Rattus_norvegicus Locus Rpl30
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rpl30
Rattus_norvegicus
Rpl30
7
SNORA72
3475..3606
4901
tcactgggacctggagctgacaggttaggctaggttgggtggcgttagcctcagggatc
tgttccagaaatggaattacgatcctgcacaaccatgccagactttttgggggtggggtg
tggcggggaggtttaggcatagaattcaggtcctcatgcttgcaaggcaagcactatact
gactgaacaatctcaacaacccggggtttttgttggtgctagagtgcataaatagaggct
ttcagtctctctctttttttttttccccacgaatactacatttatacaacggcccaagtt
tcgtagcaaagtgattttaaaagtattcgtattgtgacagtttacttctgtatacttatg
tgtgcatccaagcgcaggtcagagaacctgctgagcctggcgctccccttacaccacgtg
ggtttggaacgcaatccatctgcttagtggcaagcgcatttacccgctcagccacctcac
cgagtttagattattttttttaattgcggtccctgtgcaaagtcggctcccaagtacacg
gaataaaaccgccacaggaagtgtatgtatgtatgtgtgttggggggtgcggggggtgtc
tcctacgagcggcaagcaagaagatcagcggcaggtggacagaaattgcctccaaaggta
acgccgcgtcccgtggtcttcccggaacaacatcccgaggccacatccggcggagaccag
cccagaccctgccgcctcacacacggcgccctcggccgtcgtcgccagctcctatagagt
tcccgttctccgcggtttcagcccacagcagcagaacacaaaccgagaaccgtaggccgc
agcccaggccacgtagcagcccagccagatccccatagcaaccaactgccacagctcact
ccagcaagtgcccttccgctagtgacaggctcggcttctgcttccgcttcctgtcccata
atcctctgttcgcctagaagagctttgcattgtgggagctcCTTCCTTTCTCGCTCCCCG
GCCATCTTGGCGTCTGATCTTGgtgagtgagctctgctgggtagaggactaggcggctcg
gggagctccgctagttggtgtttgacgctctgtatcataatcctcacttctgccctctgt
gtattctagGTTGGGGCTTGTCCCGCACCTAAGGCAAGAGGATGGTGGCTGCAAAGAAGA
CGgtaagtgaagccgaccgagcccggaagccgcttcacgtggagagctgggtctgggccg
gggcggatagatctgagcacactgggtggattgcatgccgctgacgtttcagggtttcaa
agtgaatccgagaggccctacgtgacttcgcaggcatcattaaagtgttcaattccagaa
atttggaactgggtttggttttgagatggctgcgagtggttttcaagtctcaaatgtttg
cattgtagAAAAAGTCTCTGGAGTCAATCAACTCTCGGCTCCAACTTGTTATGAAAAGTG
GAAAGTACGTGCTGGGGTACAAACAGACTCTGAAGATGATCAGACAAGGCAAAGCGAAAT
TGGTTATCCTCGCCAACAACTGTCCAGCTTTGAGgtaatggagggaatatgaatgtatgt
ggcttattgtagattccagcattgggaagaataatgatggttgttttctgatgtttggac
cctgatttgtgtgtgtattcttctgtaagtgtaaatacacagtgtgtaacaggtcgcata
caaatgataacacgcaggttcagggaagcacggtggcttttcccacgtatctggaacatc
cctatttttgatcgtctttcaagatttgaagtgttaacactccattgctgtgcgtgtttt
agttttaaaaaatttcagctaaattcataaagtcacctattagcagggtccaattttttg
aacattagtttattcttgattaaccattttaacttgagcatagtattttaagtaagctaa
agaaacttgtatagtataagcctcttgacttttctatggtgattgcacaccttcattctt
ttatgtagttcagacttagtggtccagtctggggcttgaagttcatttctcataagcact
ttggggcactgttgatggtctatgggccacataataagctcaagtttctgtggaactttc
acatcttaaccatttgaatccattaacctggcactgaagtgtttattctttgagtaatag
tatcagcagtccttacgcagtggtcagtatgtagtaggtggtaaggtggcttatctatct
tttttacactttttaccctccattccaattcctattccacccctcgttcctattagtctt
tgcctcagtttgttaagatggagtatataatacttgttgctgacatgagaaataacaccc
tttgagaatccagaagattctcctggagctggagttaagtagttgtgaggcagctggtgt
gagtgctgggaacagaactttgttaagagcagcacaggctgtcagtgtaccaggccagca
ttgacttttttatgtctattatcccttttctagtactttagacaccattttttcctgtgg
tttctaagtaacttatttcaaacacattttaaacgtatttagtaaattgaaacatgaata
caatgtatttagtaccgaatactacctcaacaaagtaggtatttagtagaaaagtacagt
atacactagtaaaggatctatgatctttttttttttttttttggttctttttttcggagc
tggggaccgaatatgatctttttttttaaagcctcaccaatttgtagtgaatctgtcaat
acctttgtatggggttttgtctgactttttgttgttgttcccccaagGAAATCTGAAATA
GAATACTATGCCATGTTGGCTAAAACTGGTGTCCATCACTACAGTGGCAATAACATTGAA
TTGGGCACAGCGTGTGGAAAATACTACAGAGTATGCACACTGGCTATCATTGACCCAGgt
atgcttttaaaattatattttttttctaatgtatgtacttattaggcagtggctttggtt
cctgagttcagaccattagaacttcagtattgaaaaagatatgccataattttattttgc
aaagaattgacagtgcacatcagtacattgtaattggcttttctataaatacaaagaaaa
atttttttaactttgttaggagttttgtttaatgaagtgaggccagcctggcctacagaa
tgagttccaggacaactggggcaacacagtgaaactatttgtgtctcttccccctcttga
cccctcttaccacaccccacatccttgggaagaagtgtttgttagaaggtgaaaatacca
ggccagataaagagtcatctcatttttgcttgggaacaaatgctttgtggtgaatgccca
caaatactcgtcatcctgtgttttgagcttagacattttagttgcctggtagaacatgcg
aatattctcgctgttctgattttgtgataatcaggacaggctaaacattcgctatagtac
gaccatgcatgtgtccccagacctagttctttacctgggtctggttttctcaatgctggt
gacaagccaggtctgattcattaaatgtatgagctgtatagtcataggatgactgagatt
ttaaggtatttttaattggttttaagagtgacagccgccactttaacattatgctaatct
gccttcttacctaaaaaacatgtaggggaattctgtaattatcagttgccattaaatgac
ttgtaaaccttttattttctagGTGATTCCGATATTATTAGAAGCATGCCAGAACAGACT
GGTGAGAAGTAAACAAGAAAGTTCTCCTTTAATAAAACTTTGCCAGAGCTCCTTTTAAAA
AAtatggtgtctgggcttcttcttgtttggctttcttgaaaccactggcaagacttgggt
gaaagttatgtatactgcctggtttccattttgctggggttttgttaaaagattgtacac
tgtttatcattatgcaaaatgtgtttctgagtatatttcggatattgaaatacacatttg
tgttgatctaatatctaatcaaggttggttggtgtttttaccacttttgtatactgaggc
aagtctcccttaaaccctgagtttggcaatgccagctagcctagccaacttcctctgggg
gatctctccggatacccagagtgatagaattgcaggctagcacctgccacttactttaca
tgggtgctggaggttcagcctcagtcctcaagcttgcacaaaaagctttgcctctaagct
gttaccccagctccttataaagaccggccagtctcaggctgtttgcattgtttttgggtc
ttagaggcactggcataccaagacttgtgatgggcaaaagctgtggactttgcgtgctac
ttaaattgatttagaactattttccttttcaaattatttcctacttagttccttaaaata
tggtagtttctgtgttgtgacttggctacaggcatttaaatattttttttgatgtgtggt
ttctagggctttgtaggtactgataatagggtataaggtaatttaaaaaatttttttgtg
tagtcattgtgtttgtaagaagggtttaaaacacaggaaagtttaaagcgagatggtagg
aagcataccgtactttgttgtttcgtgattcttaaaagaagtgccttactaatgttattg
aggggaaaaggtcactgtcccaaatcaagagtggtgaaaaatggcattttaaatgtgcag
ggattctagctagctacatttagtccacagctctactggttgggtgtggagtacgttgat
tgcaagcagcactctgtggcatatgaacaaaactgttgacag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1041, 1149..1201, 1448..1593, 2867..2997, 3802..3901
1181..1201, 1448..1593, 2867..2997, 3802..3851
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved