Rattus_norvegicus Locus Rpsa
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rpsa
Rattus_norvegicus
Rpsa
8
SNORA62, SNORA73, SNORA62
1981..2136, 2553..2755, 3728..3876
5873
ccttcaggatctgtggaatttgttccagaaccttctatggatgccaaacccaaaggtgc
tcaagtcactaatataaactggtattttctaataaccacaactctcccgttgactccaaa
tcatctctagattacctgagacacggaatacagtataaatgcactgtaaataaatgactc
attcaaattcctccccatccccttcaatacttttgtaatagcttactgggtaaccaccat
tttgttgtcccccaaatgtaggaaggagccagtgctttcttcaaggagcagagggcctgg
tgggtatgtgctcctctaattagttctgacacaggtggcccaggcttgaagtctgttctt
cactcagctgtggtgctgatagtgtcaaagaaatgggggagaaaataccgtccatgccct
aggccagccgtgagggaaaatactttgttttcactgaccgacctctttcacacacagggt
gtcatttttgttcgtagttgtcctctcgttccaattcttttgtgtcacaggacctatcta
tctttaaatggccgcatagtattccattagatagaataaacttacgaactgcattttctc
tttgaccaaaaactaattttatgcgtacagtcctgtactttatactttcaagaaaacatc
tctgcgataaagtctgaatttcccgtcggtaaaccgtcctccatagaccacacagcagtc
cttcaggctgtgcttgctgtacacaggcctgatttctagaaatcttccatcaaaataagc
ttcaggcttccaaccccacgatttacaccacgattggaaccgagcaggcgccggccactt
taacttccgctccgcgcgtgcgcagcagcggacccgctcgctgaatctgcgcgtgcgcca
cactccctttccgtaacggaagctctgccctctttctgtttaacgtgtgttgctattggc
tctctgtggcttatttaaggacgtcatttccggccgcccgtcctttccgcgctaccctgg
aacgggtccgtacggcgttgttcttggtgagtctcatgtgggggtcctcggcgcctctcg
acgccctgctctcgagcttcctgccacatggatgtgcggggagggtcccgaggctgcgtg
tgtcggagctgcttgattactggcggcggcgccacgtggtggcccgtggtgaggtggggc
gggcgctactccgaggcccttctgcggctcgtgccaggctcgagaggcctgtcggcaaga
tgctgggaaaagtgttcgtggggcgcgtagagatggggcggaaactttcgatcactttca
aaatacaaaacccgaagcacaccaaatatggctgccttctctgtgcatagacgaaacttc
tttagtaagtaccctttgaccagtgtgccaacgtaagcgctaacttcctactggccagtt
ttaatgcttgtgatttgctgcctaagccacttttcttagtgattaggtggccagaaaagt
tacaagcgacggaggaataagaatacagtcagcttcactaagacgtaccgagccatgtgg
catacaaaaacctttaatccctctctccggaggcagggtaatcttgtgggttctaatcta
agagaaaaatggacgacattccttttttaggttcccatcgtaacttaaaagggaaactta
cacaatgtccggaggccttgacgtcctgcagatgaaggaggaggatgtcctcaaattcct
tgctgcaggaacccacttaggtggcaccaaccttgactttcagatggagcagtacatcta
caaaaggaaaagtgacggtcagctgttgctcttgatagtcctgataagttgtcctagtgg
gtagtgctggtgctgaatgcttggagaaatactgccctggcttgtgagttgtattaaaga
gagttttgtaggaagggccaggggtcatggaggattgacagaagggaagagacaggctga
acctgcacactattaaagctcagggtggaggccagatttggccagtgaacttctgagtgt
cggaagtgtgctacattgaacatacggcaggattttcgctaacaccagtagagcttgcct
ctatgactggagtttggtagtggtcactgccacatacacatactctgctttcctgcagtg
tccctttacagagcaatgaggttagcaaatctgggccacccactttaaagatccacttgt
ggctaggtgtggtggtgcctttaatcttagtgctcaagaggcagacaggcaaatctctga
tcagcttgttctgcagacagccagggttccacagaccctgtcttggaaaggcccccacaa
gaatcccgtttgctggcctaggtatctacatcatcaacctgaagaggacttgggagaagc
tgttgttagccgctcgagctattgttgccattgagaaccctgctgatgtcagcgtcatct
cctccaggaacactggccaggtgtgtgggagaggctgttttatttgggggcaaaaatgtg
cagaatacgttgggagtgagtacacaagagtttccaacgtggataacccgggaggtcact
ctccccgggctctgtcctagtggcgtcagggagcagaggcattgcccagtgatgtacagt
ccctttccacaacgttggagatgaagctgggcttcgtgctcgcacctgcatattcctaca
acttctcagagtcctgtggacgatgactgaggaggcaaaccatgcaggaaacagtcctat
gtcactcagtggcaggcagtgctgtgtgtttaggaggaaactgttgctgactttaagggt
aaagcaatgtcagccacaaaatagccagccaagaagagtctttgctagcttgagtatatc
ggttgtaaaaaaaaaaatgagatggagtgttaagacagtttttggtacactggtggctga
gttggtaaagagtcgattcaagagtcccctagtcagttctgtaccttactgaggtggctt
acagccatccacagttcagtttgtttcagtccagtaccagacctccgtgtgggtgtgggt
gtgtgatacacttacatacactgaaagcaagccacccctacattaaataaaaaggaactg
tccactacagggaaacgagggatgatatgcttgctctgtgtcctgataaatttgtccaga
agtcagaggtgtttgctggtggtcctttgaggggcatggggcatgtgaaaagcttgaaat
caccaacatcatctgcttcatagatgaatcaggtgcctcagactaagcatatggacatgc
aagtgttacaattagcctaagaatgtgcttcaataaagtgctgctttggtgttgataggt
aacttgaagtgagtatctacagtttccctatgaaagcattcgtgataacgctgactcaat
ctcccttcaaagcgagctgtgctgaagtttgccgctgccacaggagccactccaattgct
ggccgcttcacacctgggaccttcactaaccagatccaagcagccttcagggagccccgg
cttctagtggtgactgatccccgggctgaccaccagcccctcacagaggcctcttacgtc
aacctgcccaccattgctctttgtaacacagattctcccctgcgctatgtggacattgcc
atcccatgcaacaacaaggtaacttggatttagagttgatgacagcactggggaagcctt
tgggctcccctgcacattgttagagcttggagttgaggtcacacgctggtcgatgaactc
ctaagtgtaggtagtgtgctaaacgagcggcaaggttttcgctaacaccccactctggtc
cagtgagtggggtctgatagtaacctttgctacaagtttgatgtatgaactatgggcctg
tgtattctcctaagtgaatgttagtttttggggggaggagtcaatttatgaggtgtgccc
agtgctcctgtacctggggcagtgtgctgccatctgggtgtgtggaatgtgagacgtggt
tccaaggggtgttctgtacagggcctgtgaggtaagggggtggccttatgtttagtgact
ccccctttcttgcagggagctcactcagtgggtctcatgtggtggatgctggccagggaa
gtactccgcatgcgaggaaccatctcccgggagcacccatgggaggttatgcctgatctt
tacttctacagggacccagaggaggtaaggcgctattaaatgctggtggccactaagtag
atgggacaccttggtgtggttcagtgaagctaaatttgtccattctgtgcttttaaaaaa
ctagattgagaaggaggagcaggctgccgctgagaaggctgtgaccaaggaggaattcca
gggtgaatggacggcaccagcgcctgagttcactgctgctcagcctgaggtggccgactg
gtctgagggtgtgcaggtgccctctgtgcccattcagcagttccccacaggtgtgtatca
aggccagggcatcaggctgcagggagctgagcagtgtagactgagtaatggtgaagcctt
cagtggccacgagagcgttactgttctgactctgggtgtgctttgatgtgtgtgccggtg
ggcgcagtgtgtcttgacacattgcttttgggatgacttgggaaaagttactctgttcct
agagctgatgaccttttttgtactttattaacagaagactggagtgcacagccggccact
gaggactggtcagcagctcccacagcacaggctactgagtgggttggagccaccactgag
tggtcctgagctcctctgcaggtgcctgagcgaagggaaaaaaggtggaaggaaaataaa
gttcctgaaagctgcctctgtgctctttactgcagaatacacctgggttggtgttgggct
atagaacaggcatgagctagggaagggggcatttctctccaggttctactgacctgtttg
tgttgactacttaagcttgggaatactaaactgcagtaacagtatgtatgtttaatgttc
tactgtgggccttagcttcacggtcatgagctgcttggtgcctctggaagtttcatacat
gtgatctaggtggggtgttcttttaacacagggtctctgttctgtcatgactcatagatc
cttctgccttcacactgagggaaggcttgtgccactgaacatgaccagattgagatatgt
cccagaacaaagttaatactggctggcactcctagacaggactgtccagtggtcctgagg
taaggatagacagtctaccgaggctgtggtgtaggcatgacattccatgagctgcagtga
ggtggcattgcaagggttaagtattcaggagtttagaaggagcctaaatttacccagtaa
ggggtgtgtgtgtccatcccctactgagctgcctgtggagaggatctggtctggaagggt
ggtccttagcctgccatgctgctgggggggggggcgctgggagggaagaatgaagaatgg
gccgataactcaagactgggaaccatagttcttaagacaggtttgtggaaagtctgagaa
tgcatggggaaagagggtagataattctgtatcctgcgcacttcctcctgctgcctgtgg
aattcacaagtatttgtggtattacgggtacataaggactaactggctatgaagtgcttt
cctagcttttataaagtttgttagaacatggcaaaaatagcattcttgtgtttgtggcat
taaaatgaacagtttaagacattaaatggtagtggggttaattctctagatgatgcctga
gtccacagtcatgggtctcagtattgtctagtctggtatgttaggtggcaagtg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1045, 1650..1816, 2361..2479, 3432..3677, 4095..4223, 4324..4489, 4714..4873
1684..1816, 2361..2479, 3432..3677, 4095..4223, 4324..4489, 4714..4808
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved