Rattus_norvegicus Locus RGD1303127
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RGD1303127
Rattus_norvegicus
RGD1303127
7
SNORA2, SNORA2
9650..9786, 16027..16162
18081
GTTTACATGAAAGGACCAAAAAAATGAGCTGAACTGTTCACAATAGAAAACTAACAAAA
CCTTTTCATGTGTAAACAGAAAACACGGTCAGTCACCGTTCAGTTTTCTGCTGTGTAGGG
ATGGTAAAGAGGTAGCTGCTTGGGAAGACTGGAGACCACCGCCACCAGAAAACCAACGGT
ACAGAGATGGAAAAAAATATCTGAACCCAGCGAGGAGCTGTGGCCCGCCTTTCCCACCGC
CCACTCACGGGCCGAGTTTCTGACAGACACTTCACATCAGCCAATCGCGTTGCGGAGTCT
CACTGTCCCGCCCTCCTCGGGTCTAGTGTTGATTCTGACCAATAAAGGTACAGCAGCCTT
AATACAACGACCAATCAGCGCTTAGGAGCCGCAGGGCCGAGTTCCGTGCAGGCGGAGCAG
CCAGAGGGCGAGCTGCGCGGCGCAGCGCGGCGGGGAGGTAAGATGGCGCCGTGCCGGGCT
CTTCTCCTTTGCCGTTAGGCTGCTGCTCGCCCTTTCTATCAACTCAGCGCGGTACGTCGT
CTCCTGCAGCGTCAGAGTCATTCTGATTGTTGGGCTTTCGGGAGCCAGGTTCTCTGGTGC
CGGGAGCCGTAGGACAAGATGGCGCTCGCAGGACGACGGCGTAGGCGCTTGGGCCGGGGC
TGTGAGCTCTGAGGCGGCCAGGGACAAAGGCGGCGTGCCGGGGCGTGGGGGCGGGGCGCG
CCGTTGCAGTTGTGCCGCGTGGGACAGGCGCCGCGCTTCCGGTCGGCTACTGTGGAGACT
CGGCCAACGTGGTAGGGACCAGAGAAGCGAGCGGGCGGGCGGGCGGGTAGGCGGGTAGGG
AGAAGGCGGGGGTGGGTGGGTTAGTAACGGAAGGTTGGAGGGCGGCGGGAGTTACGGTGC
AACCCTCGTCCTGCGGCCCGCCGACCTGCGGGAGCACGTAGACAAGGACTTCTGGCAAGG
TTAAGGCCATTTTGATCTTTCCCGTGACCACCTACCCGCAGGTTTTGGTATGAACAGGAT
TCGGATTCACGTCTTGCCAACGAATCGGGGGAGGATCACCCCAGTGCCCAGATCTCAGGA
GCCCCTCTCTTGTTCGTTCACTCACCGCCCATGCTCTCAGCCGCGTCTGGAGGGGCAGGA
GTTTTGTCTTAAGCATATTCTTGAAGACAAGAATGCACCCTTCAAACAATGTAGTTACAT
TTCGACGAAGAATGGGAAGAGGTGCCCCAGTGCTGCCCCAAAGCCTGAGAAGAAAGATGG
GTATGTGTAGAGCGCGTGGGTATGTTGTGCCTTGGGGCTCTGAGAGTCGTTCCTTAATTT
TCAATGCTGAGGATTGAACCCTGGGTCTGGTTCACGTAAAGCACAGGTTGCATCACCGAG
CCTATTTTTACTATAGTTTGAAGCATTTATCTCCGGTTTGTAGTTTGATTTGTGTGTGCA
GGGACACGTGGGGAGGTCAGTGGCCGATTTGTTGGAGTCGGTTCTAATGCCTCTTGGTAT
GGTGAATAGGAGGACGTTAGGCTCGGCTCGCAGAGTCATGGACGCCCCCACCTCCCTTTT
GAGACAGTCTATATTCCCGGAACTTCTCCTCATGCGGACAAGACTGGCTTGGAACAGTTT
TGGCAACCTTTTACGGTTTTTAAATTTTTTTTCCGTGTATGGGTGTTTTGCCTGCTTGTA
TGTTTGTACCATGTTCATGCTTGAGGAGGAGAGGGCGGTGGATCTCCAGGAACTGGATGG
AGTTACAGAATGTTGGTGCGTCACCATGCCTGTCCCCTGCCTTCAGTTTTAAAGTGAAAA
GAGGAACATGTGTAGTTATTTTATGTTGGTCATATCTGTGAAGTTTTAGGTCATGTGTTT
GTAAAATTGGAATTAAAGGATACATTCTTTGGGAGGCATGTCAAAATACGAAAATGATCA
GAACTGATGCTAGGCGGTGGTGGTGCAGGCCTTTAATCCTAGTGCTTGGGAGGCTGACTT
GGGGTGATCTAGGAGTTCAGGCAAACCTAGGCTACAGGGTTGAATTCCAGAATAGACAGG
GCTAAACAAAACCCTGTCTTAACCCTCCTACCCAACTCCGCCAATGATGAGAACTTGAAG
GACACTTGAGGCACTGCTGAGGAAGGGGCATTTAGTTAATTGCTTACTTGTAAAATTAAC
ATTTGAGTTCTCACTGTGGTCAGAGTAATTTTGAACCCCTAATTCTCCTGCCTCAGCTTC
TGGAGTTCTCAGATTATTCCCATACTCAGATCTAAATTCTTCCTTAAACATTTATTCCGT
GGATTCACGTGCTGCCAAACATGTGTGGTCAGAGGACAACCCTCTGGAGTTGGTTTTCCT
GCTGTGTGGGGTGGTGATGGAACTTGGGTGGTCCGGCCTTGGTGGTAGGTGCTTTTGTTT
GCTGAGTCACTGAACTGATGGCACTTCATGTTGGAGTGCTGACTCACTTGCCAAACCTTG
TTAAGTAAAAGGCACACTCACTATATGTATGTGTGTTTTGGAAGGAGCTTCATAGTTTTT
TATCATATGTACTTACCTGTGCAAACATAGGACTTTACTAGATAATTTTTTATAGATCTT
CTTGCTTTAGAATTGTCTGTCTATAGTGGATTGATATTAATATGTGTTTGCAGAATTTAT
TTTGAAAAAAATACAAGCAGCTCTGATTTTCTGAGATACTGCTAACATTTTTATAGCTGG
AATGGATTTGATAACTAGAACAGTGGGTAAGCTACTTGTCGCTCCCTTTGAGAGCAGCTA
CTATGAGCCAGGGAGGCAGCATGAGTTAGAGCTTTCCCTGCCTGGAGCTCTGGGCCTGAC
TGAACAGCACACATGCCACGCCACGCCACGCCACGCCACGCCACGCCCCCACCACACCTC
ACCAAGGACCCCAAATGGCTTACTTGAGGGCAGTTATATTTTTGATTCACATTGCTGCCT
GACCCACAACCCCACAACAGGGTCTATTTAACCCTGGCTGTCCTGGAACTGTGTATACCA
GGCTGACCTTGAACTCACAGATCCACCTCTGCCTCTAAAGTGCTGGGATTAAAGGCGTGA
GTCACCATGCCTGGGTTTCATACTGCTCTTCAAGGTGTGACTATAAGTCATATTTCCTAA
AGAAAAAAATCAACTGGTGACTGAATATTGCTGGTTCTTTCAAGAGAGGGCCTATTAAAT
ATTAATGCTTTGTCTCCTTAGGGTGTCTTTCTGTGCTGAACATGCTCGAAGGAATGCCCT
AGCACTTCATGCTCAAATGAAGAAGAGTAACCCAGGCCCTATGGGTGAAACCCTCTTGTG
CCAGTTGAGCTCATATGCTAAAACAGAGCTGGGCTCGCAGACCCCAGAGAGTAGCCGAAG
CGAGGCGAGCCGGATACTGGGTAAGCAAGGAAGGTGCTTACGAGCGAGCCGATTTGGCTC
GCTGCAGTGCCTTGGGAGCTGGGTGGCAGTGCCGGGCCTGCTCGTGCTGGTTGCTGGTTG
TTTTGCATTTAGAGTTTGTTTAGATAGATTTCTCCCAGCTTGGTGACCTTTCCTTGTGTT
AACAATTGAAACAGTTAAAAACTTTGCATTTTAAGGTTTTGGGTTGATCTCTAAGTAATG
TAGCTTCATATGTGGAGTTACAGAGGTGGGAAGTCTTAATGGCTGCTCTTCCCTTCCTTG
CCTCAGATGAAGACAGCTGGAGTGATGGGGACCAGGAACCCATTACTGTGGATCAGACAT
GGAGAGGTGACCCTGACAGTGAAGCTGATAGCATAGACAGTGATCAAGAAGATCCCCTAA
AGTAAGTTGTATTCCACATGAGACTTTTACATGCTTTATGTAGTTAGTATGTAGAGTGTA
GTGTGGCATGTGGTTAACCAATACATGTAGGTGGGTTTAAGGGTCACAGTTCAGCACCGT
TTTGCTCTAAGGCAAGATTCCTTGATTATTTTGCAGAGGTCTTGTCACTGGCACCCGGGT
AGTGCCCATGAGATGCTTTAGGGAAGAACACTTCTTTTGACACAAGAATGAGAGGGAGTC
AGACAAGTGCTGGCTGGCTATCGAGGAGAATGCATTTAGATAGGTACTTGCCCCAAGTCT
CAGAAATATGGGCTCATTATACTTAGATACGTGCTGTAAAATTCCATGGTTCTGAATTTT
TAAAATTATGTATATGTATTGCAGCTATCTTCAGACACACCAGAAGAGGGCATCAGGTCC
CATCACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCTGGA
AGAACAGTCAGTGCTCTTTTAACCACTGAGCCATCTCTCCAGCTCATTTCTGACTCTTTA
AATGGGAAATAACAGTGTTCAGTCAGTAGTTGGCTTTGGTTTCATGCCTAGTAAAAGGAA
AACTGATTTCGAAACCCAAGTTTTAATTATGTTAAGGTCTACTCTAACCCTTGGTCATCT
TAAGAATTTAGAAATATCAAAATATTTCCTGTTCCAAAATCTCTGATTTTTTGAAGCCAG
TCTCATGTGGCTCTGACTGGCCTGGAACTTGGTATTTGAATCAGGCTGACCAACCTCAGG
CTTTGCCTTCCCTAATGTTAGGTTTTGAATCATCTTAGCAGAATTTGTCCTCAACATTGT
GCAGGTGCACACTCACCACACAAATTCTCACTGGTTTTTTGAGACAGAGTTTCTCTGTGT
GGCTCTGGCTGTTGTGGATCTCACTCTATAGACCAGGTTGGCCTGGAACTCAGGGATCTG
CCTGTCTCTGCCCAAAGTTAATCTTCCAATTTTTAATTACTTGACTCAGAAGCAGGAAAC
AATCTTTAGATTAACCTCTAGAATATCTTTAAAGTTTGTGATTGGCAGGCAAACTAATAA
AATTGGTATGTAGCCCTCCTACATTTTTGTAATAAAGGGTCAATCTAGGAGACTGAATTT
TGAGGATATTGTGAAGAAAGTGGGCCTATCATGACCTATCACGTGTGTGTTGGGGGTGGT
GGTGGTGAGATCAGAACTGGAACCTTTTCTGTGCTATATATGCATTTTACCAGCAGTAGT
CTGCCTTTGAGCTAAATCCCTTGGACCACGAAGGCCCAAAGTCTTGATGATAAAAGATTG
TATTTAAAGGAAAAATAGAAGTCACAGTCATTTTGATACTTCGTGTGTTAGTTTGCCTGA
ATGTATGTCTGTGCACATGGAGCCCAAAGACGGTGGTGGATCCCCTGGAACTGGAGTTTA
AGCTGTGAGCTTTGAGTGTTGGGAATCGAACCCAGATCTTCTTCTCTTAACCATTGAGCC
ATTCTCTCCAGCCCATGATATATCTTGTCATTAAAATACTCAGTTATTCTGACGTGGGGC
CCTTTTTAAAATTACTATGTAAGTAGACCAGGTTAATTAGCATAACTTTCTTGTTGCACA
TTTTTACTTTTGTTGTTGAGACAGGGTTTCTCTGTGTAGCCCTGTCTGTCCTGGAACTCA
CTCTGTAGACCTAGGCTGGCTTCAAACTCACAGAGATCCCCTGCCTCTGCTTCTGGAATG
TTGTGATTTAAAGGCATGCTCCACCGTGCCCAGCCATCTTTACTCGTTTTAAATGTATAA
ATAATGAGACCTCCCCCACTCTACCCCGTTCCAATTTGTGAGATAACGCATTGGTATCCT
TTTGTGGAGAGGAGAGTTCTCCCTCTCTCCCTCTCCCTCTCGCCTCATCTTTTTTTTTTT
TTTTCCTTTTTTCCTTTTTTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCACTTCCTAG
GCAAGCGCTCTACCACTGAGCTAAATCCCCAACCCCTCTCGCCTCATCTTAAAAAGAATC
TGTTCAGTTCCGAACTCCCGACCACTTACAAACCACTTGTGACTCTCCAGCTCCAGGCTC
TCTGAGAGCCCCATGTGCACTCGCAGGCCGGCAGCGGCATACACAGTGCTGAGAAGGAAC
CAAGGGCCTTGTACTCTACCACTGAGCTGTGCTGTACTTAAGCCTTCTTTATTTTCATTT
TCATTTTTAATGTCTCAGTAAAATGCTTTGTGAAAATATTCCTGTTTAGTGTGTCAGTCA
GGGTTGACTTTGTCAATACAAATCGAGGCTGTCTCTAGTCATCCTTTTACTGTCTTGTTG
CTTATGTTGTTTCTGAGATAGGGTTTCATATCTAGGTTTACCTTGGATTTGCTACATAGT
CCTGGCAGGCCTTGAACTCCTGATTCTTGTGTTTCCACCTCTAACAAGTGCTGGGATTAT
TGGCACTCATCCATCACCATGATTATCATTGTTATTGTTTTTAATGCTTTGTTGAATTTA
TCGTTTTATTCCAGACATGCGGGTGTCTATACAGCCGAGGAGGTGGCTCTTATCATGAGA
GAAAAGCTGATTCGTTTGCAGTCTTTGTACATTGATCAGTTTAAACGACTACAGCACCTG
CTCAAAGAGAAGAAGCGCCGTTACTTACATAATCGGAAAGTGGAACACGAAGCTTTAGGT
AAGTTGGGTGGAGTTGGATCTGCGTGTATTACAGCTGAGGCTTCCCGTCTAAGTAGAAAA
GCATCCTTGATCACTGTACACGTCACACCTTGACCTGTGCAGCCTTTTTGGTGGTGACTG
TAGTGTCCCACTCGGTACTTGAGAGGCTGAGGGTAGGGAGTTTGTTGTGAGCTCAGGGCC
ACATAGACTGAAGTTCTCTTTTAGGAAAACTTGATATTTATGATATTTATTTAATTATTT
TGGTCACTCGCTAGGTAGTAGTCTCCTGACTGGCCCCGAGGGACTTTTGGCCAAAGAGAG
AGAGAATTTAAAGCGACTAAAATGTCTCAGGCGATACCGTCAACGCTATGGAGTAGAAGC
CTTACTACACAGGCAGCTGAAGGAACGCAGAATGCTGGCCACAGAGGGGGCTGCTCAACA
GGTAGTTTGCAAAATATGCCAAAATTGATGGTTTTAGTCCAGATGTGCTGCAAACTCTGG
GTGTGTACATTCACTTTGTTGATAAGATCATCAAAACACCATGTCCAGCCTTGGCTTTGA
AATCCAGCTTCTACTAAAAGCACTTACCTGAATGTCAGCAAGACAGAGTTCCAGTCTGTT
CTCGTCCAGTCAGCCCTGGGCCTTCGCAGGCAGCTTTCAGAACTTTACAAATTGAGGGGT
TTAGGGGGTAGAGTCCTAAGTTCTTTGGTTCAGGAAGCCCTTAGTTCAGAAAATTGGCAA
AAGTTTTACTAAAGCAGTTTGGAAATCTTTAAAAAAAAAAAAAAAAAGGCAAACTGGGTG
TGGTGGTACGTGCCTTTCGGTAATCTCACCACTTGGTGGGAGGATGAGGCAGTCGCAAGC
TTGCTATCAGCTTGCCCCACCCAGGGTTTTTGCAAATCAGCCAGCTAATTATTCTAAAAG
AATAGGAATGGACTGGAAGAACTGCCTAGTGGTTAAGAGTTGGCTAGCTTTTCCAGAGGA
CTCAGGTTTGAGTTCTTGAACCCACACTCCACTCCAACCAGCTGTAACTCCAGTCCCAAG
AGCCCCAAAGCCCTCTTCGGGTTCCTCAGGCACTACACACACTGTAGATAAACATGTAGG
CAGATACTCACAAAATTAAATAAAAATAGCTGGGTGTCCAGTCCCAAGGGCCCCCAAAGC
CCTCTTCGGGTTCCTCAGGCACTGCACACACTGTAGATAAACTTGTAGGCAGATACTCAC
AAAATTAAATAAAAATGGCTGGGTGTGGTGCACACCTTTGATCAGCATTCTGTTGGCTGA
GGCAGGAGGATGGATCTCTTGAGTTCCAGGCTAGTCCAGGCTCTTACCCTGAGAAACCCT
GTTTTGAAAAACAAATGCTGGGGCTGGACAGATGGCTCAGTGGCTGAGCGCTGACTCTTC
TAGAGATGCTGAGTTCAAATCCCAGCAACCACAAGGTGGCTTACAACCATCTTGTAATGA
GATTCTATTCTGTCGTCTGGTTTGTCTGAAGAGCTATGGTGTACTCATATATAATAAATA
AAGAAAAAAAGAAAGAAAGAAAGAAAAAAGATGATGGGAGGGCTAAAAAGTTGAAAGGAT
AGTGTCAGTTAACTGTCAGAGTGAGGCGGGGTAATTACATGGTCGTTGCTTTTGTTGTAG
TTGTTGAGGCTCCACAGGCATTGTCAGTTGTGTGGCTGTGAAAAGAACTGCACGGTGTCA
GCAGCCCACGGGATGGAGGCAGCGTTGGCTCGGTGTTAGAGGCTCTAGTGCGTCAGGGCT
AGAACATCTTGGTGCCTGGCTTTCTCCTGATTCCATCTTGATTCCATTTTATTTTGTCTG
GGTCTTAGTCTGAGCCCCAGTGCAGAGCACAGTCAGCACCCTGTGAGGTCTTCCCTCCTT
AGTGCTCCCACCTCACAGAGCCCAAGTACCTACTGGTGGAATTGCTTCTTGGCCAGTGAG
ATGAACCACTAGAGAATGCAGGGTATTTTATGTATTCTATGTCTGTGAGCACACTGTAGC
TGTCTTCAGACACACCAGAAGAGGGCCTCATCCCATTACAGATGGTTGTGAGCCACCATG
TGGTTGCTGGGAATTGAACTCAGGACCTCTGGACTCTGGAAGAGCACCGAGTGCTCTTAA
CCACCGAGCCATTCCCATCCCCCCCATGCCCCCCCCCCCCAAGCAATTTAAAAAAAATGT
TTTGTTGGCTGGGCTTGGTGCAGCTCTAATCATAGCAGCTGCGGCAACTGAGGTGTGGGA
TCTCGAGCTTAGGGCCTTCTTAAATCATTTGCCTAGCATGCTTGAGATCACAGCTAGCAC
CCCAAAAAAGTTGTTAAAAGATAAGTTAGTTGAACTGGGGATTTAGCTTGGTGTTAGAGC
ACATGTGTGTGATTCTGGGTTTATTTCCTAACATTACCAAAAACCTTGATGTTTGAGTCA
GGCTCCCGCTGTGTAGCCCCCTGGTTGTCTTGGAACTTCTGTGTAGACAAGGCTGGCCTC
CTAGATTTGTCTCTGCCTTTGCTGAGATTGATACATTGACCACAGTGCCTGGCTAAAGCA
TCAGTGTTTAGGATACCATCTTTCCCCCTTACCTCAGCCGAGGGGTAGTTTCTGAGGTAC
CTGAAGGAGCCTGAAACTTGGTAGTATCATCATGCAGGTGTTTATGTATTTATAAATAAG
CCAATTATGCCAATGTTAAGTTAGTATAAGCTATTTACAACTTAGAGATTATTCCTCTAA
TTCTGTATTTAATGTTTTCAGACCCAGGTTGACTATAGTTTAACCTAGTTAAGGGACAAA
CATTTTTATTACTTCTACAGTGTGGAGAGGTGCATTTGGGGTTAGGATTGATTAACTCCA
TTCTATGTACATGAGGTTTCATTGTTGCAGTATTGGTGAGTAGGTTTGTTAAATGTTAAC
GTTTCCTACTTTGTGTGGATTGACTTTCCGTGTATAACTGAATACTACCACAGGTCTATG
GTTTTTGTGGGGGTTTATTTGTATTTTTTTTCTCAATTTTAGGCTCATACCACTCGTTCC
AGTCAGAGGTGCTTAGCCTTTGTGGATGATGTTCGCTGCTCCAATCAGTCTCTTCCGATG
ACCAGACACTGCCTTACCCGTATCTTTACAACTGTGTGTCTAGGTTCTGAGTGTCTAGTT
AAGTCAGGCTGGTTATGAGCTCATCAGTTTCACTGAAGAGCTTGGTTACTTTGGCCCTGA
ATCAAGGCCAGCAGTTTGCTGAAGCTGTTGGTTTCAAGCAGGTGCCTAAATAAATGTCTT
TCTATGGTCTGTTGGCCATTTCAGAAATTTAAAAATGTAATGGTCAATTCATTAGAAAGA
AACATCTGGCTGGATATGGTACCCAGCTCTGTGATATTATAGCACTTGGGAGGGTAAGGC
AAGAGGATTGGGAATTTGAAACCTGCCTGGGCCTCAGCAGAATCCTGTCTAGGGTAGGTG
AAGTGGGGGCAGGGAGCCAAAGAAACAGCCATGTTGTTTGTGACAGCTGTGTATGGCTGA
CGGTCTTAGTGGGGTTCCTTAGTTTGTGTATGATACTAATGCTTTACTGATTTAGCTTTG
TTCATTAAGTTATATGTTAAATCTGTCACCAAGAAAAAAGGATTACTGTGGGTTTTCTGC
CCAGAACAAGAGTATGTATTGTGAATTTTTATGCAGTAGTATTGTTAGTGCCCTAACTTG
TATACTTACTCAAATTAGAAACTTGGGGAAAAAAATGGGGTTTCTCCCCAGGATCATTTC
CTCTATTTTTTCTAATTTGTGATTTTAAACCAATATACGGTGTGTGCTTTCTGGTATAGA
AATGCTACATTTGCTGATGGGCTACAAAAGTTGTGATGTTTATTGAGTTTTTGTGCAACC
TGAATGGTTTTGTTGTATTTAGAAGTCAGAATATTTTGTTAGTTCAGTGTGTTGTCTTTT
TAATATAGTCCTAGGTAGTCAGGAGACTGAGGCAGGAGGATCACTTGAGTCCAGGAGTTC
TGGGCCAGTTGGGATAAAATAATGAAGATAACTCTCCTCTCCCCAAAAAGAGATTGATAG
GAGGGGGAACCCCATCTTGGTCTTTGGTAGAAAAGGAAAGGGTTGTGGCTTCCCTCCCCC
ATTCTATTTAGTGAAGTATTTGAGGTTAATTTTCATACTAATGCCTTCTAGCCTGGGATT
GCAGGTGTAGCCCCCACACTTGGTGTAGCGTTACTGCTTGTATCATATAAACACTCATAC
AAAATGATGAGCTCTAAGGGGAATGGGGAACCTTGGGCCAGGTGATGGCCGGGAGCTACA
AAGGGGTGGAGTGGGGTGGAGGGGAGACTGGAGACTTAGAACACAAGGATACTGAGCAAG
ACGGAGGCTGTAATTGAACAGGAGATGCTAAGGTGGAGAGAGTGCTGGAGAGTGGGGTAG
GGGGGAAATGATGGAAACCAGCTGCTGTGCAAGCCAGCACTGCAGAGGCGAGAGTCCGGT
GGATGGTCAGCTTCAGGTTCACGCTTGGCCACACAGTCGCTCCTCCTTGAGTTTGTAGTA
AGTATATCATGGAATTGGGAACGACCATTAACATTTTCTGCAACAAGCTACTTGTTTCTG
TGTGGACCTCTCTTGTCAGTGTATGTTCCTTGGCCACTTGACACTTCCTGTCTCTGGTTT
AAATGGCTGGAATCCTGGGAAGAGGTTGCAAGTGGATTACAAATTATTGGTAGGGTTAAA
ATCATGTGCACAAAATTACACTTAGAACCCTAAAAATAACTCATTGCATTTGGCTTTCAA
TGAAAATGTAGTTCTCTGCATTGTCAGACTTTGTTTAGCACTGTATACTCCTGTATTGTG
TTCGTCCAATGGGTCCTGGTTTATTTTCCTTAACCATTCTGTAGATATCTGTCAGGATAC
AAATCAGGTTCTCTTCAAATGCTGCCAGGGATCTGAAGAGGTACCCTGTAACAAACCAGT
TCCTGTAAGCCTTTCTGAGGACCCCTGCTGTCCACTGCACTTCCAGTTGCCTCCTCAGAT
GTATAAGCCCGAGCAGGTACTGTCTGTGCCAGACGGTCTGGAAGCCGGCCCCATGGATCT
GTACTTGAGTGCTGCCGAGCTTCAGCCCACTGAGAGCTTACCACTGGAGCTCAGTGACGT
AAGTTAGAGAAGCTCTGCTCTGATTGGCCCTTGAGAGAAGGCCCTGTCTGCTAGTGGTGA
GAATAGTCAGCAGTTTTCCAGCAAGAGGATGACTTGATGCAGTCGCTGTGGTTGCGTGCG
CCTGTGCTGTGTTTATTAGACACTCTGTGCTCTACCCTTCTCCTCCCCGACAGTCTGTTC
CGAGACAACCTCACTGTGTAGCCTGAGTTGAACGTGAACTCATGATCCTGTCTGTCTGTC
TCCTAAGTGTTGGTGTTAGAGACCTATGTGGAAGCGTGTGACACCGTGTTGTTTATAAGG
TGTTTAGAGGACGTTTGTACCAGTACTCTAATGAGATGGCTACAGAGCGGTACTCTGTAG
TTGGTTTGGTGGATTTTGAACATCCTCTTCTGGTACATAGGTATTTTTGCTGACCCTTAA
TTTTATTTTTGACAGATTTTATTACAAAATTTATTCAGTGTTCACACTTTACATGGTTCA
ATTCTAATTTAGTATTTTGATGCTGTTATGAATGGGATCTGAGCGTTTCTCTTCTTTTGC
TTGCCACTTGAACCCAGCTTTGAATCATGACCTAAAAAAACTGGCATTTAATGTGTGTTT
TGTTGTATATAATGTATGTAATATATATATGTATGTGTGTGCACCCTATGCGTACCTGTA
CCTGGCATGAGAGGTCAGAAGAGGTTAGATCTGGGACTGAAGTTTTAGACAGTTGTTTGC
TACCGTGTAGATGCTGGGAATCGAACCTGATCCTTTGCAAGGTGAATAGGTATTTCTGTC
CATGGAGCCTGCTTGGCTTCTCTCCATAGAGTTGCTGGGTTTCAGTGAACTCTTGGGAGG
TTCTTGAGGCTCTAGCATAGATGTGTGATATAAATCCATCTCAAGAGAAGCCGCCTTGCA
TCTTAAAGCCTTCGTTGTCACTGCTTCCAGGGATGTCATCCCGGAAGGCTGTGTCCTGTA
CAGAATGACTTCCCTCCATGGCCCGGAGATGATGCCAACCCCTCTTTGCTCTTGGAGTTT
GGCAGCTTAGGATGTAGTCTAAATCTCTTAGCTATAAATTTTGAGTAATTATTTTAAAGC
AAAAATGGCCTAACATTTTAAGCACTTTCCCATTCGGCTTTAGGGAATGAACCCCTCTGG
AGTGCTTGTCCATGTTATAAATAAATCTTGGCTTTTTTTTTTTGCTGTGATCTAGAGACT
CAGAGTATGTCTAATCCCTGGTCTCAGAGTTAGAGTTAGATACGCAGTGATGGAGAAGTT
AGCAATCCTCCTTCCCACAGGACGGAACTGGGTACTGGGGTTTCTCTTCAGTTCACGGTG
TAGAGCCATGTGGTTCCTGCTTGAGCTTGCCCCTGCTTTCCCTTCCCACTCAAATAGGTG
TTTCCTGGTTGCCCGGCGGACAAGAATTTCTTGATCACTCAGTCCCTGGGATTCTCAGAA
TTAGACTGTGTTTATATGATGCACCTGTGGGTGGGAAGAACTGGGACCAACACCACGCTG
AGAGAGAAAAACTGTAGAAAGCAAAGGGGTGTCCGCAGCCTGAGTGGTGTGAGAGCGGGT
TTCTGTGGATGAAGTGATGTGTCCAGTAGCTCTGTAATGGATGGGAGGAAGTGTGGCTGT
TTCTTTCCTTCTGCTTGCACTGAGTAGTTTGTTTAAAGGCATTTTTTACAAATGGGATAC
ATTGTGTATCCAGGCTGGTCTTGGACTCTCAGGGAGAGGCTTGCCTGCTTCTGCCTACCT
CCAGAGTGCTGCTCCTGTGCTAGTTTTAGGCTTAATTTTTTTTTCTAAAGGTTTAGTTCT
GTGTGTATCAGTGTCTTGCCTGCATGTATGTGTGCCATGTCCGTGACTTTGTGCCTTAAG
AAGTCAAGAGGCGCTGGGTCCCCTGGAGTGGAGTAGAGTTCTGTGTGGAGCTCCATGCAG
ATGCTGGTCATGGCGCTTGCATTCTCTGGAAGTGGTCTTAACTGCTGAGCTCTTTCTCCA
GGCCCCCGCCCCCCCCCCCCCCCCCGTTAAAATTATGTTTGCCTTTTTGTTCGTCTAGTT
TATTTTAGATAAGGTCTTGCTCTGTAGACCAGGCAAACTCAGATCCACCTGTCTTTTGCT
TCCTGAGTGTTGGGATTAAAGTTTTAGACTTTTTAGAACTGTGTTCTTCCCCCACCTTAG
TTATGAAAAGGTTATGATTTCTATTCCTGGTGATAAGGACACCAAATTTTTTTTTTTGGA
GCTGGGGACCGAACCCAGGGCCTTGTGCTTGCTAGGCAAGCGCTCTACCACTGTGCTAAA
TTCCCAACCCCCACCAAAATTTTTAATACTGAATAATTATGTAAAATGGTGGTTTCCTTG
TGACATCTTCATACAGGCATGTGGTGTACTTTGAAGTCTTTTACTGTCCCTTTTCCTTCC
CTTCCCTCTGCCTGGTTTTCTGTACTGTGGGACCTGTACATGCTTAGCTGGAACTTGAAA
GCATTAAGTGAACTTGTCAATGGCTCAGAAGTTAGGTTGCCATAGATTTTGAACCACTAT
AGTGACTTGGACCCTAAGTTAATGTTGGTTTCAGAAAGGAGCCAAGAATAATAATGTCTT
TGATCTGCCATCTACTCAGTGTCTCTGGGAATGGCTGACCCAGAAGTATAGTATAGGGAA
GTATAGTCTAGAATATAATGTCTTTTTTTTTTTTTAAACAGAATACTTGAACTATGTTAA
TTAATTTAAGACTCAGAGGCTCACTGGGCCAGGGCGCACAGGCCCTTAATCCCAGCTCCT
GGGAGGCTGAAGCAGAGCACCCTAAGTTCAAGTCTTGCCTGGGCCACAGGGTGAGTTCCA
GGCCGACTTAGTAAGACCCATTTCAGAGTAGAGGGAGGAAGAGGGCTGAGACGTAGCAGA
CCAGACCTCAGGCCACATCGCTTATTTGAGGGATTGGGAGTTAACCATGATATTTTGGCT
TTGCCATTCAGAAACATCTGAGTTTCTGTGATCCGTCCTTCCTCTCCCAGCCTTCCTTTC
CTCTCTTTTAGTTGCTTGCTTTTTGTGAATGTTGGCCAGTCTTAGACTGCTGAGTGTTTT
CCAGCAGGGTTTCATGGTATTCTGCCCATGGGCAGATGGATGCGTCAGTGAGGAACTTAA
GAGTTTGATTGTGTGTGTGCGTGCGTGTGTGTGCGTGTGTGTGTGTGTGCGTGTGTGCTG
TGGCAAGAATCGGAGTTCTTTGCTTCTTCCACTGTGTGACTGAATACAAGTCATTAGACT
GCTCACTGAGCCACCCTGCTGGCCCTATATTTTCTCTTTATTTTTCCTCTCAACAGTATT
CTTCTACACTTGGTTTGTGTGTGTGCATGTGTGTGTGTTATGTGCACATCAGAGGACAGT
TGTGGGGGTCTGTTCTCTCCATCACATGGATTCTGGGGTTCAAACTCAGTTCATCACATT
TAACAATGCCTTCGCTCACTGTTTATAATAGAAATGTGTAGTAAATCTGTCATTTTAACC
ACTTAGGAATTCACAGTTCATTGGTGTTGATATTGGTATTGGTGCTGTGCAGTCATTGCT
GGCATCTTTTATTTCCGTTGGGTTAAACAAATTCTGTAACTGTTAACCCTTCTCTTTCCT
CCACTCATGGTAGTCACTGTTTTACTCTGTTTTTCTGTATTGTGTTGTCAGCTAAGGAAA
AGTTTTCACTATTGTTGGTTTTGTTTAATTGATCTAGCTTTCTAAGCAAGGAGAGGAGGG
ACCTGAGAGTTACCTTGAGCTTTGGTGAAAATTGTCAGTTTTAGCTTACTGACTTCCTGG
ATATTGCTGATGGATCTCTCTCTCTTTCCCTAGGACTTGGATGTCGTAGGTGATGGCATG
CCGTGCCCTCCATCGCCCTTGCTCTTTGATCCCTCCCTAACTCTAGAAGATCATTCCGTC
ACTGAAATTGCCGGAGGCCCAGTGGGTATCTTGACAGTGTGTCTTAGCTAGGTTCCCGCA
TGTGGTGACCAGGCTGGGCAGATGTTTTCTCTGTTGGCTAGTGTGAGTTCCAGGGAGTAG
TGTGATTCCAGATAGAATGCAAAAGTGACCAAGGTGGGGTTTTCTCAGTGAAGACCATAA
AATGGAAATGCTCCCTTTTAAGCTAGAAATGTGTAGACGTTTGTTGTGGGCTTTCTGTTG
CTTTAATAAAACACCACAACCAAAAGCAGCCTGAGTACAAAGGGACTTATTTCATCCTTT
ACTGAGGGAAGCTGGAGGCAGGAGCTGATGTACAGGCCATGGAGACTCTGCTTACAAAAT
ACCGTCTTTTGCTTTTGAATTCTGCCTGGTACTAGTTTTCCAGAGGAGCTGTGGAATTCC
TCCTCGTGGCTCTTCTCCTCAGGAGCAGGACGTGCATCTACTTGAGTGAAAGGGGATAGA
GAAGTTGACCGTTTTTAAGGGAGAGCCCATCACTCCAGGTGATAGATACAGGCAAGATAG
GTGACCCATGGCTCTCACTGAAGACCAGCGGTCGTGCTGTAGCTGTTGGTTTCAAGCAGA
CGCCTAGAGAGCTGTCTTCCTGTGGTTTGTTGGCCCTTCTGGACTTCAACAGAGAGTGAC
TTTTCCATCTGGAAGGAACAACCCCTTGTTGTGTCTGGTTTGACAGCTTCAGTTATGACG
GATTCTTAGGAACAGCAGAGTACTGGGAAAGTACTGGGGATAAACTAATAACTTAATTTC
TCTGGTCTTGTTCTTTAGCCACTGTAAATGGGTATTGATAAGTCAGAGTCATGCCTCAGG
CCCATTGGAGGCGTCTCTAACCAAAGTGCCTTTATTTCTTTTAATAGGGACAGATACAGG
TGGCTGGGGATGGGTGCAGATCCCAGGGACCTCATAATGTAGAGAAAACCTGTGCACCAT
TCCCTCAGCGTGGATTGGCTACTGCAAATGGAAAACCAGAGCCCACTTCTATCAGTTGAC
AGTTCATTCTGGGATTGCTCACCGCCTTTGGATTTGAACTCTCCATTCTTCAGACAAGTG
TATCTTTGATCATCTCTCACTGAACAGGGACAGCTCAGACCACGTTGTTTCCTTCGGGGC
TTGAGAGTGCTGTAGACAAACATAACCCAAGTCTCTGTGATGACAAGTTAGTATTTAAGT
TTTGGGATTTTTTGCGAGGAAGAGCGTGAGGTGCTCCCTGCCTTTGAGATGCAGTGCCTA
TTGGAGACATTTATACTGGGACTTCTGAGCCATGGGCTGAGATCCACGTGGATGTCTAGG
CGGGGTTGGCTGTGGTGAAGAACGGTGCTCTTCAGGTGTTGGCTCTTAGTCTCTGTAGCC
GTATCTAAAGCTGTATTTAAGCCTTTCCTCTGCTCCACATCATTGGGCAATATAAACCCC
CTTTCCTAGTGAACCGACTGAGAAAAGCAGTTCACAGGTCTGGGTTCTCCTTAATTATTC
TTGCTTTTAATTTATGTAAATTTCTGTGGTGGCTCCTTCATGTAAGATATAGTGAAGTTA
TTGTATATAGTTTCTATTAAATGTTAAAATGTTATGAAAATATAAAGTAGTCTGAGTTGA
TTGTATTTTCTTTGTATTTGAGAATGTCTATATTAATTATCCTCTGGGTCTTTGCTTGTC
ATCTGATGGGAAAAGTGCACACTGTTTCTATCCCTTGACGTGCACTCTGGAGAAACTAGT
GACAAAGGTGGCACTTGGTACCTAGTTCCAGGGCCAGGTAAACTTGTGTTCCCTGGAGAG
CTGGAGTTAACTCAGTAGGGGGCTGGAGGCCTGGTATGGAGCTTAGGACTTGGGTCAGCC
CAAGTCAGGATGATAGCAGGCAGTGGTGAGATTTGTGTCCAGCCAGTTTCTAGGGGAACA
TTAGAAATAATGAGCTACTCATCCTGAATAACCGTCCACAGAAAGAAGCTAATAGAACTA
CCACCGGAAAAGATTGAGCTTGTCCTGGGGTGGGCAGGTACCCCTTCACTGTATAAGCTG
TACATTTCTCCCTGCAAGGAAGATGTGCATGAGAGTGAAGACCATTTGTTCAGCCCAGAC
CCCTGTCGGATGCTTTAGACTTTCAGTTGCTTAGGACTAAGACTTACAGTTCTAGAGGAC
ATCATGGCGGCAGGATCAGGAAGCTGTGAGCTCACATTGTAACCACTAACGTGAGTCAGC
AACCCGGAAGTGGTATAACGCTTTTCACCTCAAAGTCCAACCCCAGTGATAACTTCCTGC
AGCATTTCTGTATCACCTAGATCTCCCAAAACTGCAACCAATGGGTACCAAGTATCTAAG
TGCCAGAGACTGGTGGGCATTTCTCATTCAAATAATCACACTGGGTTTGACCAGTGGAAA
ACCCAAAAGCACAGTCCTGGACCAGATTGTTAGCAGGGGAGCTGGTCCAAACAGCACTAA
GGGCAGACTAGGGTGCATCTGTCAGAGGCAGGCCAAACAGTGGAATCCCCTTACTGCTGA
GACTCACGGAGGCCCTACATCAGTACCCCAGGATGGGAAGGTTGGATGGCTCAGGTGGGA
AAGTGACTCCTACATGCTGCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1259, 3201..3379, 3666..3780, 6314..6477, 6734..6900, 9462..9558, 11324..11577, 15393..15500, 16367..17081
1009..1259, 3201..3379, 3666..3780, 6314..6477, 6734..6900, 9462..9558, 11324..11577, 15393..15500, 16367..16498
AC_000075.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved