Rattus_norvegicus Locus Slc25a3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Slc25a3
Rattus_norvegicus
Slc25a3
7
SNORA53
6797..7042
9462
AATTTTTAAAATGACACATCAGGGCATTGAATGCAGAGGTTGACCTAGTATTACTACAA
TAGTCAGTACAACATGCCAGCTCTAGTGGTGTCTTGGGTTGAATTAAAAGTATTTTGATA
AAGATGAGGCAAATTTCCCAGGAAAATGTTAAAAGTAAGAATTATAACAGGTTTGATTCC
TTCTAAACTCTCCCTCATGGGACTAGGCCCCCGCTTGTCGACATGAGAGTAATGATCTTC
TAAATGTCTGAAGCACACACAATCCATCGGTCCCTTTCATTTCAGCGCATGCCTGTGCCT
GCAGGAACGAAGCATTGATGGACTGTTTTCAGGCGCCACGGACGTTGCTGTGAGGCAGAA
GCAGTTTTATGTATTGTATGAATTCTTCCTGTATATCCTTTCCACCAGAACTTGGTGGAA
TATTTAGACATGCCTGTAGTCTAAAGTCAGTGAGTGGAATTTTTTCTAAAAACGTCCGAT
GATGGCAGGAATTCCGGCATAAGATCTTATAGCGATATCGTAACTTCAATCCCTGAATAA
AATATCACTTAAGCATTCCTGTCTTAAAAAGTTTATGCCGGGGGCTGGGGATTTAGCTCA
GTGGTAGAGCGCTTACCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAAA
AAGAACCAAAAAAAAAAAAAAGTTTATGCCGACAATCACTTAAAGACGTGTAAAAATTCC
TGGCGCCAAAGAGAAACACCCGAAGGTTAAGGGACAGAGTGGGTAGGTCGCCCGCTAGTC
CAAGGCCAACACTGCACATTTAAAAAAAGGGGGGGCCCACCCGCTCCGGATATGCGCCTG
CGTAGTAGGAATCCTCCTGCGCACTAGCCCGGCCGGAAGGGCTGGGGGTGGACGGGGGCG
GGGATAAGGTTGCTAGGAGGACGCGATGACGTCCAGGCTCTGCGCTCCTCTCTGCAAATG
GGCAGCGCGCGGCGCAGTGACGCTCTGCGTGCGTCACGGTGACGCTGCGCGAAGGGCACG
GATCTTCGGGCGGGGAGGACATTCGGCCTCTGTGAGCCGCAACCTTGCCCAGCGAGCGGT
TGGGTGTTCGCCATCTTAGGCAAGTGAACGCGGCCGGGCCTCGCCGCGGAGGGTGCGGGG
TGCAGAGCCTTGAGTCCCTTGTGGCCGCCGCCTTGGCCGTGGGCCTGGCCGGGCTCGGCG
TCCCTGGGGAAGAAGCTGTGACCTCCTCAAGGGCGCAAAGCCCGGCATGTCTCGCGGGGC
TCCTTTGACATTGCCCGGCGCCGGGTCTCTCTCACCTCCACCCTCTGTCTCCCCCGCAGG
AGGATGTTCTCGTCCGTAGCGCACCTGGCGCGGGCGAACCCCTTCAACGCGCCACATCTG
CAGCTGGTGCACGATGTGTCGGGTCCCCGCAGCCCCCCAGGTCCGCCCCGGCGTTCCCGC
CACCTGGCTGCCGCCGCCGTGGAAGGTGAGGTCACACCCTGCCCTGTGCGAGCACTGGTT
TCGTGCTGTTCCCCGCTCTGCCTACGAGACCTGGGCCGGATAGGGAGGTCGAGGAAGGAC
GCTCCAGCCCTGGACCTGAGAACCGGTCTCTAGCTGACCCTGGGATGTCAGCTCTGACGC
CCTAGGCCGCTGTCGGATCCTTGGCCCTCCCTCAAGGGCGTGGAAGGGCCCAGGCCCAGC
GCCACTCAGTGACCTCCGTGTCCCCAAGGGAGTAGAGGCAGAGAGGTGGTAACCAACTTC
TTTATCTAACCCCCAACCCATGAGCCCGCTTGGTCAGCCAAGTCTACTGGGTAAAGTGTC
CTTTTTAATCACTAGTTTGTCACAGTTGCAACTCCATAAAGTCTTATTTGATTTGCCTCT
TTTTAAGTCTGGAAAAGTCTCCTTTGATCTCCTTTTCCAAGTTTTTTTGATAATCTTTTC
ATTTGATTGTATTTGAGGTAATGGGATTGGGTGCTTTTGGTGCTAATGGTGCAGAAGGTG
ACTTGAAGATTATAAGAGGCGTGCGTGCATTCCTTTGAGTTTATGTTTTGGGATTCGAAG
TAGCTGACTGTTTTTGTATGTTTTAAATCCTATGGAACATATGTACAAGGGAAACCAGAC
AGCTGAATTATAGACCTCAAGAGAACGTTACCTACATTGTGCCTATAAAACAGAAATCCA
ACACACACAGACACACACACACCACACACACCAGTTATTCATGGGGTGATTGGAAAACTT
TCACTATCTCTTTATCACTATATCATTTTCCTCTGATTTCAAAAGCTAAAACAAACCTTT
GTATGTTTTTGACTGGGGGAACTAGGCATATGTGGTTTAGTTCATAAGTGGGTAGTTGGT
TAATAGCTGGAGTAAACGTTAAAGTTAGCAAGCTTTGTACATGTTAAGTGCTCCTTTTTG
AATTTGGGCTGTTTTTGGAGGATGCTCTTAGTAAACTGCTTTTAGTTGAAGTACCAATGC
AGGAAGTTTTAGAAAATAGTATCTCACAGATACACATCCTAATAATTTCAGCGATATGAT
TTGACAGTGACTTTCATATAATTTACGAAAACTCATCTTTCTACCCAATTGTGCCTGGTG
GCTAAAAGTGCACAGTAGTGGTAGTGCTATAGGAAAAGGAAATTGAGTTTTCTTCTATTC
CCCTAGACTTCCCGTAGGCTCTGAAGAAATAATTGATCTTTTTTCTTCACTCAAACAGAG
CAGTATAGCTGTGAATATGGATCTGGCAGATTCTTTATCCTCTGTGGACTCGGAGGAATT
ATTAGCTGTGGCACAACACATACAGCATTGGTTCCTCTAGATCTGGTTAAATGCAGAATG
CAGGTTTGTGTTGCATGCTGAACTAAAACATACTGTTGAAACAAGTTGTAAGATATACAA
CTTATACTACTAACGAGCTGTTTGGAGGTCTAACTACCCAGGAGGTAAGTGGATGCGCAC
TAATACAAGTCTGTATTAAAATGCACGGTGTGTCTTGTCTTATTACAGAGTACAGTTGTG
AATTTGGCTCCATGAAGTATTATGCACTGTGTGGCTTTGGTGGGGTCTTAAGTTGTGGGC
TGACACACACTGCTGTTGTTCCTCTGGATTTAGTAAAATGCCGCATGCAGGTTTGTATTG
GCATGAGTGGTTTTTATTTACTTTTGTTATTTGCATTTTTGTTATATAAGTAATATATAT
TATGTGGGTGGGTGGATGTGGAGATAAATGGACACCTTTTGGGAGGTGATTCTATATTTA
AACTATGGGAAACTCAAGCATGGAGCTCAGGCTCTGGCGGGTTGGCAGGCAAGTGCCTGT
TAACTGACCTGATGTGTTTTGTGTATGTGATTTATCTTACTAATAAAAAAGTTGTTTTAA
ACTAAAATACAGTTATATTACTTCTCATCCGTTTGCTCCCAACAACCCCCTCCCATGCCT
CCACCTCCCACCCTCTCAACTTGATGGCTTCATTTCTTTTTTTTTTTTTTTTTTTTTTGG
TTCTTTTTTTCGGAGCTGGGGATCGAACCCAGGGCCTTGCGCTTCCTAGGTAAGCGCTCT
ACCACTGAGCTAAATCCCCAGCCCCGCTTCATTTCTTATTATTACATATTGTGCTGGAAT
CAAGGCCTTGAATATGTGTGCTAGGAGCGCCCTCTACCACTGAGCTACACTTCCAGCTTT
GCTTACATTTGAAAAGGTTTATTTCTACTTCCTGTGTGAGGGTATTTTGTCTGCTTGTAT
ATTTGTGCACGGTGTGCCTGGAAGAGGGCATCTGCTTCCCTAGAACCTAAGTTATAGATG
GTGGTGAGCCGCTGTATGGGTGCTGGGAATTGAACCCAGAACTTCTGGAGGAGTAGCCAC
TGCTTTTAACTGATGAGCCATCTCTTCTGCCCCAACTCCCACTTTTTAAAAGAGCATCAC
AAATGAGAAATGGAGACATCCCAACTGCTACAGACTTCAGCAAGAAACAGCCCCAGCTCC
ATTTATTTATTTATTTTGCTATTTTTATTTCTATATGTGGGTACCCAGGGAGGGTGTCAG
ATCTTCAGGTCTCCTGGAGTTGGACTTACGAGTAGCTATGGGCTGGGAATTGAGCTCTGG
AAGAGAACAGTATGTATTTTTCACTGAGCTCTCTCCAGCTTTCTTCTAATGCACCTCTCA
CATGTACAGTAGATCATTACTTGTTCTGCTCTCACTCTAAGTGGATCTTAACTGCTGCAG
TTCAGTTCTGGCCAGAGGTCTTTTTCAAGGTCTACTAATTCAAGACCCCAAGTAGTCATT
GCATAAGTATTTTATGTATTAACACGGGCAGTCTTGTGTGTCATCTTATGTAAAGTAACT
TCCTGTCCCTAAATACTGAGGCAAAGAACATGTTTATTTCTCAAAGAAGCTCTTACTGTC
TTTATAGGAAAGTTGTGAGCATTGCCTCTTCTGTGTCTTTTATAATTTGAATATCATAAT
TATTGAAAGAAAAGTAATCAAACATTAAAAATTTATTTGTCCCAAACAGGATTAGAAGTC
TCCTTACCTAAAAGAGAAAGGAAGGTGAAATATTAGGAGGGAGAGAGGAAGGTGACGTAT
ACCAACCCTTCTAGTACCTGCAGGAAGAGTGAGATAAGCTCCCTTACCCACATGGCTCTT
AGACAATAGATACCAGTGTAAGTCCTCAGACATGCGCGTCTTTGCAGTAAATTTCAGAAG
TAAAGCAATTCTGTACCTCACAAGAGATGCTGTACATGTTAAAATTGTATTTAGTTTGGT
TATCTAATGTTCACGCTGCTCATGGTGTAGTACAATCTACTTAAAGGACTCCAGGGTCAG
GAATACATACTTACATCTTAAGAACTATTTTATTTCTTACTTTTTGTGTTGGAATTTTAT
AGTTTTGACTATCTAAGAATTAAGTATAGTTTAAAGGAAGCTAGACTTTAATGTAGAAGT
TGTTTATAAAAACAGTCCTAAATAGAGCCTGGAAGTCGTGGCTCATGCCTATAGTCTAGC
CTCTGGGAGAGAGGCAGGAAGCGCACTATGAGTTTGAGAGCAATCTGAAATAGAGACCCT
GTTTTAACCACCAAAATCCTTCCAGTCTGGGAAAAGTGCTCAGTTAAGAGTGTTTGTTAG
TTAGGTAAGCATGAAGAACTTAGGCGATATTCCCAAGCACCTGTCAAAACAGTCATGCAT
GTCTCTAATCCCAGCACTAGCAAGATGGATGTAGGAGTGTCCCTGGAGGTCACTGGCCAG
CTAGTCTGTGTCCACATAAATGCACACAGAAGCATGTATACATGAATACACCACACCAGC
TTTTAAAACATAGGTGTTAGCTTATATTAAGCTAAGAACTTACATATACCTTTTTTTGTA
GCTAAATTTTAAAACAAAGCACAATAGTAGAATAAAGTGTTAGATATTCTTAAATCTTAT
TTTTATAAAACTCATTGTAAATATCTTGGCAAATAAAAAACCATTGTACAGTTAGATTAA
CATAGCTGTTTCTTTTATATTGACATTTTCCCATTTTAAAGGTGGACCCTCAGAAGTACA
AGGGCATATTTAATGGTTTCTCCATTACATTGAAAGAAGATGGCGTTCGTGGTTTGGCTA
AAGGATGGGCCCCAACTTTGATTGGCTATTCCATGCAAGGGCTCTGCAAATTCGGCTTTT
ATGAAGTCTTCAAAGCCTTATATAGCAACATACTTGGTGAGGTATGTGATTTTATTTTGA
CATTAAATGTCCCAAGTGTTTGAGAAAGAATATAGTGCTTTTTGTTTGACGTATCTTGTT
TTATGGCTGATGAAATGGCCCCAGAAATAATGAACGACATGTCTTAATGTACTCTGTTGA
ATTTCTGAGAATGGTCGGTATGTGTGCTAGTGTAAGAACAGTGTGGGGCTCCTTTTGTGT
AGTATAGGATTACTGTATATGCATATTCAGAGAGCATATACCTTGTATTCACAAGGCTGA
GAGACAATATAAACTCATTCTGATATTGTGTTATTCATGAACTGTGTAATAAGAGTAGTT
CAGACAAGTCAGGTGGCTAACGTACATTTGTTTCCTAGCATTTAGGTATATTTTGGGTTT
TTTTTAAGATTTAATTTATTATATATATATGTGAGCAGTTAGTGCTCTTAACCACTGAGC
CATCTCTCCAGCCCTATATTGTTTTGGTGTTTTTTTTTTTTTCTTTTGGTTCTTTTTTTC
GGAGCTGGGGACCGAACTCAGGGCCTTGCGCTTCCTAGGCAAGTGCTCTACCACTGAGCT
AAATCCCCAATCCCTATATTGTTATTTTTGAAGCCAGACTGTCCCATACAACAAGGCTAA
ACTGGGATAGACTGATGAAGTTAGAACTTAAACCAAAAACAGGGAGAGGAATATTTTTAA
AGTCTCTGAAGTTACATTGTCAAGGACGTTAGATGGAAAAGGCCGGTGTGGCAGCAGTTC
ATATCTGTCCTTCCTGTGTGTTGACTTTTAGGAGAACACCTATCTGTGGCGTACATCACT
GTATCTAGCTGCTTCTGCCAGTGCTGAGTTCTTTGCTGACATTGCCCTGGCTCCTATGGA
AGCTGCTAAAGTTCGAATTCAAACCCAGCCTGGCTATGCCAACACACTGAGGGAAGCTGT
CCCCAAAATGTATAAAGAAGAAGGCTTAAATGCGTGAGTGAGCATTTCCTAAATCTAGTC
ACGGGGGAGACCTAAGATCAGGTCCTTTTGTCTGTCTGAAAATGGCTTGATACTTATCTA
TATATCTGTTGACTCAGGTGGATGGGCTTGTTAGGACATTTCTGATGTACACAGTCAGTT
TGCATGGTTTGGATGCCAACATGCTTCCTTAGATCCACCTTTGTGGATGAATCTTGAACT
GAGTTCTACCTGTAAACTTCTTGTTTCTTGTAGTTCCAGTCCAGGAAACATCCAGCAACT
TTGTTGGTTGTACAGTCAAAGGTGCTTGAGTCATTGGCATGTGAGACTAATACACCTGCA
TGTTAGTCCTCAGGTTCTGACGGCAGTGACACGCGTTATGCTGTCATGTGTTACTGTCAG
GACTCGACTGGTGTGCGGACACTTCTGTAGACGGTGAAAATATCTGCTAAATTCACTTGG
GCACCTATTTAAATTAGTGTCCTTATTTCCTAGGTTCTACAAGGGTGTTGCTCCTCTGTG
GATGAGACAGATCCCATACACCATGATGAAGTTCGCCTGCTTTGAACGGACTGTTGAAGC
TTTGTACAAATTTGTGGTTCCTAAGCCCCGAAGTGAATGTACAAAGGCAGAGCAGCTGGT
TGTGACATTTGTGGCAGGTTACATAGGTATGACTTGTCTGTCCATCTGTCCATCCATCCA
TCCATTTGTCCATGTATATATTTCAGGGTCTTAGTTTATAACCCTGACTGTCTTAGAACT
CAATGTGTAGACCAGGATGGCTACAGATCCACTTGCCTCAGTCCCCCAAGTACGGGATTG
AAGGTGTGCATCACTACACCCTGGCTGGAATGAATTATTTAGAACACACTTGTTCATGAA
CTTATATACAAATTATATCACTTCCATTCTTGGTTCCTTTGTGAAGGAAAATTTCCAAAG
TCCAGGAAGTATTTTTATCTTCCTGTTTTTATGTTCTGCTGGATTCTAGATACTCATTAC
TTTCTAAAAATCTTTCTATATAGTTCTGTATATGCCACCCATCACGCTTGACAATGCATC
TGTAACTCTGTTTCCAGGTGACATGGTGCCCTTTTCTCATCTGTGTGGGCATACAAAGCA
TGCACATGGGTACACACAACATATATGCAGGGAAACACTCATGCATGTAATGAGTAGATC
TAAGTTTTCATGTTTTGAATAGTAAAGTTGAAGCCAGTGTGGTGACACATGCTTGTAATC
CTAGCACTTGGGATGCTGAGGCGGGAATTTTACTAGAGTATCTTGATTTTCTTTTTTACT
TCCCTTTCCCCACAGCCGGAGTCTTTTGTGCGATTGTCTCTCACCCTGCTGACTCTGTGG
TCTCTGTGCTGAATAAAGAGAAAGGCAGCACTGCCTCTCAGGTCCTGCAGAGGCTTGGCT
TTAGAGGTAAGTTAGGCTCTCCTGGGACCTGGCACTGCTTGGGTAGATGGCGCTGGTTTG
TACGCTCACCTTTCTTCTCTGAACCAGGTGTATGGAAGGGGCTCTTCGCCCGAATCATCA
TGATTGGCACTCTGACGGCACTGCAGTGGTTCATCTATGACTCTGTGAAGGTCTACTTCA
GGCTCCCTCGCCCTCCTCCACCTGAGATGCCAGAGTCTCTGAAGAAGAAGCTTGGGTTAA
CTGAGTAGATATACATCAAAGTAACATGGACTGAATCTGCTTGTTGATCAGTGTTGAAAG
TGCAAAGGAACTTTTATATATTTGACAATGTAGGAAATGTCTGTTCCTGATACAATTACT
GTAGTACCCTTGCTTAAAGCAAGAGTTTCAAACTTACTGCTAAATAAACCCATCTATTCA
TGATGTCTATGAGTTTGTTATTTTAAAAACTAGTATTGAAAAAAGATTTAGTCCTAAAAT
CAAAAAATTAAGGTACCCTCCCCTAGGAAAAAAGTGTAAGCTAACCATTGGTGCTATTCT
TAAATTGTCCCCTTACTTAAGAAGCTCCTGTATTAGGAATAGTCTTGGGTTTTCAGAAAC
ATAGTTCATTAAATATGGATAAACACTGAATTGTTGGTTTTTGGGGTTTTTTTGACAAGC
TAATTTTAGCATAGCAAATTTTTGTCCCATGTTTCCTTTTTAATGTTAGTGGATTTATTG
ACCTGTCTTTGTAAAAGGGGACACAAATTAGGTTCATTCTTAGGAAGTTAAGGACCAAAG
AAGGATTGCTAAAAATTACCTAAGGTGACCTGCTTTTCACACAGCCAGACTGAATGGATT
GCCAGCTGTTTTCTGTTGGATTTCTTTAATGAGAGAGACTGCTAGACAACCGAGGGAATC
TGGAGATGCAGCCTCATGCATACTCCTGGGGTTTAGTGGGAGGGTTTAGCCTGCCTTTTA
ACATTACACTGATGTTCAGTTTTCTGCTTGTTTTATTCAGAAATACAAAGGGCCCAGTTT
ATGTTTTCCTGATTTTAGCCTTGAAGGGCTAACAGTCTCTATATTATATAAAGAATGTAT
GTATGTGTCCATACATATGTGGGAGGGGCTTGGATAATCCAAGAATTCTGTTTTAAAGTC
TCCCCTTTGTATCCTTGGCTGCTGGTCTGAAGCTTACCACAGTGAGGCTAGTCAGGTGAT
CCTCCTGCCTCAGCTTTCTGGGATTACAGATAAGCGACACTACAGCTTGTTTCTGCAAGG
ATTCCAATAGAGAGAAATGCTCTTTTTCATTACAAATCTGTTTTCTAAGATCATTGAACT
AAGTTTAAGAGTTGTGCATCTAGTTAGCTGCATATTAAATACACCTGAACTGAAGAGAAA
GGAAGGGTCATTAGGTTTGAAATTGTTAGGGGAAACTTCTGGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1098, 1319..1464, 2698..2822, 5501..5680, 6451..6632, 7113..7285, 7935..8045, 8127..8462
1323..1464, 2988..3109, 5501..5680, 6451..6632, 7113..7285, 7935..8045, 8127..8287
AC_000075.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved