Rattus_norvegicus Locus Rpl4
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rpl4
Rattus_norvegicus
Rpl4
8
SNORD18, SNORD16, SNORD18, SNORD16, SNORD18
2647..2714, 3024..3122, 3485..3555, 4202..4300, 4667..4737
7129
tcctacaggatgtagaagttgacagcaacatttcactcagggaacaaagtgaattctgg
catggcctccgcctctaatgtcagcattaggagcctggcaaggaagatccatatgaattc
tgtacgtttcttaggagtcaggcaaagcttgaggcaggatgacatctagctctccgtatc
ccgggagcctctacttagaagcatgtattcagcaataagcatacaccgactcgtcacctt
gccaccctgggtaagtgctgatgttttttcgggaggctaggcctccgcaaagcactaccc
actacagtagagacctgcctctcatatcccagatccggagagcaggaagggggcaaaagt
tacagctgtggcaaaacacattcgggcgcgaatacaaaggccgggagggacaagtactat
cccattccccgaccacaactcactgtagaagacgagcataaaactcctcggctgcgcgat
tcaaacgcacccacatgcctctgtccgatcgctccattgcggtgcagctaaactgaactg
cgcgcccagacgctgacatcagagagcatgaccccgcccagccggaactacttcacacat
taagttttgtttgtactcaacgctaacacattgttttaatttagtagaggatcccttcaa
tctaccattccaaaagtatcccatttctgttagtggggggaaaaatggattaaaagagat
ggtgtgacgagggtgggcgggatgaagagaaagaaaactctcgcgagagttttaacgagt
tacgaattattccgcgaaaaggagtccctcttttctaatcactgtttttaacttaaaaaa
taaataaatacataattttaacacgcgtcacgtaataataaacctttaaaattttttaag
tgtagcagaaagatagcttgtgtctctacgttgtttttcattaggggcaggatgcggaag
acgagtggaaggatatatagagtacaagtgataagttcttcCTTTTCCTGTGGGAGCAGC
CGGGTAGAGAGGAGCGTGGCCTTCTCCTCTCCCCGCCATGgtgagtggaggtcctcttca
ccgggctttcccctgatttctggggcctgtggaagagggtgaaaattctggacgtgggat
ctacagagaggaggcagtgggaagtggacctagcactttttttggccggagctgggttgt
atgcgctgcggcagccatcttagaggcaacgtgggcaacagcgcagggtggatgacagag
gaacctttgggatctttgcttcccttagttctaagaaaacgtggcttctggaagcggagc
tttttgatgtgggagacttgtcgggttctgagttgtccgatgacaactcggcgtaggcct
tggcgggtcatgtgccttcagtgcagttaatttgtgtatccaacttcaaagaaaagatat
gagggaattctgtgtaaacgccttatagaaagatcgtctatttctttgaaatagttctgg
gaagtcaggtctttgttactttatttgatataatctagacgtttttaccttaaaacaatt
cgcagacagtagtagtaattgtttcttgacgtgtttatatctgctttatttaggtgggtt
aatgttggtctaaccacgataaattaaagtttggagacaggtctgcagttacatcattaa
attgactaggttgtcctattgtgcaacaactttaagggagaaaaggtagatggtctggta
tctggaagaacacgtgggagatagggcagagatcagtgcaagtggtaactcaggtagaag
tctgtagagttgaagtatcaaaacttctgagcttgataaggggtctggagcgttggacaa
atgagcaccatagctttgctgaagttggtgagggtagtgtttacgtggtcttatattaaa
cagtatctttgaacattttcattctgctttaagcttgttattaaaattggcagatttttc
aggttgtatgttctttcactgtaaaactattgacatgataaataaccactggtgttctaa
gacaagccattctgacctgaaactgctcccacagattggtgtgtatataacctcagccag
tgacttagtctagattttatgtgtttgcctccaaaaatcaagctcctgacatttaatgat
gggaagtttgcctccaatgttgtctctataagtactcttaattttctcaagtgaatccat
tattacaacgtgatagggctctattggcgttttctgtatttcatgtgctggttcttgaca
ctgttacttcctgcctctggtcccccattattccccaggtattcctctatctctttgcaa
gtattaacaagatgggctttacaaatctaggttcaaagacaggagatggtactttgagtt
ttagttactttcttcttttcttccaagGCTTGTGCCCGTCCCCTCATATCGGTGTACTCT
GAAAAGGGGGAGTCATCTGGCAAGAATGTCACTTTGCCAGCTGTGTTCAAAGCTCCCATT
CGACCGGATATTGTGAACTTTGTTCACACCAACTTGAGGAAGAACAATAGACAGCCCTAT
GCTGTCAGTGAATTAGCAGgtatggatttacattcgtcgtgggtatatactttaaaggct
tctttgcagtaaatgatgagatttccattggtccgtgtttctgaactccatgatttttgt
ggctattctgatactgcctttaccatgcataaatttaagtcatgggtttgttataaatta
gtacctaaacctgctcttaccaattatagGTCATCAGACCAGTGCTGAGTCCTGGGGTAC
TGGTAGAGCTGTGGCTCGAATTCCAAGAGTTCGAGGTGGTGGCACCCACCGTTCTGGCCA
GGGTGCCTTTGGAAACgtatcctttgttggtgttcttggcaattgacccaagtggactta
aagtttgtattaatagttattaataattgaatcacgtttaaaagtattagtatctaaagg
atctgaagatgttgagggtggacttgcagtgatgtcgtaatttgcgtcttactctgttca
cagcgacagttgcctgctgtcagtaagctggttcagaaggttgacgaatgttgttgctga
gcaagtaatgaccttgttaattttctaagtttgaaaagaaaaattcttgacaaaagaaat
cagATGTGTCGTGGAGGCCGCATGTTTGCACCAACCAAAACCTGGCGTCGTTGGCATCGC
AGAGTGAACACAACTCAGAAACGATATGCCATCTGTTCTGCCCTGGCTGCCTCGGCCTTA
CCAGCTTTGGTGATGTCTAAAGgtctgatgctttgatgtgtgacgtttagttttaacttg
cacctaagtcaatttagcttctgataattctatttctctgcctgctaaagccacttttgc
ttatataaatatatagtgagcctttgattgtagctcctatcaaattcttaccatgttatt
aactgtcaaaatgatgaaactccacttaatggtccgtgtttctgaaacacatgatattag
tggaaattctgatttggcagtttgtattgtgctttattttgaggtgtcgtataaatagtt
gaggctcctgccactagaggcatagacaagaggatctcttgagttctgggacagtgtctc
tgggggagaatttgatactttgctgttaaatgttatattgggtttgttagGTCATCGTGT
TGAGGAAGTTCCTGAACTGCCTTTGGTGGTTGAAGATAAAGTTGAAAGTTATAAGAAGAC
CAAGGAGGCTGTTCAGCTGCTTAAGAAACTTAAAGCTTGGAATGACATCAAAAAGgtagg
ttcagcatacacacagtctgatcttccatgctgtcagatttggattcaaaggataaggtg
aggttttatagatgggtggttggtcttcatttcttattggttattactatagaaacttag
ttctttacaggtaacctaggtagtctgctgtgggtatgatttgtggtagatgtgtatgtg
tacagatttgtgtgtgtctaaaaaagaccgcttcggggatcttttttagttttttccgga
gctggggatcgaacccagggccttgcgcctgctaggcaagcgctctaccgctgagctaaa
tccccaaccctggggatctcattttttctgtcatcttttttacaggaaggccttgatctc
cttgcagtgatgttgtaatttgcgtcttactctgttttcagtgacagttgcctgctgtca
gaaagctgaatcagaaggttgacgaaaattattgctgagcaacttaaaactttagttagc
ttgagatctgagccgtgaaatgttacacagttgtgaatttcagggatcaaacagcatcag
acctgactgaactttttgcttgcttagatggtttcttgttttgttgaaattgaagatctg
gaaagtttatatcttgatcagaataacaaagctcatcaccctgtagGTCTATGCCTCCCA
GAGAATGAGAGCTGGCAAGGGCAAAATGAGAAACCGACGGCGGATCCAGCGCAGGGGACC
CTGCATTATCTATAATGAAGATAATGGAATCATCAAGGCCTTCAGAAACATCCCTGgtaa
atcttgtattgttttaactgcctgttttgtgcaagcttgctcagctgtggttatgatgaa
attccacttcatggtccgtgtttctgaaataacatgattttgtggaagttctgattccta
tgtgagtgagttccatccaccatgatgactagagcttctaagtgatgtgcagctcaaaaa
gccatggcttcctgattcttctttccccttaaagGTATTACTCTGCTTAATGTAAGCAAG
CTGAACATTTTGAAACTTGCTCCTGGTGGGCATGTGGGGCGTTTCTGCATTTGGACTGAA
AGTGCTTTCCGGAAGTTGGATGAGTTGTATGGCACTTGGCGTAAGGCTGCTTCCCTCAAG
AGTAACTACAAgtgagtttccctatgtttattacagattaatgactaaaatgtctgatta
tatttgccttaagttctgcattcaaattttgtttacattttccattgttggagtagtgtt
tctctatggttattaactgaaaatttaaagataggaaattctatatctgaagagttgaaa
catttaaattacaattttttttttcccggagctggggaccgaacccagggccttgcgctt
gctaggcaagcgctctaccactgagctaaatccccaactcctaaattacaattttttaat
gctttatgttcagtttggacttgtgggttttttctcccccagCCTCCCCATGCACAAGAT
GATGAACACAGACCTTAGCAGAATCTTGAAAAGCCCAGAGATCCAAAGAGCCCTTCGAGC
ACCACGgtaaagttttgaaacttaaagtgtagcacttgttataacctcctttgactttta
aaggtgttgactaacgaatgctacctcttaatcttgatagCAAGAAGATTCAGCGCAGAG
TCTTGAAGAAGAATCCACTGAAGAATCTGAGGATCATGTTGAAGCTGAACCCTTACGCAA
AGACTATGCGTAGGAACACCATTCTCCGCCAGGCTAGGAATgtaagtcataatttgccat
gtcagttttttaatacttgattgcctcccctcccctgagacaggaatttatgaggaccag
gccaccaactagcagacagatcccacctgttcctcctccccacccccccccccaagcact
ggagtttaaggtgtgagctgctggactcccattgaagataggattcttatatcctacatg
tttttgttgcagCACAAACTTCGAGTGAAAAAGCTGGAAGCCGCAGCTGCTGCACTGGCA
GCCAAATCGGAGAAGATTGTTCCAGAGAAGGGGGCTGGAGACAAAAAACCTGCAGTAGGC
AAAAAAGGAAAGAAGCCTGTGGATGCCAAGAAGCTGAAGAAGCCTGCAGGGAAAAAGGTG
GTTACCAAGAAACCAGCAGAGAAGAAACCTACCACAGAAGAAAAAAAGTCTGCTGCATAA
ACTATTAAAATTTGTTAAATTCCAGAGAGCAAAAAGATACAGCCTATTTGAATAAATCAA
AGATGCAGTGagaaacgtttgtgtgactcttgattgtgggatttcatgggcaagcctagg
tcatcagcactacagagcaagaaagagctttatttttaataaaatttcattctctagact
gatttgttccacatattagtctactgtaaaataattttgggatagttgactaatttgcaa
tgaaatccagtctgttagtatttggtacagatgttttaggctgagaagcaggactaaatc
gggaacagctaggtgctaaagactatgactgttgtaatgatagccactagagggcatcgt
ggtaaaaggaaatgatgtgtctgccacaattatgggctgtgtgcgtggggggtgttctct
aacaaatgtcaatcaatcatccttgattggatagccttcatttcctgttgcctttatggt
atttggtcaaaattactaacagacaatatgaactcggctaaaaacaccacttgtcctaaa
acatgggaattcattaagcttagcatagttgtccctactaagcttaagtatttggtattt
tggtttctacctgcaaaattgtagcctttgcagagtataaagtcacttggaaaagcacgt
taaaagtgctgagatggggggctggggatttagctcagtggtagagcgcttgcctagcaa
gtgcaaggccctgggttcggtccccagctccgaaaaaaaggaaaaaaagaagtgctgaga
tgagtgctgttttcctgagtctgagagacattagggactgaagagtccacgctcttgggg
attccactttattttcagattcctagtgtccggcgaccttaccttcagcaaacaactgca
agaaaactagcgtccctcgctgatttcggtggtcggaagtgacgtcatcagcgcgcgcca
agtagaaggcagcgctttacgggagtggaggagcatgttgagtcggttgcaggagctccg
caaggaggaagagaccctgctgcgtctaaaggcagccctgcatgaccaac
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 2427..2598, 2789..2895, 3183..3321, 3710..3834, 4486..4615, 4834..4990, 5322..5405, 5500..5620, 5832..6129
1057..1059, 2427..2598, 2789..2895, 3183..3321, 3710..3834, 4486..4615, 4834..4990, 5322..5405, 5500..5620, 5832..6059
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved