Rattus_norvegicus Locus Polr3h_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Polr3h_predicted
Rattus_norvegicus
Polr3h_predicted
7
SNORA44
7006..7134
12311
AGCCACCATGTGGTTGCTGGGAACTGAACTCAAGACCTTGGCAAGAGCAATCGATCAGT
GCTCTTAACCACTGAGCCATCTCTCCAGCCCCGTTTTTTTTTTTTTTTTTTTTTTTTTTT
TGTCTTTACTTTCTAAGTGCTGGAATTCAGGTGTGTTTGCCACTATGTTTGGCTGACCAA
AATTTTGTGTTGGGGGGGGGGGGCGGCGGGGAAGGGAGCCGCTAAAACAAAGTCTTATTT
TGTAACTCAAACTGGTCTTGAACTTGCAGTGATTATCTAGCCTCTACCTCCTCAGTGCTG
GCATTACAAGTGTGAGACTGTTTGCATTCAGCTGTTTAAGGACGGAGTGTGCTGAGTTTT
AGTGAGTACATACATCAATTGCACCACTTAAAATTACTGTCACCCAGAAAGGCCTGGTGA
CCCTTTTTTGCCCACTGTCTTGGGTACTTGTCTGGAGTAAAGACTATTTTTTTTTTAAAG
ATTTATTTATTTATTATATATAAGTACACTGTAGCTGTCTTCAGATACACCAGAAGAGGG
CATCGGATCTCTTTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAT
GACCTCTGGAAGAGCAGTCGGGTGCTCTTAACCTCTGAGCCATCTCTCCAGCCCGAGTAA
AGACTATTTTGAACGTGTTATATTTGTATTTTCAAAGGATCTCTCTAGCTGCTGTGCAAA
AGAAAAGACAGGCTGGAAGAGCAGAATTATCGCCTAGCAACCAGACTCGCTCAGTGGCCG
GGGTTGGCTGGCTTCAGAACGAGGCCCCGCCCTCTCAGCGCTGTACCCCGCCCCTCTCCT
CTCAGTAGCGGGAGAGTGCAGGCGGCTCCGCCCACCTTCAGGCTCCTCCCCTCACAGGAG
CCTTGCCTAGCTCTGCGACCCGTAGGGGCGGGCAGATGCTTCTTATTGGTCAGTTCTCCG
GAAGCTGAGTTCATTTGGTTTGGCTAGCGCTGCGTTGGGGCCTCCGAGCCGCTGGACGCG
CGTGAATGGTGCGTGGCTTCCGCGCGTGGTGCGGAGTGGTCGGGGCGGGGATGGGACGGG
GTCGGCTCTTCTCCAAGCCTGGAGGAATGGGGCCTCAGGTTCCTCCGGGAGAGGAGCGTG
GCATCCGCAAGCGGGACCCCAGGCCCTGCCCTCCCGCGCGGCTCGGCTGCAGGCTTGGCT
TGTTAGAATCCGAGAGGGAATGGGGGCAGCTCGGGGACCCCCAGCCCCTCACCGTTCTCA
GCCCCGCGTGCTTAACAGCTTCTTTGGGTTCCAGAGCCCTAGCGCAGGATGTTCGTGCTG
GTGGAGATGGTGGACACCGTGCGCATACCCCCGTGGCAGTTTGAGCGGAAACTCAACGAC
TCCATTGCTGAGGAGCTGAACAAGAAATTGGCCAACAAGGTACTAGGCCCTCGGGTTGCC
GGGCAGTGTCCGGAACGGTCCCGCTGCTTGTCTGGCCGTCCCTTGTTTCAGCCTTGGCCT
TACACACTTAACGTAACTTCATGTCAGGGTTTCTTTCCTTCCCTTCCTTATAAACCAGAC
TTGGATGTCAGCGTGTACCCAAGGGAGTAAATGGGCTGGACGAAGTAGTGTATACCTGTC
ATCCCAGCTTCTTGGGTTAATAAGGCTTGTGACGATCCTGAGTTCGAGGCCAGCGTGGGC
AACATAATAAACCTGTTTCAAACAAATTAAGCATCGAAACTGCTGGTGGTAGCGCATGGC
TTTAATCCCATTACTTAAGAGGCAGAGGCAGGTGGATCTCTGTGAGTTCGAGGCCAGCCT
GGTCTACAGAGGGAGCTCAGCCATGGCTACACGGAGAAACAAACGTCTCAAAAAAAAAAA
AAAAAAAAAAACCAAAAAACCAAAAACAAACAAACAGACAAACAAAAAACCAAAAAAACC
TAAAAAAAACCAAAAACACCGGGGTGTTGAATAGTGCTTAAATTTGCTTGACATTTGAGG
TTTGATTCTCCGTATTGTCGGAAAACAAAACAGAGTACGAAATGGGTTTGTAAAACGGAA
ACCGGAAAATGCCTGTTTCCTCCTTCAATTACTGTGCAGTCTTGGCCAGGTCACCTACTC
TGGGCCTCAGTTTGTCCAAGTGGGTGAGTACAGAGGTCAGAGGATAGTGCGTGCTCTCTG
GAATTGAGCTCAGCTGTCAGGTTTAGAGGTGGCTTTTTACCAGCTGACCCAGCTCATTGG
CCCCTTCCTTGTATTCTTTTGGTTACTGTATTATGTCCCTTTCTGTGAATACAGACCTTC
TCTGATGTAATCCTTTCATTATCCCCAGTACTTAGCCAGAGCGTGGCAGGGGAGACAGAG
ACTCTGCCCGTGTAGCATAGTGAGGAAGAAGAGCTGGCTTGAGAGGGTCCCCTTGTTAAT
GAGCCAGGGTGGATGCCATGAAGGACAGGCATTCACACAGCTGGAGAACAGAGGTGTGCC
ACCTGGGATGAAAGAGATTGGTGACTTCTGAGAAAACAGCACTAACCTGAGAGCTGACGG
CGAGGAGAAGCCAAGAGACAGACTCTGATTTGATGGTTGGAGCAGGTTAGGTATAAAGAG
TTGTGGAGACAGCGCAATTAGCATGTGCAAGGGTCCTGAGGCAGGAGGGCTGTGGCATCT
AAGAAAGCACAGAGAATGCCAGTGTAGCTGGAACACAGAGGCTGGTCTAGGAACTGTAGA
CAGAAGCCGGACCACAGAGCCCTGGAGGGCCTTACAGTCCAAGTTGTTCTTTTCAAGTCA
GTAGGAGGTGATCTGAGAGCCAGGAAGAAAGAACAGGTTTGGCTTTACATAGGAGACAGG
TAGATCCTTTACAGGAGGCCGAGGCCGGAAGAAGGGGTATATCACAGACCTGAGGCTCGT
CAGATGGAGGAAAAACGATGCTGACTTTCCTTTTTTGGGACAGGATCTCACTATGTAGTT
TTGGTTGGCCTTTCAACCCAGAGCTGCCTGCCTCTGCCGCCTAGTGCTAGGATTAAAGGT
GTGTGCCAGCTGCCCTCGCTGTTCTAGTGCTGTAAGGAAACACCATGACCAGGACAACAA
GAGAAAGTGTTTTACTGGAGGCTTGCGTATGGTTTCGGAGGTTTAGTCTTTGAGCATCGT
GGCAGAGGCATGTTGGCACACATGGTGCTGGAGTGGTAGCTAAGAGCTACATCCTCATCT
ACCAAGGGAGTCAAACCACTCCCACTGACAAGGCCACGCCTCCTAATCCTTCTGGTCTTT
CTCAAGTTGTAGCCCTTCCTGATGATGTCAGCATTCAAGTGTATGGGCCTGTGGAGGTCA
TGCCCATTCAGTCACGGCATCCAGGGCTTCTCTCTTTGTTATTTTTTTTAATTACATGAA
TTTATTTTGAATGTGGTGTATAAACCACAGCACACATGAGTAGGTCATCGCACACCTCGT
GAGGAGAAGGGTCCAGGACCCGGCGTCGGTTAAGATGGACGGCAGGCACCTTGACTGCTG
AGCCGGTTTGCCAATAGCATCTTCCCTCTTATTTTTGAGACAGCATCTCGTGGGACTTGA
ACTCGCTTTAAATTTACTGTGTAACCAAGGAAGAATTGGGACTTCTGATACCTCTGCCTC
CCTCTCAACTGCAGGGATTACAGGCAAGGATCACCATGCCTCGTTGAGGCCAGTTCACTC
GATCCTGTGAGAGAAGCCCCCCCAGAAATCACTGCAGGGAGCTCTGCCCAACGCTGAGGT
GCGCTATGCATCTCTAGTCCCTGAGCAGCTCTTGTGAGGGCTGTGACTAGGGGTAATATT
GGTGGTAGATGTGCAGACACTGAGCTAAGTCCTTTAGAACAGCAGAGTGTGTGACTTGGG
CCGTGTGGGCTTCTGGTCTGTGGAAGGGCTTTGGTCACAAATCCCTGCGGGAGCCCCGTC
TGTCTGTCTGTCTGCGATGGTGTGAGAGTGGTGGAGTTCTCACACTTCTTGGCTGTGATC
TGGGCACAGACTTGGGGACACTGGAAGTGTAAGCTTAAGCAGGGGCAGTAAACTTTGTCA
TTGTGGTCTGACCCAGCCACCAGCGGACTTCATGTCCATCCTACCCACTCAACCCTCCAG
CTGCAGTCTCAGGTTTGAATGTGGAAGGCTGAGGCTGAGAGGCAGAGTAGTATCCTTGCT
GGTCCCACAGTGAGGCAGAGCTTGCCTGTGAGCGTGAGGTTTGGAGCGACCGGGCCCTGG
GGTCACTGTGTGTGCATATGTGTGCATAGGTCGTATACAATGTGGGACTCTGCATCTGTC
TGTTTGATATCACCAAGCTGGAGGATGCCTACGTATTCCCAGGGGATGGAGCATCACATA
CCAAAGGTGAGTGCCTTCTCTCCCTAGGGTACCATATTTCTTGGGACTCCTCTTGAGGTG
GTGGGAGACCTGGGCCCCAGTCCTAATTCTTCTAGGAATTGACTTCAGTGACTGGGTACA
CATGTCCTCTATGGGCCTTAGTTTCTTACCTGGAAGACATTAGTGTGGATGAAATACTCT
CAAAGCCACTACAGTTTTGTGATTTAGATCATGGTTCAGCCTGTGTGTCCCTCGGGTTCA
GTCTAGTGCCCCTGCTATTTGTCCCGCCCCCACGCTGCTCACTGTTTCATGGTGAGATGG
AAACCACTAGGCAAGGGCCCTGAGTTGTGACTGTTACTGGCTGGAAAGCAGAAGGCAGGG
GAAGAACAGGCCAATTGGGTCTAGGGACTTAAAGGAATTAAACAAGTCCTTTGGGCCAGC
AAGTGGCTCGGGATAAATAATGTGCTATTGGACAATCTAGAGAACTGACTGTACAGAGTT
TTCCTCTGATCTCCATATTATGATATAAATGTGTGTGAGGCCTGCACAAATGCACTTGTG
TGGCCTCTGAGCAGGAATGGTAACACATACCTGCAATTCCCACACCTGGGAGATGGAAAC
AGGAGGACCAGGAGATCCAGGGCAGCCTGGACTATCCAACAGTGATAGTAGATTCTATAC
CTCAGGGCAGCCTGGGCTATCCAACAGTGATAGTAGATTCTATACTTCAGGGCAGCCTGG
GCTATCCAACAGTGATAGTAGATTCTATACCTCAAGGCAGCCTGGGCTATCCAACAGTGA
TAATAGATTCTATACTTCAGGGCAGCCTGGGCTATCCAGCAGTGATAGTAGATTCTATAC
TTCAGGGCAGCCTGGGCTATCCAACAGTGATAGTAGATTCTATACCTCAGGGCAGCCTGG
GCTATCCAACAGTGATAGTAGATTCTATACTTCAGGGCAGCCTGGGCTATCCAACAGTGA
TAGTAGATTCTATACCTCAGGGCAGCCTGGGCTATCCAACAGTGATAGTAGATTCTATAC
TTCAGGGCAGCCTGGGCTATCCAACAGTGATAGTAGATTCTATACTTCAGGGCAGCCTGG
GCTATCCAACAGTGATAGTAGATTCTATACTTCAGGGCTTCCGGGAGGACTAAGGAATTG
ACATAGTAGAGCTCAAGACTGGATCTTGGCACTGAGAGATTATGGGGCACATGTGTTTCC
GTTGGTTCTGTGGGTTACTTGGTAGTGCTCTTCTGGGCAGTTGGCAGGGCTAGAATGTCT
GGCTTACTGGTTTCAAAGGTCTGAAGTTCTGTGCCTAAGTATGTCTTCAACCTACCTGGA
TGCCATTGACCAAAAGAGGTCACATGGCTGAAACTAAGGGATAGAGAAACAGACTCTGTC
CCTTGTTGAGGGAAACTGCAGTAAAACTGAGAGGTGTGTGCATCTGGGGTGCAAGGGTGC
TAGGCAGAACCTGGAGGAGTGGTGAGTAGAGCTGGTGTTCAGGGCTCTTCTGTAGCTTTG
TCTCTTGGCACTGGGCAGCAGTGTGGATCCAGCCTGTCCAGCCTATTAATGGAGTAGAGG
CAAAGTGACAGATACACCAGCCACAGTGGACCTTGTCTTTGCCTGTGTTGGTCATCTTCT
AAGCACAGGGATGTGTGGGTGAGTGTTCTGCAGGGTTTGGAGACAGCCTGGGGTCTGTGC
TGACACTCAGAGACTGGTCAGTTGACATGGGTGTTGGGCTCTGCAGAGAACCCCAGGAAA
CAGGCTGTCTTTGTGTGGATCAGGCATTTTCACGAGTAGAGAAGGGAGCCCAGAGTGTAG
AAAGCTATGAGGAGCTCTGTTCTCAGAGAGGAGTGCCAAGCCGAGCTGCTCTGCACTTAA
CCAAGGGGGCTTCTGTTCTCAGAGAATGCTGCTAGGCCGAGCCAAGAGCCTGTTGTCCAG
GAGGCAAGTACTAATAGGTATCCGGACTTCAGGAAGACCAGAAACAAGTCAGCATTAAGG
AAATGCTGCCTGTTACCTTGGTGATATTTGTCACTTCGTCTCCAGGATTGGATTTCATTG
TCCCAAATGCCCTGCTCACCCTGCATTTCTTGTTTCGATGTGGAAGATGTAAAGTCCATC
TCAGACCTATGTTTGAATTCTGGCCTGGGCAGCTTATCACACAGTGGGATTGCCACTTAT
TGCTCTGAAATCCCTGGAGGGTCATGGAGCACCTCAGGGCCATCAGAAACTCAGGGTCAG
ACTTGGTGACAATCAGGAACTCAGGGTTAGATTTGGTGACAATCAGAAACTCAGGGTCAG
AGACTTGTGACAACTTGGGGTCAGACTTGGTGACAAGCTTCTTTATTACTGAGTATTTTT
GCTGACTTTTCTGTTTTCTGGCTTGTAGAACCTGACTAGTGCCTCATGTGAGTGGAATCA
GATTTATCCTTTTCACAGAAAGTCAGCACATCCTAAGGGTTAGGGAGGACATGTCCTGGG
GTCTATTTTCTTTACACCTGTTAACTGAAAGCAAATGACCCCCCCCCCCCCCCGGGCATC
TAGGGGATAATGAAGCACATGGTAGGGATGGAAACCCAGAGCCTCATGCCACTTAGGTGT
TCTCCCACTGTGCCATGTCTCTAGCCTTTTGTTGTTGTTTTAAGACAGGGTTTCTCTGTG
TGGCTCTGGCTGTCCAGTAACCCACTATGTAGACCAGGCTGGCTTCGGCCTCACAGACAT
CTGCTTTCAGGATTCTGTGATTAAAGGCATGCGCCATCCATCATACCCAGCTTCAGCCTT
CCTCTCCGAGTCTGACTGATGTTGTGCTGTGTGTGCCCCAAGCTGCTCACCACCTTGCTT
TCAGATGAGGTATTTAGGCTCTGGGCACTGGTTTACATGCTGTGCTGTCCCAATAAGCCT
TGTGTCAAACTAAGCCTGGCACAGCCTGGCAGAAGCTTTGAGCTGAGTGCTAGGTCTTGT
GGGGGGCAGGGTTTTCCATCCTGTGAGTAAGTGACCCTTGGCTGCTCCTGGCTGGATTCT
GGAGAGGTAGTAGAGCCTTGGTCATCTTCAAGTTGTCACCTCACAGAAGGTAGAGTGCAG
CTGGACAGAGCCGGGCATGGCAGGCCCTGATGTCCAAGATGGCAGGCTAGGCCACTGAAG
GAATCCTGGTAGAAGCCCGTGCTGGTAGAAGTCTGTCTGAGGAAGGTGCATTCAACCTGG
TGGCCTTGTCTGAGGCAAGATGTAGAGCAGTGATTCTCAACTTGAGGTCCCAACTCCTTT
GTGGGTCAGACACTTACATTAGGATTCATAACAGTAGGGGTTGGGGATTTAGCTCAGTGG
TAGAGCACTTGCCTAGCAAGCGCAAGACCCTGGGTTCAGTCCTCAGCTCTGAAAAAAAGA
AAAAAGGATTCATAACAGTAGCAAAATTACAGTTATGAAGTAGCAATGAAATGATTTTAT
GGTTGGGGAGGGGGTCGCCACAGCACGTGGAACTGTATTAAAGGGCCACAGCATTAGGAA
GGCTGAGAACCACTGCCTTAGAGTCTATCCCTGGCTGAATGAGCAGGAGAACTGTGTGGT
TGGGACAGGGCACACAGCCTCTGAGCTGCCTCCTCTTCCTCTGTATGGTAGAACATGGCA
TCTGGCACAGGAGGCTCATAGGCAGTGATGGCAGAGAACATCTTTCTGGGTGACAGGGCC
AGTGAGGTGTGGCCTCTGCTGAGGCCAGGAGTCATTCTGGTGTGGTACAGCTTTAGCCAG
CCTTTTCCTTGGTTCAGGTGAGTGGAGAGTGCATAGGACAAGGCATGGGAACACAGGAAG
GCTTTCCCCATGTCACCTCGCCAGGCAGGCAGCCTTGCATTTTTAGTATCTGTCCCTGGT
CTCCTGTCAGCTTCTGTGCTTGGGCGTCAGGTGACAGGACCTTCCTTCCAAGCCTGGCCA
GTTGCTTCTTTCCTTTTGGAATGTGAAGAGCAGCCTGAAGGTCGTTCGGAATTGACTTTG
GGGGTCACTCATGGCCCAGAATCTAGGCTCAGGTATGACTGAGATGGATTTGGAAGCCTC
AGTTCCAGGGCAGCAGCTGCTGATGGTTCCTTATGGGGACCAAGCTGTGGCCTTGCATAA
GTGAGGGAGGCTTTGTTCTCTGGCTAAGCAACAGGTCTAGGCCTGCAAGAGGACTCAGCA
TGAAGCACTGGCTAAGTGCTGGCAGTGAGGCGAACATTGGAGAACGTGAGCAGCTCCAGG
CTCCGTGGCCTTCTTGGCAGGCCTGGTGTTACTACCACAGTGTGGCCTTCTTTTCTAGTG
CATTTCCGATACGTGGTGTTCCACCCTTTCCTGGATGAGATTCTCATTGGGAAGATCAAA
GGCTGCAGCCCAGAGGGTGTGCACGGTAAGGTGCCCTGACTTCTGGGGCAAGACTGGGAC
GCAGTGGGGTGGGCATTATGCTGACCACGTGGTCCAGAATCCAGCTGAGCCTCTCCTATG
GCAGTGGAGGGGCTGTCAGCTGCAGAGCCATACTCTCAAGGAAGGAGTCAGGGCTTCAGC
TCTCCTGTAAGGCCACAGCTTAGTAGCTGAGAATGGGTGCTGAGCTGGTGGAGGTGACGG
GCTCCCTGAGAATGCTGGGAGCTGTGTGTCTGGAGCTCTGCCCAGGGCTGCTCAGCCCAT
GTGGGGTAGAAGGAGGGCTTTGAGGAGGGAGGGGACAGACTGCCCTGGAGACACCTGGGC
CGCATGGGAGAGGGACTTGCCATCTCTGCTGGGCTTTCCCTTTGAAGCCTCATTCTCATG
TCATTTCTTCCTTTCTTCCAGTCTCTTTAGGGTTCTTTGATGACATCCTCATCCCCCCTG
AGTCACTGCAGCAGCCTGCCAAGTTGTATCCTCTCAAGTGTGGTTTGGAGCAAGTGGACA
GCCAGCCCCATTACTGTGGTTCCCTGGCCTGTGATCTGTCACCACTGGTGGTGCTTGTGT
GAAGCTCCAGGCCACCTCTGCCTCCCATCCTGCCCAAGTCTGTCAGGCTGGGTGATATAA
TAGAGCCCTACGGCTCCTCAGCCATCACTTCACTCAGGCTGTCTCTGCAGAAGTCACTTC
ACATGTCCCCTGCAGCTTCACCTGGCAGGTGGTCTCTGCTTCTCTTCACCCCCTGCTGTG
GGGCTGTTTCTTTTAATGGGACTGTCACTGGTCCCAGGAGGGGCTCAGGTGGTTGTCACA
ACTGCACTCATGGTCTGGGCAGAGGGAGATGTGCCACTAGAGGGCAGTATGGCTCTGTAG
GCGCTAGGGGAGGAGTAGAGCAGGCACTCGCCTCTCCTCTCACCCAGGCCTGTGCAGGCA
GCAATACAGGCTACATGAGACTGTGGAATCGTCAGCAAATCTGGCCTTGGTTTATTGTTT
CTCCTCCTTCCTAGACAGGTGGCAGTCAGACCTGCCTCTCTTGAGGCCCGGGCAAGCCCC
ATGATCTCTGTCTGCCTGTCAGATTAGTTATGAGGATTAAAAGAGAAATGCAGGGCACCT
AGGTCAGTCTCATCCTAGAGGTGGGAATAGAATTCTCATTTTGGGTCCTGGTACAAACTG
GCTGCTCTCCAAGGGACAGAAGCAGCTTTTACTGTATTTCCTAGCGCAGATAGTCTCAAC
CTCAGGCTGGTTTTAACCTGGGTAAGTACTTCAGAGGACCCGCAGCCTCGCGCTCCCATG
GCGTGATTGTGGCCTTGACCCTGGACTCCAGTGATGAAGCGGAGCAAGTGTGGGTGTGGG
AGTATGAGACCGAGGAAGGAGCTCATGACCTGTACATGGACACTGGTGAGGAGATCCGCT
TCAGGGTGGTGGATGAGAGTTTTGTGGACACATCCCCCACAGGACCCAGCTCAGCCGAGG
CTGCCTCTTCAAGCGAGGAGCTGCCAAAGAAGGAAGCACCATATACACTCGTGGTAAGCT
GACAGGAGACTGCTTTCTTGAGGTTTCAGGTCGTCTTCTCTGATTGTCATCTGTCAATCA
CACTAGTCTGCTTTTGAGGGCTGGGGCCATATGGTGACAAGATTGCTGTAGATGATGGGC
AGGCAAGGTAAGAGTTTGGATATCATGATCATCTTTAAGGGACAAAAACCAACAAGAGGC
TAGAGAGATCAAAGCTGAGACTAGAGCAGGGTTCCAGGAGAGTGTTTTTCAGGCCCCTCC
CTCTGCAACTTTGGGAGCTCAGAAAGACAGGTCTGGGGTCGAGGAAGGGTTCCCTGATCC
CACTTGAGGCTTTGGAGCCTCTTTCCTAAAAATCTGGTGAGCTAGGGCATACGTAGTGAT
CTTGCTCTCTGTCTCTCCAAGCCTCCCGACTGTTGTGAACCCGGCCTTGCTTTGCCTGTG
CTGGCCTGCTAGATGTTGAATAGGGTGAGGGCAGCCCAGCTCTGAGTGGTGATGAGTATA
CTTGTGTTTTCTGTCTTTGGCAGGGATCCATCAGTGAGCCAGGCCTGGGCCTTCTCTCCT
GGTGGACCAGCAACTAGCCCTGGAGCTCCCAGTGACTGCCCAGCCTGAAGACTGTGCAGA
CCTGTGAAAGTAGAGAGCAGCTGGCACTGAGTGCTGCTGGAGCCAGGCTTGGTGGGACCA
GGAGCAGAGTGACAGGTGCTTGTCCTCTTCCTCCCCAGCACTGCTTCTCTGATCTGGAGC
CACCCTGAATCGTTTTCAGAGTGTCATGGATCCAGGCTGGCTTCTCACTTGCTGTCTAGC
ATAGCATGGAGCTTCTGGTCATCCAGCTTCTACCTCTTGAGTGCTGGGATTACAGGTGTG
CAGTATACGTTGAGCTTTGTAGAAGGCAGGGATGGGTCCCAGGGCTTGTGTACACCATGC
AAGTATTCTACCAACCATGCTGCTTCCCCAGCACAAGGACTGACTTTTTTTTAATTTCTT
CAGGGCTGAGGAACCCAGGGCCTCTTTTGTGTTAGGCAGGTGTTGTACTACTGAGCTAGG
CCCAGTCCATCCTATGGACTGCTTCTGGCTTTCTGTGACAGCAGGAACATTTAATAAACA
CTGACAGCAACAGCAGGAACCGCCCCACTTCAGTAGCTGACATCACGATCTCAGGTCATT
GAATTGCCCATCTTGGACAGCATGTCCTGCCTCACCCCAAGGCCCATTTAGAGATGACCT
TTCTCAGGCCCACAGATGGCAGGTCTTTGTTTGAGACCAGACTGGCTCTGTAATAAAGGT
AGGCTTACTCCGGACAGGCGTTTTGGGTCAGTGCTCAGTTACTGGTGCAGCTGAAACACT
AAGCAGCAGCCTTACTCCCACAGCATCTGGAAGGTGGACCCTCCAAAACGAGCCAAAACC
CCTTCCTGTCTAGGATGTGGAGACGGAGGCCCACCCTCACCAGAAGCCTGGGGCTACTGC
TGCCTCAACTGTGACCATGAGCGCTCTGTGGGGATAGCATTGCCCTGGGTCCACAGATCA
GATGGCTGTCTAGTCCTGCTGTCCCTTTCTCACTGGCACTTGTGTGATAGGCTGTTCTGT
GACAAACTCCCCTGGCTTGCCTGGGCCTTTCTGTGTGAGATTTAGCTGATGCAGCCCATG
GAGAGACCCTATCTTGTCATAACTCTGCTGTACAGGCTAGAGGGACTGTCTGGTTAGCCG
TGTCTTGGGGCAGATTCCTTTTCAGGCTGTTTTTTTTTTTTTTTTTTTTTTTTAATGTCA
GGAATCTGTACTTTTTTTTGTTTGTTTACTTTGTATTTATTTATTTTTTTAAGATTTATT
CATTTATTATATATAAGTACACTGTAGCTGTCTTCAGATACACCAGAAGAAGGCATCAGA
TCTCATTACAGATGGTTGTGAGCCACCATGTGGTTGCTGGGAATTGAACTCAGGACCTCT
GGAAGAGCAGTTGGGTGCTCTTAACCACTGAGCCATCTCTCCAGCCCCTTTTCGGGCTGT
TTTAACTCTGCAGTCTAGACTGGACTTGAACTCAGATCCATCTGCCAGGTGTGTGCCACC
GCCACTAGCGTTATCTTTAAGGTAAGTACTGCGTCTACTCTCAGGGGAACAGAGGAGGAG
GCACCTCTCGTC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1027, 1294..1418, 4229..4325, 8578..8664, 9081..9144, 9991..10192, 10703..11311
1308..1418, 4229..4325, 8578..8664, 9081..9144, 9991..10192, 10703..10756
AC_000075.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved