Rattus_norvegicus Locus Eef2
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Eef2
Rattus_norvegicus
Eef2
7
SNORD37
3254..3317
7271
GGCATATTAGAATCCACTGTGTAAGGAAGAATGGCCTTGAGTTCTTGTTACCCCAGCCT
CCGTCTGCCAGGCAGTGGTGGGCTGACAGCTGGCTGCCACCAGCCGAGCTCCACGCGCTG
ATCTATCCGTCTATTTATTTGTTTGTTTGTTTTTAAGACAGGGTTTTCCGGTCTAGACCT
GTCTCTTCTGGAAATCACTCTGTAGCCCAGGTTAGCCTTGAACAAAGATCTCCTTTCTTT
GCCTTCTAAGTGCTGGGATTAAAGGCGTGCACCACGGAGTTTCGTTTTTTATCATTATTG
TTGCATTCTTGCCCGCAGGAGGATCAGGCATTCAAGGACAACCAATACAGCTAACCCAGT
TGAGGGCCAGCCTGTTCTACCAGAGATCATGTCTCTGGAAAAAAATAACTTCAGAAGAGC
GAGGTGTGTTGGCACACGCTTTAACTGGGCACAGTTCAGGCAGGCATATCTTCGGGTTTT
GGGGCCATCCTTGGCTGCACCCATAGACCTTGGTTCCAAAACAAGGAAGAAAGTGTAATA
AAAATACAGGCAAGGTTTAGCAGAAATAAATCTGTGGCCCTAAGGGTCGCTTTCTCCAGC
TTTTCCCAGAGGTGTCAAATTACATAACAGTCTCAAACCTAGGCCCAACCCACTGACGGG
TCCGAATTTCAAAGTCCTTTTTATTGACTTACAAGGTTTTCAAGGAAAATCTTGGAAGTA
ACTGTGTTCCGAAGAATCTACGTTTAAAAACCGACCCCTGGATCTTTGCCTTGGGTCCAA
GGACCGAGCTGGCCACGCCCCAGCCGCGCCGCAGCCACTCCCAAGGCAGTTCAAGTGTTA
AGCCCGAAAGGTAGAGCTCTGCGCATGTGCACACCCGTCCATAGCTGGGTCCCAGCCAAC
CAGGCCGGAGGAGCACCCGCGCCGTCACGTGACGTGCCCAACCGGCGTCGACCTATAAAA
GGCCGGGCGTTGACGTCAGCGGTCTCTTCCGCCGCAGCCGCCGCCATCGTCGGCGCGCTT
CCCTGTTCACCTCTGTATTTGAGAATCCGACGCCATCTGCCACCATGGTGAGTGTCCGCG
GCGCGGCAAGACTTGGGGACTGAGACGAGTCTTCGGGGCAGCGGGAGGTGGCCGGAGCGG
GACCCGGAAAAGAAAGGAGACATGGCTGCCTCTGCATGGGTGGCGGGACGTGGTCGGCTC
GCGGCGCCATATCTGCACCTCCTCTGCCCGTCTTTGGGAGTGTCGGCCTCCTGAAGTTGG
AGTGTTTTCTCTAATTCCTTCGTCCAGCTCTCCTTTCCGAGAACGCTGGGGTGGCTGTGG
GAGGGGCGGCGTTTGCTGATGTGGCAGCGGACATAATGCTGTATAGCCCTGTGCCCATGG
TGACAGGGTGATGGTGCTCCCGGGAAGTGACAGCCTGCAGGGGTGGCTCACATGGAGACC
TCTAGTGAGCTGAGCGTCTTCCGCCCTGGCCTTTATCTCCTTCCTTGGTCCGCACAATGG
AACCGGTCCCCTCCAAGCTGAGAAAATGGCTCATGGGCCTAGGGGCCTATTGTGGCCTTT
GATCCCAGCATTTGACCTTGGCGCACAAGGCGGGTTGGCAGTGTGTAGCAGGCGAGGTTT
TGTCGGCCTGTGTGGGCCCCATCTCGTGCGGGCCCCCTGTCGCCTGCATTGTTGGACTGC
TGGGGTGGCAGTCCAGCTTGGCGTTGATTACGTGGTGCGGTCTCAGCCTAGGCTCCCTGG
TACTCTTGTTCTAGTTGTCATTTTGGTTAGGGTTGGGTTCCTGACACATCTGGTGACTCT
TGATGCTTCTTAGGTGGTAGGCTTGTAGGTGTGAGTCGAATGAGCGCCAGTTTTGGGGAG
ACAGCTCTTTGGAACCCCACAATGGGGTGCTATCGACCCGAGTTCCCAGAATCAGTCCTG
ACCGCCCTTCCCCCACCACAGGTGAACTTCACAGTAGATCAGATCCGTGCCATCATGGAC
AAGAAAGCCAACATCCGGAACATGTCAGTCATCGCTCACGTGGACCACGGCAAGTCCACG
TTGACCGACTCCCTTGTGTGCAAGGCTGGCATCATCGCCTCTGCCCGAGCCGGGGAGACA
CGCTTCACTGACACTCGAAAGGATGAGCAGGAGCGCTGCATCACCATCAAGTCCACGTGA
GTGTGAGGGGGAGGGGTCCCTCATCCCCCAGCCCGTGTAGATGAGATATGTCCACCAGCC
TGATGATTGGCTACCAGTGGTGCTGTGGGGTGAAGGGACCCAGGAGCGGTTTCATCTGGT
GGCCATGTCTGGGCTGACGTCCCCTTTCCCCCCCTTAGTGCCATCTCCCTCTTCTATGAG
CTCTCCGAGAACGACCTGAACTTCATTAAGCAGAGCAAGGATGGCTCGGGCTTCCTCATC
AACCTCATTGACTCTCCAGGTCATGTGGACTTCTCCTCAGAGGTGACCGCTGCTCTGCGT
GTCACTGATGGAGCACTGGTGGTGGTGGACTGTGTGTCTGGTAAGCCATGTTGGTGGGCA
CTGTTATAGACGGCTCTTTTCATGGTACAGTAGTGGCAAAGACAAATTCTGCTCAAGGTG
AGGGTGAATTGAGCTGTTATCTGAAGTTGGGCATGGTGGTCCCCATGTATGTCTGGGCAG
GATGGCGGTGAGGTCCAGCTGCATGTAGTAGCAGTTACCTTTAATTCCAGCACTGTGAGG
TACGTTGATCTCTAGGTCCAGGGCCACCAAGGCCTGTCTGGGAAAGGTGAGAAGGGCTAG
TAGCATGAGGCTCATGCTCTCAGGAAGGTCCAGGCTGGGAACAGCACCTGCAGCTGTGCC
TGCTGGGGACCACCACTGTGCACCCTGGTGAATGCCTAAGCAGGTTCTTAGACAAGCCCA
CTCGGGTCTTGGCATGGAGGACAGCTGTGTTGGTCATCACTGCCTGTACTGTGCAAGGTT
TGGGAGTGTGCATAGCTGAGCAGTCCCTGCACTCCCGCAGGTGTCTGTGTGCAGACAGAG
ACAGTGCTGCGGCAGGCCATCGCTGAGCGCATCAAGCCCGTGCTGATGATGAACAAGATG
GACCGGGCCCTGCTGGAACTGCAACTGGAGCCTGAGGAGCTCTACCAGACCTTCCAGCGC
ATCGTGGAGAACGTCAATGTCATCATCTCCACCTATGGCGAGGGCGAGAGTGGACCCATG
GGCAATATCATGGTGTGAAGCTACTCTTCTGGGGGGAGCGGTCAGGGCTGTGCTCCCTGG
GAATCCCTGGGCCCACACATGATGACGGAAATTCTTCACTTTGACCTGATGTCTGTTGAA
GAAACTCAGTGTCTGAGGCTGTGGGCTTGTGGCTGGGCTGGCTGCTAGCCAACTTTGCTG
GCTAATTGCTGCTTTCCTCCTCAGATCGATCCTGTCCTGGGCACTGTAGGCTTTGGCTCT
GGCCTGCATGGGTGGGCCTTCACACTGAAGCAGTTTGCAGAGATGTATGTGGCCAAGTTT
GCAGCCAAGGGTGAGGGCCAGCTGGGTGCAGCTGAGCGGGCCAAGAAGGTAGAAGACATG
ATGAAGAAGCTGTGGGGAGACCGGTAAGAACAGGGCATGGGACAGCCTCCGGTGCCACCC
ATCACCTATGTCTGTGCCATGTGCCGATGCTATGTGACCTCTCTGTGCTAGGTACTTTGA
CCCGGCCAACGGCAAGTTCAGCAAGTCAGCCAATAGCCCAGACGGGAAGAAACTTCCCCG
CACCTTCTGCCAGCTCATCTTGGACCCCATCTTCAAGGTGTTTGATGCCATCATGAACTT
CAGGAAGGAGGAGACAGCCAAGCTGATCGAGAAGCTGGACATCAAGCTGGACAGTGAGGA
CAAGGACAAGGAGGGCAAACCACTGCTGAAGGCTGTGATGCGTCGCTGGCTGCCTGCTGG
TGACGCCCTGCTACAGATGATCACCATCCACTTGCCGTCCCCGGTCACTGCACAGAAGTA
CCGTTGTGAGCTGCTGTACGAGGGCCCACCTGATGACGAGGCCGCCATGGGTATGAACCA
ACCGTGCGGTCGTCCTGCTCAGCCCTGGGCCTTCCCAGCCTTAGCAATTGGCTGATGTGG
GTTCCCACCTCTCCTAGGTATTAAGAGCTGCGACCCCAAAGGCCCCCTAATGATGTACAT
CTCCAAGATGGTGCCAACATCTGACAAAGGCCGCTTCTATGCCTTCGGTAGAGTGTTCTC
TGGGGTGGTGTCCACAGGTCTGAAGGTCCGGATCATGGGCCCCAACTATACACCTGGGAA
GAAGGAGGACCTGTACCTGAAGCCTATCCAGAGGTGGGTACTGTCCTTACTCTCCTGAGC
CCTGGCTGCTTTCCAGGAGAGTCCTTTGACATCTGCCTTCCCTTTAGGACCATTCTGATG
ATGGGCCGCTATGTGGAACCCATTGAGGATGTGCCCTGTGGCAACATTGTGGGGTTGGTC
GGAGTGGACCAGTTCCTTGTGAAGACCGGCACCATCACTACCTTTGAGCACGCTCACAAC
ATGCGGGTGATGAAGTTCAGCGTCAGCCCTGTCGTCAGGGTGGCAGTGGAGGCCAAGAAC
CCAGCTGACCTGCCCAAGCTGGTGGAGGGGCTGAAGCGGCTGGCTAAGTCTGACCCTATG
GTGCAGGTATGTGCCACTAGCTCACAGGCTTGCTGGGGTTAGAGGGGATGCCTGGGGAAG
GGGGGTTGCTGACAACTGTCCCCACAGTGCATCATCGAGGAGTCTGGGGAGCACATCATT
GCTGGTGCTGGAGAGCTGCACCTGGAGATCTGCCTTAAGGACCTGGAGGAGGACCATGCC
TGCATCCCCATCAAGAAATCTGACCCTGTCGTGTCCTACCGGGAGACAGTCAGTGAGGAG
TCCAACGTGCTCTGTCTTTCCAAGTCCCCAAACAAGCACAACAGGCTGTACATGAAGGCC
AGGCCCTTCCCTGATGGCCTAGCAGAGGACATCGATAAGGGTGAGGTATCTGCCCGCCAG
GAGCTCAAGGCGCGTGCCCGTTACCTGGCCGAAAAGTATGAGTGGGATGTTGCTGAAGCC
CGCAAGATCTGGTGCTTTGGACCTGATGGCACTGGTCCCAACATTCTCACCGACATCACC
AAGGGTGTGCAGTACCTGAATGAGATCAAGGACAGTGTGGTGGCTGGATTCCAGTGGGCC
ACTAAGGAGGTGAGTGAGTGGTGGGTGAGCCTGGGTGCTCTGGGTGTTAGTTCCTGAGGG
CTGCTGGGGGGCTTGACATACAGCTCTTTGCAGGGTGCTCTTTGTGAGGAGAACATGCGT
GGTGTGCGATTTGATGTCCATGATGTGACCCTGCATGCTGATGCCATCCACCGAGGAGGT
GGTCAGATCATCCCCACAGCGCGCCGCTGCCTCTATGCCAGTGTGCTGACTGCACAGCCC
CGCCTCATGGAGCCTATCTACCTGGTGGAGATTCAGTGTCCTGAGCAAGTGGTGGGCGGA
ATCTATGGTGTCCTGAACAGGAAGCGTGGCCATGTCTTTGAGGAGTCCCAGGTAGCTGGG
ACCCCCATGTTCGTGGTCAAGGCCTACCTGCCTGTCAATGAATCCTTTGGTGAGTGTCTG
GTCCCTGGAGTTTGCTGATAACCGGGAAACCTGTGGGGGTGGGTGAGGAGCCAGAGGGGC
AGAATTCTTTCTCCAATGCCAAACTAGTTAGGGGTGGCCAGGAAATCCAGAGCTAACCTG
GAAAGCCTCCCCGGGAGGGATGACAGGACAGCCAAGCATGCCCCAGGGAAGATACCTAAA
GGCCTAGGCTACTTAATGAGCCTCCTGTCTTCTGTCTGTAGGCTTCACTGCCGACCTTCG
ATCCAACACTGGTGGCCAGGCCTTCCCCCAGTGTGTGTTTGACCACTGGCAGATCCTGCC
TGGGGACCCCTTTGACAACAGCAGCCGCCCCAGCCAAGTTGTAGCTGAGACCCGCAAGCG
CAAAGGCCTGAAGGAGGGCATCCCAGCGCTGGACAACTTCCTGGACAAACTGTAGGCAGC
CTGGTACTGCCACACGCTGCACAGTGCCCGCCCATCAGAAGACACCTTGAGACTGTCCCC
ACAGTGCCCCTCTGGAGGCTGCTGGGGCCATCCTGACATCACTCAGCACTCACTTGCTAC
CAATTCTATTTATTTCGGAATTACAAGGCAGCGTGAATGGCCCTCTGCAGGCTGGACTGG
CAGGCCGTGGGGTGGGCAGCACACGGTGGTTAGCATTTTCAGAGGGAAATAACGCAGATG
TCCAAAATTCTAAATAAATGCATTCAGAGGTTTATGGGGTCCATGGCCAAGTGTAATTCC
CCCAGAGGGGGAAGTGGGGGAGTGCCTCCAGGAAGGCAGGCAACCCTTAGACCTGCAACC
CAGCTGTGCGAATCATTGGAGTAATAAACTCTTCTGTGGTTGAACCCTATGGGCTCCTCA
ATCCTGTGCTGTGCGCCCCTTCCGGGTACCTCTACCTTAGAGGGTGTCTGGCTTCTCCCA
CAAGGCTCCTGGTTTCCTTACTAAGGGTGACTTGCAGTGTTAACACCCTTTGCTAACCTG
TGTCTTGGTGACAAAATTGATTTTTATTCCAAACTGAGTTCATAGTGCTCCACTCCCAAG
GTTTCTCAACCTTGGACCAACTCCATATAGACATCCAGGAGACTGGTCTTTGACACACGC
GGCTCCAGGTCATTGGCCTTCAGTCTCATTGCGTTAGCCAATCACATGAGAGTAAGGAGA
CATCGGCCCAATAAAGGCGTGTTTTCCTGAGGGCAATTTCGAGAGTTCCTGTGAATTGTC
CAGTGGGCCAATGAGCACCGGAGTCTAGCCTAGCGTGGTGGCGTCACCAGTCAACGCCCA
GTTACGCCGATAGGTCGGATGGTAGCCAATGAGTGGGGGCATCCAGTTTCCGGGTGAGAC
GTGATCCAGTGAGCACAGGCTTCCTAGTTTTGGGGGCGTGTCGCAACGCAGTCGGCGCAT
GCGTAGATGAACCCGCAGGGTTTGCACCGGAGGCTCTCGCGGGGGCCTCGCTGGCGCTGG
GCGGGGACTCGCGGGCTGAGGACGGTACGAATGGGCTGGGTCCGGGACGGTGTGTCGGGA
TTCAGGGGACTCGCGGCGAGGGCGTGAACGAGGGGAGGGGACCCGCGAAGGGCATGGCTG
TCTCCGTAAGCTCCAACCTCGAGGGGTGGACCTCTAGGACCGGCACCGCTGCTACGCATG
CGTTAGGTTTCCGGCGACACTCCTGAGTTCCGGGGTTCGGGTGGGCATGATTGACAAGTG
AGGAAGCTGGGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1066, 1941..2155, 2318..2499, 2980..3191, 3384..3562, 3651..4009, 4097..4292, 4367..4625, 4707..5168, 5253..5568, 5801..6271
1064..1066, 1941..2155, 2318..2499, 2980..3191, 3384..3562, 3651..4009, 4097..4292, 4367..4625, 4707..5168, 5253..5568, 5801..5994
AC_000075.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved