG
AATGAGCAAGCGCCATATTGCCTGAATACCTAAACTTACAGCGAGCCGGGCTATCGCGAG
ACCGCAAAGACCTCTGGGAGGGACAGAGGGGGAAGGGAAAGGAAGGAAGCTAGGACAGGC
GGGAGGCGGGCCGAGACCAGGAGTGGAGCCCCAGGAAGTGGAGGGCGGGGAACTGTGAGA
TTGACGTGCCTCCAATCCAATAACAAGACAAGTAGGGAGGGTCTGTGGCCAATAACCAGT
TGCGGCCCGCTGCAGGGGGCGGGACCCGGGGCCGAGGGTAGCTTGAGCGCGGCGGCGGCG
TTGTTCAGTCAGAGCGAGAACATTCCAGAGGTGAGTCCGCGGGGGGCGGTGGCCCGTGCC
CCTGCCCAGCGCTCCCGCCCCTCCACCCCGCGGGCCGCCGGCGGGGGCAGGCGCCGCCCG
CGGCTCACAGCTGTGTCCCCGCCAGGTCGCCAGGTTCGGCGCTGCTGGTGTGGACGCGGA
CGTCGCTGGGACAGTCCCTCCCCCTGCTAGGCGGCGGCACCTGCCCAGCCGCCCCTCCGC
TCGCCGCCGGCCCCGTCGCTCCGGACCCGGTTTCCAGCGCCTCTTCCTCCCAGTCCCGGG
CGAGCCGCGTTGGGTTTATGTCTTTATTTGACGAAAACGGTGAGTCGCGGGCGGCGGGCC
ATGGCGGCGGCAAGATGGCGGCGCGGCCGCGTGACCTGCCGCGCGTGTGGCGCAGTTTGG
GGGGGCCGGTCTCTGCGGGGACGCGCGCGCGCGCGCGCTGTGGCCGGGCTGAGTCAGGCC
CGGGGCGCGTTTGTGACTCAGGGAGGCCGCACCTCTGCCCCGCCGGCCGCCGGAAGAGGG
AGGCCAGGCGATAGGCTCTTGACTGTCGCGTAGCCATGGGGACGAGGGCGAAGGTCGGCC
GTGCGCTGAGGGAGCGAGCGAAGGGAGCCCGGGCGCGGCTTCGGCCGCGTTCCTCGTGCT
CCGACGGAGCCAATGGCTCCTGGCCTGGACGTGCCGCCCTGAAGCCACTGGAGTCGCCGA
AGCCGCAACTTCGCGGTTGGCAGGTCCGGCTCGACGTTTCCCGTTTTCCAACGATGGCAG
CCAGGGAAGGCGCCATTGGAGAAGTTGGTGACCCACAGGCTTGAACTGAGGGAGAGAAGG
GTCCGGATCCTCTTTTCGGCAGTTACAACGTGGTCGCTCGGCAGGGGCAGCCCATGACTC
GCCGGTGGTCTTTGAGCTGACAAACTCACAGCCGCTGAGGGAGCAGGGTTTGTGTTTCGT
GTTGTTCTCAGTTCCCTGCCACAGTCACAACTCTTGTCAAAATGGTGGCCTCCTGGGTTC
CCGGAGTTGTGCTTCTTTACATGGGAATGTCAGCTTTTTTTCTCACAGGAACTCGGACTT
TTAGAGCTAGGGGTGTTAATCTGTGAGCTACTCGGGGGGTAGGAAGTTATTCCAGGTAGG
AATGATACTAAACCCGTAGGGTTGTTGTGTGTTCTCTGCTTTTCTCTTTCAGAGCTGTTG
CGCAGCCATTGGTACCTGTATTGGGGAAACATAGCATACAAGCAAGAAGCTTACAGCCTC
AGTGGCGAAAAATTTTTCATGTCAGAGACCGAGAACTCTTGCAGTCGTTTATGTCATCCC
TTCTTCTCCAGACAGAAGATACCAAAAAGTTGCAATCAAAGATCTGTTCATCTTATTGAT
AAAGTCACTAATAAGCCAAAATGTCTGTCAACGTCAACCGCAGCGTGTCAGACCAGTTCT
ATCGCTACAAGATGCCCCGTTTGATTGCTAAGGTAATGCTGGTTTTTTTTTTTTTTTTTT
TTTTCAATTTTAGTAGTCTGTTGGTCCCACACACTCTTCATAGGTTTTGAAAGAATGCAT
TTTACAGGGAAGACAGTGCAAAATTGAAATTCTTATTTCCTTTAGGTTGAGGGCAAAGGA
AATGGAATCAAGACAGTTATAGTCAACATGGTTGACGTTGCAAAGGCGCTTAATCGGCCT
CCAACGTGTAAGTAAAGCTTGGAGAAGCCTGAAAAGGTATCTTATGGATATAGTTTTCAC
AGTCTTTAAGCTATACATCTTTCTTCAGTCATGTTAATTAGCAAGTGTGGAACACTGCGT
GGACCTATTGATTGGGTGTCATTAAACCGCCGTGGCTGTGTTTCAGTTGCCCTGTAATTT
TAACACACGGTGAGTTTGTATAAATGTTCGTGTGCAGCCAGTGCTTTAGTTAACTATAAT
GAAATTTCTCATCTTTATATAGATCCCACCAAATATTTTGGTTGTGAGCTGGGAGCACAG
ACCCAGTTTGATGTTAAGAATGACCGTTACATTGTCAATGGATCTCATGAGGCGAATAAG
CTGCAAGACATGTTGGATGGATTCATTAAAAAATTTGTTCTCTGTCCTGAGTGTGAGAAT
CCTGAAACAGATCTGGTGAGTTCCTTCAAGGTTTTTTTCAAGACTACCATGAAGAAAATT
TATGTTAAAACTAGTTAGTGTTAGATGCCGTCTGGCACTTTTATAATGTAACCAAAACTT
AGGTACAATTTCCATCTTTAACTAGAGATGACTCTTGTTTTTACTTTTCTTGACAGCATG
TCAATCCAAAGAAGCAAACAATAGGTAATTCTTGTAAAGCCTGTGGGTACCGAGGCATGC
TTGACACACATCATAAACTCTGTACATTCATTCTCAAAAACCCACCTGGTAAGTCTTTTT
AATAAATTGACTAGTAGAATTTTAAAAAATTAAGATTTTGGTTACTGTACAGTACACAGT
ATGAGCTCTTAGTCCTAAGTGAGTTTTATTGTGTGTGTGTGTGCGCACACGTGTATGTTC
TTCAAAACAAGGTTTTTCTATATAGCTCTGGCTCTCCTGGAACTCTGTAGATTAGGCTGT
CTACATATTTTGTCTCTGCATATTTTACATCTTGGGATTAAAAACATTCACCACCATCCC
TTGTTCTATTGACTTTTAACTGACTATAAGACATTAAAAAATGTCTGTCCTCTTATAAAA
GTGAAAGGGGGGTGCTAAACTAGAGGTCTGTTATTGAGAGTCAAGGCTTGTATATTACAC
TACAGTGACCTTAAAGCATTGCAAGCAACACTCTGTGGCAGATGAACAAAACTGTCTGAC
ACAATTTGAGCTTGCTATAGCAAATAAGTCTAACCTATTCCGGTGTTCTCTTCTCTGTGA
GACAAGCCGTTATATAGGCTCAAACAAACTCTTAATTGCTGATTTGGTTTTAGATGTGGT
TTTGTTTAAATTCATGGGGAAAACTACAGAATATAAACCTCCTAATCTTTAATAGCTCCA
ATACTGTATCAGTACTGCTTCACCTTATTTTATAGCCTGCACAATGTAGTTAGTGAATTT
ATTTGATGTCTGAATACCTTCAGAATTCTTTTTTGTTTTTTTCAAGCAAGACAGGGTTTT
TCTGTAATATCTCTGGGTGTCCTGAACCTTACTCTGTAGACCAGGTTGGCCTCTAACTCA
GAGATAACCTGCTTGCTGCCGCCTCCCAAGTGCTGGGATGAAAGGCATGCAGGGTTGTTT
TATTGAAGTGTATTTTTTTGTGTGGGTGTTCTGTGTGTGGGTATGTCTGTACCACATGCA
TGAATCCCCTGGAACTGACTGGAGTTATGGATGGTTGTGAGCTACCATATGAGTGCTGAG
AATCTGAACTTCCTTTTTTTTTTTTTTTTTGGAACTGGGGACCGAACCCAGGGCCTTGTG
CTTCCTAGGCAAGCGCTCTACCACTGAGCGAAATCCCCAACCCCTGAACTTCCTTCTTAT
GCAGGAACAAGTCCTCTTTATTGTTTACCAGCCACTCCCTCCAGAATTCGAAGTTGTGTT
TTATCATGTTGGCTTTTTCTGCAGAGAACTACGATGGTGAGAGGGTGGAATTTAAGTCTG
ATAGTAATACATAAACCATGAGACTAAGTAAGCTAACTCTTACTTCCTTGTAGAGAATAG
TGACATTGGTACAGGAAAGAAAGAGAAAGAAAAGAAAAATAGAAAGGGCAAGGACAAGGA
AAATGGCTCTGTATCCACCAGTGAGACACCACCACCTCCACCACCAAATGAAATTAGTCC
TCCACATGCTGTGGTGAGTTTAGTGTTCTTCAAATAGTGTTGAAAACCCTGATATTTGGT
TAAATTTTTAAATGTATTAATATAGTTGTAGCATTGTGCTATTGGCTGGTGGATAAACTG
AATTAAACTAAACTATTTTTAGGATCCTTTTTCCCTGTTTGCCATTTTGTTTTGTTTTTG
TTTGCTCTGATGTGAAAGATAAATATTTTCTGGTTTGTGGGCAAAGGTGCTTGCTTGATC
TTGTCAAGATGACTAATTCCTTTGTGATCTTTTGTGTGAATAGGAAGAAGAGGAAGATGA
TGATTGGGGGGAGGATACAACTGAGGAAGCTCAAAGGCGCAGAATGGATGAAATCAGTGA
CCATGCAAAAGGTCTGACACTTAGCGATGATTTGGAAAGAACTGTAGAAGAGCGTGTTAA
CATCCTGTTTGATTTTGTTAAGGTAACTTTTTTTTTTTTTTTTTTTTTTTTTGTTCTTTT
TTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCGCTCTACCACTA
TGCTAAATCCCCAACCCCCCAAGGTAACTTTTTATAGTTAACATTTTCTCTGGTATCTTT
GAATTCATTTTTTCAGGGTCTCTAGCCCTGACTTTCATGGACTTGATAGACCAGGCTAGC
CTCAAGCTCTCAGAGACCTGAGCCTGCTGAGATTAAAGGCATGTCCCACCACACCATTCT
TTGAATATTAATGGAATGCTTGTATTTACTTCCTTGATTATGCAAGAAATGTACTAGAAG
TAGTACAATGGGTGTTGAACTGTGATAAATTGGGTATAAATTCTGGAGAAGGACTGTTCT
CACACATAGCAAAATATGCCTGTATTTTATATTGAAATAATCCTTTATTTCCAGAAAAAG
AAAGAAGAGGGCATTATTGATTCATCTGATAAAGACATTGTGGCTGAGGCAGAAAGACTG
GATGTAAAAGCCATGGGCCCTCTCGTTTTGACAGAAGTTCTCTTTGATGAGAAGATAAGA
GAGCAAATCAAGAAATACAGGCGCCATTTTTTAAGAGTAAGAGATTTTGGTTTATTATTC
TTGATTGTCACCTTAGGACTGTGGCTTTAAATTGCTTCAGACAACTATTGTTATCCTGAA
AATAGATAATCCCCACTTTACCAAGTCTGGGAGCACCTGCAAAGGGTAAGGGTACATTGA
CTTTTTTGGGCTACTCTTTCATACTCTATGCTTTAAGAAAATGAATGTACATAGGTAAGA
ATTATAGAACAGGCAGATAATTGCTGATGTTGTCTACCTGCAGTTTTGTCATAACAACAA
AAAGGCCCAGCGGTACCTTCTTCATGGTTTGGAATGTGTGGTAGCAATGCATCAAGCTCA
GTTGATCTCCAAGATTCCACATATCTTGAAGGAGATGTATGATGCAGACCTTTTAGAGGA
AGAGGTCATTATCAGCTGGTCAGAAAAGGTAAGGAACCACATAAGTTATGTTAAAATGCT
TCAGAAGCATCAGAATGGCTATTGGGGCATATGTTATGAGGAAGTTGTGTCTAATAGACG
CAGTTTTCTCTATGATGTTGAATTCTATACTTGGGTAATGTGTATGTGTGTTCTGTCTAC
TGAAGGTTAGGGTGTGAACCAAGCCCTTTAAATAGCTAATTCATTGTACATGTGACTTAA
ATTACATTTTTCAAATCTTCACCAAGAAAATTCTGGGCTTTTTTTAGGCCTCTAAGAAAT
ATGTCTCAAAAGAACTTGCCAAAGAGATTCGTGTCAAAGCAGAGCCATTTATTAAATGGT
TGAAGGAAGCGGAGGAGGAATCTTCTGGTGGTGAGGAAGAAGACGAAGATGAAAATATTG
AGGTAAATGCTAAAAAATGTTATTGAGTACTTGGTTGTCAATGGGTATTGCAGGTCTGCC
ACACATGAATAGGGTTTTGTGTGTGTGTCCCTGGCTGGTCTGGAACTCAGCTGCCTGCTG
CTCTTAGTGCTAGCTAAAGGTGTGCGCTGCTCTGGGGAGAGGGAGTAGAGATTGAAGGGT
AGTTATGACTAGACAATTGGGATGGTTCCAAATTTCAGTTTAAGGATACAACAAAATGCA
ATCTTTCTGTGAGTGGGGGAGACAGTTTTTGCATGTAGTTCTGGAAAGTGAGCATACTAG
GTAAACAAGCATTATCTGACCTTGAGCCCTTTTGAGCCCTGGAAATACTAATTCAATTTC
AATGATGACATTTTCTCCCTACACATAATCAAAGTAAATAAAGCCGGATATGATGGCATA
TACCTTTATCCTGGCACTCGGGCAGAGGATCTCCTGATTTTCAGGATAATCAAGGTGTTA
TGCAAAGAAACACTGTCTTAAAAAATCAAAAAAAATTTTTTTTCTTTAAATAATGAATCT
GGGGGTTGGGGATTTAGCTCAGTGGTAGAGCCCTTTGCCTAGCAAGCGCAAGGCCCTGGG
TTTGGTCCCCAGCTCCGAAAAAAAAGAAAAAAAAATGAATCTGAAGGTCATCAAAAGGCT
TGGAAAGGGAATAAAGGGAAATGAAAATACTGTAATTGTCTCAGGTGAAAAAATTGTAAT
GGAAATAATATAATCCTGTATTTGTATTGCCAGGTGGTATATTCGAAGACTGCCAGTGTA
CCAAAAGTTGAAACTGTGAAGTCTGACAACAAGGATGACGACATTGATATTGATGCCATT
TAAAAGGATGGATGCAACTTAGCTTAACAGTGTAATGCTGCAAATTTTTCTCCATTATCA
GCCAGAAGTGCAACATGTATGTGCAAGAGCTAAAGTGGTTTAACATCATGCTACACTTGA
TACTAAAAAGCTATTACTGTGAGTGGTCTATAATTAAGCCCAATGAGACATCTAGGGAGT
CCATACATATCAGTGAGCAGTTGTAGTTTGCTTATTTATAGCATGTTTCTTTCGGAAAAA
CTAGTGGTGGACACATTTGGATCACATTTATACAGTTATAAAAAATAAAGATTTGATTTT
GGTCATTCTTCAGACTTTGGGCTATGAATGGCTTATGCTGAAGTAATTGGCTACTTTTAG
GATGTTACACCATTTAATAACTTAGACTTCTTAAGTTTGGTAGATTGTTAGGTACTGAAG
ACTTGAAGAATGCAAACAATTATAATGACCTTACTCAGCCATTAAGAAATGAAGTATTTT
GAAAGTTGTGTCTCCAGTCCATTGAGATTGGCAACTGACAATTCTTGTCATTCTAAGGAA
ATTTGATGATTTAATGACAGTGTGACATCCTCATGAGAAGTAAAAATGACCTGTGTGTCC
TATGGTTTAAGAGCAAATTTTGAAACTTGGAGTTGTGGTTTTTCCAGTTTGTGTACACTC
ACCCCAAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTACTTGTC
TTCAATATTAAAAAACATAGCACATTTTTCTTTCTACAAAAGTACATTCTGGAGTTAAGA
ACCCATGTGGTTGATTTGTGTGTGGCGTGCTAGCTCATACATTATTTGGATCTTATTCTT
TGTGTCATCCATCTCACAGATTATAAGACTTTGATTAATGTAAAAAGTATGCGTTAAAAT
CATACCAAACATTTGGTAAAATTAAAACCTTGATAGGAGGCTGGGCGTGGAACAGGAGCC
ATATACCTGGAATGGTAACAGGGGAATGTGCTGTGTCACACCAAAGAAGTGGGACTTGGA
AAGTCACTTGTCTCCTGGGTTTCAGACTCTTTGTTGCATGGGCAGCCCATCCATATGTCA
TTACTTTTTGAGATTCTCAAGTAGATCAGCACATTTCGGCCTCAGGTTGGCAAGATTTTG
TCTTAGAGCTGTTGCTTTAAAGGGAAATGGTCAGGTCTTAGACACTTAGGAAGGTCTTGG
GCTTCTGTTCATTCTGGTGCCAAACCAGTGGGATTCAAATTTCACACAATCTGGGTTTTT
ATTCATGGAGGTTAACCTGGTAAGAGTAATCCTTCATGGCTCTATTGAGGTGTCTTAAAA
AGTTTCCTGTTTCAAACAGCTACATTACTTGATTAAAACAATGTTATAAAATTAAATTTC
TGTCTGCTTTAATATTAAAAAGGTATGTTTTGATTTTATTGTAAGTAAAAAGTGCTGAAT
GTTCAAGATTATAGCCCTGGGATTAAAGGTGCAGTGGTAGTTCTTGTAATAACCAGCAAG
GAGCTGGCTGGGCCTGAACAATAATTGAACCTAAAACCTAACCTGGAATGTGACCTCCAT
GTACCTTATGGGGGTAGTAACCCATGTGCAACCTTTTGAAGCTCAGCTGGAATGCCATAA
GACCAAGTACTGGAGCAGACAACCATGGAAGAGCTCCCACTATAGTCCCCTGCTTCACTT
TCACTGATCAGAAAAGGTGCTATGTGCCTTATGTCAGGAGTGGTGGGGAGGGGAATGTTT
TTCCTAGAAATCATTGATAGCGTTGACTGTACAAACCTTATAAGGGGCCAGGAGCATGCC
CAGTAATAATGCCACTACAAACCCGCTAAAAAGTTAACAACCGTTAAATACAGTGAAGAT
GTGAGGGTTTACTATGTGTGAGTTCTGTGTAGAAGTGTTCACCTGGTGAACCAAAACTGA
AACAAGCACCCAGTACCTGTGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1109, 1225..1418, 2272..2551, 2685..2766, 3022..3194, 3356..3467, 4733..4872, 5143..5301, 5754..5915, 6163..6327, 6587..6721, 7473..8228, 8812..9500
2480..2551, 2685..2766, 3022..3194, 3356..3467, 4733..4872, 5143..5301, 5754..5915, 6163..6327, 6587..6721, 7473..7562
AC_000074.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved