Rattus_norvegicus Locus Odc1
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Odc1
Rattus_norvegicus
Odc1
6
SNORA42
2183..2316
8400
AACTTTGGTGGGGGCTGGGGATTTAGCTCAGTGGTAGAGCGCTTACCTAGGAAGCGCAA
GGCCCTGGGTTCGGTCCCCAGCTCCAAAAAAAAAAGAACCAAAAAAAAAAAAAAAAAACC
AATGTAACTTTGGTGGATACAAATTCACTGCCCAGACTCTTTTCCGGTCCAGACTTCTCA
AAGTGACTTAGTTGTAGCTACCCTGAAAGATTTAACAGAATAAGGGACAGCTGTTGGCTT
GAAACCCCTCAACCTCTTCCCTAACATGCGACTCTTGCTTAGATAAAAGGCATTATCTTA
GCATGCAACTGGTGCCTAGAATCTAGTTGGAAGCTACCAACGTAAAACGGAGTGGCTCTC
CAGCCTCTGCTGGCTTGTCTCTCAGCAAGTTTTCAGGCATAGGCACACAGGGTGGTGAAG
CAGGGTCAATCTACACCACGAAGTCTAGTCTACGTGGCCCGCACACAACTCAAGGCCCAT
CCATCCTCGGCTCGCACCTGCGATCCCGCCAGGGAATAAATACTACGCGCTGAATGCAAA
GCCGAGGAAGAGTTTTGCTAGTCTTCCAGGCCAGGGCTCAGCCGTTAGGACCCGGGGAGA
GACTGCGTGATTGAACCGGTTGCAAGACGGACGACCAAGCGCCTGTGCGCATGCACCGGC
CGAATCCCGCCTGCTGCCCATAGGACCCTGCGGCAAGCTGGTAGTCAGGACTGGTGGTGT
GGTGCGCGTGCGCGGGCCTGCCGCAGGGAGTGTCCGGCACGAGGCCGGGCGGGGAGCGCG
GGCGGATGGGCGGGGGGCTGGGCACGCGCGGCGCCCCGCCCCACTGACGCGCCGGGCCCG
CGCCTCCCGCCTCCGGCGTCGGGAACCGGGTTGGCCGCCAAGGAGTCCCCGCCCCTCCCC
CGCGCCTCCCGGCCGGAACCGATCGGGGCTGGTTTGAGCTGGTGCGTCTCCATGACGACG
TGCTCCGCCTATAAGTAGCGGCGCGTCGCACCGTCGGGCTTTGTCAGTCCCTGCAGCCGC
CGCCGCCGGCCGCCTTCAGTCAGCAGCTCGGCGCCACCTCCGGTCGGCGACTGCGGCGGG
CTCGACGAGGCGGCTGACGGGGCGGCGGCGGGAAGACGGCCGGGTGCGCCTTGGGGTTTA
GTGGCGGCTTCTCCATGGGTCCAGCCAGCCGCTTCCCTGTGCTGTGAGGTAAGCGGGGCG
CGGGAGGATTGTGCGGCCACGTGTCGCGAGGCCCGGACTGCGGTCGCCGGCAGGGGACAC
GTGGCCGGAGGCTGGTGACCTTGCGAGCCTCCGCCCTGAAGGCAGCAGCTGTTCCTGGCC
CTTGGCTGCAAGCCCTCGGATCGCCCCATGGGAGCCCGCATCGTGTCAGCCGGGCTCGGC
GCTCCACTTGCCCGGGCGGTGATGGAGGGCAGGTGCAGGGGAGCCCGGCCGCTAGCAGCC
GCCCTGCAGTTTCCTGCTTTCTTTAGTTTTGCTACGTGTACAGAGCAGAGCTGATGGACT
CGAAGTGGAAGTCGATAGACCTAATTTAGTCAGGGAGTCCCTGCTAATGAATACTCACCG
GCTGTGACTTGGATTTAGAACTGAACTCTTTGAATGACTTAGGGGTTTACGGGAAACCGG
ATTCCCGGCTGTCTTGGAAGCCCGACTCAGAATCCTCAATAACTGGTAGAACTGGGGAGC
AGATCCTGTCAGGAATGTCTGGGAGAGGACAAAAGAATGCAGTGGCTTGTTTTATTCAAA
CCTAACATCGGGCAGAATTTGACTGGAGTTCATTTTTGTTTTAATTGGCTTGTATCTCAT
CCAGATTTAACTTCTTGTGCTAATTGTTTAACAGGATTTAGCTGCTTCCCATGCCAAAGT
GTTAGCATTTTTTTTCTTTTATCTTTTTTTTCTTTTTCTTTTTTTTTTTTTTTTTTTTTT
GTATTGAGGCAAAGATAGGGAAAGGCAAAATAAGTGGTATTTCAATGAAAGTTTTCCAGG
TTTAAGCCGGAAGGCTGCCTGGAAAATACTTAACAAGACCTAAAATTACAAAGTTACTGC
CAAAGCCCATTCATCAGTTCTAAGTGATATACAACTGAGTTGGCTGGCGCTGGTCTGTAG
TCTTCACTTAAGAGAGGTTTATGCAGCTAACGAAGTTGACCAGTGCCAAAAGTCTCCTTA
AAGCTTAAAGTGTGCTTTATCATGCATGGATTTGGATTTATGACAGGCTCATCCCCGTGG
GCCTCTCATAGTGTCCCGTGCTAGAGCAAACTGGCTCCTAACCATTGCCCAGCCTTGGTG
CATGTAGGCTGCTGGCACTGAAGTGGGTCACACAATGGAAAAAAGTTTTACCTGGCCACT
TGCTGCTGGTGTCCATTTCATAAGACCCAGGCAGGAGCTTTTATTAAGCGTGGTGATCTT
GCTTATTTTTGTTAGTAAAAAAGTTGGCCAAAAATTCCTTCAATATGGTTATTATCCATA
AGTGGATATTAGAAGGCACTTGAGGACTGTTGGATTCCCAGAAGTGCGCATTTGGTAGGC
AATCCAGGCTCTAGAATACTGATGTTTCATAACAGTAACAATATACTGTGAATTGAATTT
TTTTAAATGCTAGTACTGCATAAAAGTTAGGGAAGTTTTGGTGGATTGCACACTAACATT
GAGTGCTCTGGATACCTGATATACTGTATTCACTAAGTCATTCAGCATAACTCTGCAAGT
GGGAGAAAAAGACCTTTTCAGGACTGCATGTTACTGTATGCCCATTAAAGTTTTTGAAGA
GCTGGAATGGCTCAAATGAAGCAGATAGGAACATGTAATAATGCCAGTAATTAGACTGTT
AACTCCGTTCCGTTTTGGAGAGGGGCAGGGATTGAGATGTTCTATGTGTATAGAGCTGTG
GCATTCAGTTTTGAACAGTGTGGAATCTATTTGAGTATTGGAGATATTTGGGGGGGGGTC
TTCACGTAGTTCTGACCTCACAGTTGATCTTCCTGTACTGTGTACTCTCTGGTATACTGT
TGCAGTGTGTAACCTTTAATGGTAAGATTTCAAGGGAGATAGCAACATGTTGTGTTTCTA
CTCACTAGTGTTTCCACCACTCCAGGAGACAGCATTCAGAGTTGACCTTGTGAGAGCTGG
CCATAATTTAATTCCATCTCTAGGTTTTCTGTGTAAGTATCAGTTTATACTTGTGAATTT
GTGTTGAAGCAGTGCTAAGACTTTGAGTGCATTCACTTATTATCTGCTTATTGTCAGCTT
ATTGTTTCAGAGGCACATCGAGAACCAACCATGGGCAGCTTTACTAAGGAAGAGTTTGAC
TGCCATATCCTCGATGAAGGTTTCACTGCTAAGGACATTCTGGACCAAAAAATCAATGAA
GTTTCTTCCTCTGTAAGTACGGGAAGCCCACAGCCACAACTCAAAAGTTCCATAAAAGAG
CATGCCTTGCCAGAGAATCTAGAATTTGACTGACTGGGCTGTCTAGTGAGTGTCCATGTC
AGTACTGCTAACAGGGATAGGATTTTGTTAGGGAAGGGGGAAAAAGATCTTCAGTGTGGC
CAGGTGCAAGACTGTTAATGAGGTCCCTGAACCCACTCACTCATTCCAGGATGATAAGGA
TGCTTTCTATGTTGCGGACCTCGGAGACGTTCTAAAGAAGCATCTGAGGTGGCTGAAAGC
TCTTCCCCGTGTTACTCCCTTCTATGCTGTCAAGTGTAATGACAGCAGAGCCATAGTGAG
CACCCTGGCTGCCATTGGGACAGGATTTGATTGTGCAAGCAAGGTAAGACTGCTTATCTC
ACCCCAAAAGGGTTATCAGTTGATGTGCTTTTGTTTGTCAAACTCCGTCTATATATACTG
ATCTTCTCTTTCAGACTGAAATACAGTTGGTGCAGGGGCTTGGGGTGCCTCCAGAGAGGA
TTATCTATGCAAATCCTTGTAAGCAAGTGTCTCAGATCAAGTATGCTGCCAGTAATGGAG
TCCAGATGATGACTTTTGACAGTGAAATTGAGTTGATGAAAGTTGCCAGAGCACATCCAA
AGGCAAAGTAAGTCTTCTGATTGAGCACAAAAAGGCTGGGCCTTGCTAGGCAGACTATAA
TCTTGGTTCCTTATTCCTATACATAGTAAGAACCAGGCTAAACCCTGGGTTAGAATCAGA
CCCACAAGCAGTAGTGCCTAGACAGGCTGATTGGATGAACGTGTACAGAGTGCTTACTTG
GTGCATGCACTTGTTTCTGTCCACCTAGGTTGGTTTTGCGGATTGCCACTGATGATTCCA
AAGCAGTTTGTCGGCTCAGTGTTAAGTTTGGTGCCACACTGAAAACCAGCAGGCTTCTCT
TGGAACGGGCAAAAGAGCTAAATATTGATGTCATTGGTGTCAGGTGAGGTCTCAGTGATA
GTTACAGACTGAGACATTAAATTTTAAGGCCCTTTTTTCCTCTGAGAACTAGTCAAAGAA
CAGCATCTTGTTTTTATTTCAGCTTCCATGTGGGCAGTGGGTGTACTGACCCTGAGACCT
TCGTGCAGGCAGTGTCAGATGCCCGCTGTGTCTTTGACATGGGAGTAAGTACATGACTCC
TGGAGGAGGGCTGTCTTGATTGAAATAACCAAACCACTGAATCTAGAATTTGCCTCTTGT
AGAAGCTGTCTGCATAACAGATTTTAAAACCATCTGTCCTGTGCATTTAAACTTGTGAAT
CTAGCAATTTGACTTCCAAATTTTCTTGATTCTAGACAGAAGTTGGTTTCAGCATGTATC
TGCTTGACATTGGTGGTGGCTTTCCTGGGTCTGAAGACACGAAGCTTAAATTTGAGGAGG
TAATTATTACAACATTAACCTACAGACGGTGAGATATGTATTTACCATTGTGGTGTTTTT
ACTGATTAAAGGAGCCAACATGCCTGGTGTTTTGTTCTCACTACTTGTTATTTGCAACTG
TAGCCCAGGCTGGCCTTGAACTTTCAGTTCTCCTGCCTGTTTCCCATATTTTAATGTTTA
GCTCAGTGCTTATCACTATTGTACTATGAAGTAGACAGGGTGGAAGGAGTTATATCTTGT
TGGCATGTATTCAGAATTCAGCATTTGGCCCCTCTTGTAATCCATTTTGTGCTATTTTAT
TAAATATTAATATAAACTATTCATAATGTGTTAGAAAGAGATGGTCCTGAGGGGAGTGGG
AAGTGGTGTATGTACAGACTAGTTTCCAGAGAGGTTTGTTGCTTCTGTTGCCTGATGACA
GACCTGCTATGCTAGGTCATGTCCTGTTCTTACACACAGCAGTGTGATCTTTCTCCTCAA
CTATAACAAATGGCTGCTCCCTTCTCTCACTTAGATCACCAGTGTAATCAACCCAGCTCT
GGACAAGTACTTCCCATCGGACTCTGGAGTGAGAATCATAGCTGAGCCAGGCAGATACTA
CGTCGCATCAGCTTTCACACTTGCAGTGAATATCATTGCCAAAAAAACCGTGTGGAAGGA
GCAGACCGGCTCGGACGGTATGTGGTGGCAGGATGAGTGAGTCATGTGGGATAACAGTTG
ATATGCTGGGTGGTAATTAGGGTGATCTGTTTTTCTAGATGAAGATGAGTCAAACGAGCA
AACTTTGATGTATTACGTGAATGATGGAGTGTATGGGTCATTTAACTGCATTCTTTATGA
CCATGCACATGTGAAGGCCCTGCTGCAGAAGGTGAGTTCTGAGCGCATGCTCTAGCAGTG
AGTGATGCATAGGATAGAGAGAACATTGGGCCGAGAGATGGCTCAGCAGTTAAGAGCACT
GACTGCTCTTCCAGAGGCCCTGAGTTCAATCCCAGCAACAACATGGTGGCTCACCACCAT
CTGTATGTAATGATGCCCTCTTCTGGTGTGTCTGAAGAATAGCTACAGTGTATTTATAAT
CTTTAAAAAAAAAACAAACAAAAAACAAACATTGTCTTTATACAGAGACCCAAGCCAGAT
GAGAAGTATTACTCATCCAGCATCTGGGGACCAACATGTGATGGCCTTGATCGGATCGTC
GAGCGCTGTAGCCTGCCTGAAATGCATGTGGGTGATTGGATGCTGTTTGAGAACATGGGT
GCATACACTGTTGCTGCTGCTTCTACTTTCAATGGGTTCCAGAGGCCAAACATCTACTAC
GTAATGTCACGGTCAATGTGGTGAGTGGGGCTGTGCCTGCTCATGCTCTTTTGGTTGCTC
AGTGTAATGTTTGCCTACTGTGAGCCAGAAGCCTGGGTTATGCCTGATGCACACACACAC
ATACTATGGGGGGAAGGCAGTATGTGCTGAGGGGAAGGATCACCTGACCTGTCTCAAAGG
GACTGAATTTGTGCTTGCTTTTTATGTTTGATAAGTTTTTTTTTACCTTGAGCTAAATAC
AGAAATGGAGTTTTTCCAAGTAATTACTGCTCATCTTCAGATATTTACTACTAGGAGAGG
TCTTACAAGTAAGCCATTAGATTCTTTTGCAACTAAAATATTCAAGTTAGCATATGTGAC
CTGTGGGTTCCTTAATAATGAAATTTTACATTGGATTGTTTCCTGGTATAGTGACAGGGT
GAGGTGTCAGGAGATCTCTTGGGAGGCTGCCCAATTTGGAGGGATTTGGGTTTTGAATAT
GCCATATATGCCTTTGTTTTTCAGGCAACTCATGAAGCAAATCCAGAGCCATGGCTTCCC
GCCAGAAGTGGAGGAGCAGGATGTTGGCACTCTGCCCATGTCTTGTGCCCAGGAGAGCGG
GATGGACCGTCACCCTGCAGCCTGTGCTTCTGCTAGTATCAATGTATAGATGCCATTCTT
GTAGCTCTTACCTGCAAGTTTAGCTTGAGTTCACGGCATTTGGGGGGACCATTTAACTTA
ATTACTGCTAGTTTGGAATGTCTTTGTAAGAGTAGGGTTGGCACCAATGCAGTATGGAAA
GACTAGGAGATGGGGGTCACACTTACTGTGTTCCTATGGAAACTTTGAATATTTTATATG
GATTTTTATTCACTTTTCAGACCTGATACTAATGAGTGCCCCTCGGCTGCTGAGCAAGCA
TTTGTAGCTTGTACATTGGCAGAATGGGCTAAAAGCTTATGTTGTGACCCATTTTGAAAA
TAAAGTATCTTGAAATGATTGGACATTGGAGAATGTGTGCAAGTATCCCTTACAGAAGGC
ACAAACTTCTGCACAGGCTGTGTGTTACAGCAGTGAGTCTAGCCCAGCAGAGATGTGGAT
GATACAAAGCTGTGCCCCCTCTGTACAGCATCAATGTGCTTAGCCCATCTCAAGTGTTTA
CTGTGAACTTGGTGCCCAAAGTCTCTTAAGAGTATCATCTGCCTAGTGGCCTCTTGACTT
GGCCACTTCCTAAGGAGAGGGCATCTGAGGCTCTTTGAACCTTGCCTGCAGAAACCCTGA
CTGCTCCCTCAACCCTTGGCCTCAGCTGCATCACCACCTAGTAACAGTTGAAGTATCGAA
CAGCACTTGGCAGTCAACTTCCTGTAATAAATTCAACAACAGCAACTACTGTGTTGTAAA
TTTTTACCTTGACCTTTCATATTATAGTCCTGCTCAGTTTATACACCTATTGCATCCCCA
AAGAAATGCCAGACTCTTAACCTAGTTAGTATTGAAGACCTGTAGGTCAGGAGGAAGGGA
TCCTGTGATCCAGCACTGGGAGACAGTATGGGCTCTACAGGCTACCTCAAGATAAGGCCT
GAGTTAAAGCTAAGCAGTCATCTGGAGTGTTGCCCATGGGTCTAAAGCTGGAGCTGCCTG
TGCCCTCCATAAAGAGGGAGTCACTTCTCAGCTGTTTCTTAAGGGTCTCCAAGGCACAGG
GCTATGGGTTTACTTGCTAAAATGTTTAACTTTCTTGGGAGCCACAATGACTGTGACTGG
AGTTAGGGAAGATCTGAAGTAAAGGCTCAGGTGTCTGGTGCTGTGCCAGGAGGCTCCTGT
GTAAATGTGATAGGGTGGAAGGGCCCCACCCCCAGGTCTGGTCATTGGTAGTTTGGATAA
CTGGGGGAAATTAAGGTTTCTCTAGCTCTTAGCGATACATTTTCCACAGTTTTAAAGATA
ATGCATCATATGATTGCTGGAAATACATACTTAACTATGAAGCCAGCATGGTTTATAGGA
AAGTACTTGTTTTCTGCCTTTTTGAAGTAGGGCCCCACTATGCTGGCCTAGAATTTGTTT
TATAGATCAGACTGCCCTCAAATTGGTGATGGTGTCCACATATGTATATGTACCATGTGG
GTTTTGTCTGAGGTGCCCAGAAGAGAACATTTTCTGGAACTAGGTCCTCCACAAGAGTAG
CCAGTGCATTTAACCACTGAGCCATTTTTCCAGCCCACAAACCATTCTTAACCTGGCTGG
CTGGCAAAAGCAGTTACTTGCTCTGATAGAGTGGTTGCCTATCATTCAGGCTTTGGAGTT
A
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1187, 3068..3151, 3237..3371, 3589..3762, 3854..4026, 4228..4362, 4462..4543, 4715..4798, 5314..5476, 5558..5670, 5925..6139, 6624..7484
3270..3371, 3589..3762, 3854..4026, 4228..4362, 4462..4543, 4715..4798, 5314..5476, 5558..5670, 5925..6139, 6624..6768
AC_000074.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved