Rattus_norvegicus Locus RGD1559849_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RGD1559849_predicted
Rattus_norvegicus
RGD1559849_predicted
8
SNORD14, SNORD14, SNORD14
2496..2581, 2910..2995, 3648..3731
5031
CATGGGCATCCTTCCGCTCCCTCCCGCCTGCGCTGACGGGTCACGCATGCGTACTCGGT
GCCGACGCTCTCCCTTCCCCCACCAGCTCTGAGTGACAGAGGACTCCCGCGCGCGGGCTC
TCGGCGCCCCGCCCTCCCCTTTCCCCCGGGCCGTTCCGAGAGCGGGGGCGAGCGTGAAAG
TTCCAGAACGCTGCGGTCGTGCGTCATCGCCCGGAGGGGCGGAGTGGAGGCGGGTCCTAG
GAGAGCGTTCTGGTTGTTCATTAGTGCACTCCGGAGAACCTGGCCGTCCATTGGCTAAGG
AGCTCTGATCGGCAGCGGGATGGGGCGGAACCCTTCTGGAAGGTTCTAAGACAGGGTATA
AGAGACAGTGAAGCGGGCGGAAACCGGTCTCATTGAACGCGGAGCCAGCTCTCGGGGGTC
TCTGTGTGGTCTCGTCATCAGCACAGCTGGGCCTACACGCAAGGTGAGGCATGGGACTTG
GGTGTTGGTGCGTGGCCGGTGTGGTGCAGGGGTCAGTGGGATGCTTAGGCGGCGGGTGCG
GCTTAGGCCGCTGTTGCCAGAGACGGAGGCTGCTGCTGAAGGGGAGGATGAGCTGAGTCA
GGGCGGCGCCGCCATGGCCTTAAGCCTCCGCATGGCGGGGGAGGGGAGCTCAGGATTCCG
GGGCCTTTTCTTTTTTCTGTCTGCAAGCTAAAGGAGGGTCTCTTCCGCGCGTTCCCAGGG
CACGGGTTTCAGAGATGGAAGAGGCGATCCAGCCTCCCGCAGTGCGCGGTCCTGGGGGTG
GGGGGGGCCCTCGGAGGTGGCCACGTGCTCAGCCATTGTCGCAGACCTTTTGGACAGATG
GTTCCTTCAGCCTAGGGCGGGCTGTGCCAAGCCTGGCGCAGGCCACTCAAACTGCAGCAG
TGTCGCCTGCGTGGCTTCAGGTGATTGATAGGTCTGGGCCGGTGCAGAGTGAAAGCAGGG
AGATGACCGCTTAGTCCTTTTTTTTTTTCCTTCTAGCAACCATGTCTAAGGGACCTGCAG
TTGGCATTGATCTTGGCACCACCTACTCCTGTGTGGGTGTCTTCCAGCATGGAAAGGTGG
AAATAATTGCCAATGACCAGGGTAACCGCACCACGCCGAGCTATGTTGCTTTCACCGACA
CAGAACGATTAATTGGGGATGCGGCCAAGAATCAGGTTGCAATGAACCCCACCAACACAG
TTTTTGGTAAGTCGCCAGTATTTTTTGTGCTATTGATGGGAGGTTAGAAGGGCTGGGTGG
CAGAAAATTTGGAATGTAAAAATAGGCTTTCACACTACTGCAACCTGAGAGGTCATTGCA
ACTGTTTAAATCGACAATGCAGTGCCACAAGCTATTAAATATGGGACATTGCTTCCTGCA
CCGGAACTTGCACCTTCCTACACCATGAGGTCATCTTTAGGATTCTTTTGCAGTCAGTAG
TCGCCAAGGTTCAATTTACTGTTTTACAGATGCCAAACGTCTGATCGGACGTAGGTTCGA
TGATGCTGTTGTTCAGTCTGACATGAAGCACTGGCCCTTCATGGTGGTGAACGATGCAGG
CAGGCCCAAGGTCCAAGTCGAATACAAAGGGGAGACAAAAAGTTTCTATCCTGAGGAAGT
GTCTTCAATGGTTCTGACAAAAATGAAGGAAATTGCAGAAGCTTACCTTGGAAAGGTGGG
TTTTAACCGGTGCCATTTATGGGATGGGCTCTCCCTTTTTATAATTCACACATCCTGATC
GGTGCTGGAATTTGCCAACTAAACAATTGTTTAATTCATTGTGTTTTCTAGACTGTTACC
AATGCCGTGGTCACCGTGCCAGCTTACTTCAATGACTCTCAGCGACAGGCAACAAAAGAT
GCTGGAACTATTGCTGGCCTCAACGTACTTCGAATTATCAATGAGCCAACTGCTGCTGCT
ATTGCCTATGGCTTAGATAAGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGACACCCACTTGGGCGGAGAAGACTTTGACAACCGAATGGTCAAC
CATTTCATTGCTGAGTTTAAGCGAAAGCACAAGAAGGACATCAGTGAGAACAAGAGAGCT
GTCAGGCGTCTCCGCACTGCCTGTGAGCGGGCCAAGCGCACCCTCTCCTCCAGCACCCAG
GCCAGTATTGAGATTGATTCTCTCTATGAGGGAATTGACTTCTACACCTCCATTACCCGT
GCTCGATTTGAGGAGTTGAATGCTGACCTGTTCCGTGGCACACTGGACCCTGTAGAGAAG
GCCCTTCGAGATGCCAAACTAGACAAGTCACAGATCCATGATATTGTCCTGGTGGGTGGT
TCTACCAGAATCCCCAAGATCCAGAAACTTCTGCAAGACTTCTTCAATGGAAAAGAGCTG
AATAAGAGCATTAACCCCGATGAAGCTGTTGCCTATGGTGCAGGTAAATATAGCCTTTAC
ATACTCTGTAGTCTCAACAAGGGAGGCCTGTAAGATTCGCTGTGATGATTGATTCCAAAA
CCATTCGTAGTTTCCACCAGAAATGCTGTGTTGGCTAGTTCCTTCCTTGGATGTCTGAGC
GAATAAAATAAACAATGTTGAAGTGATTGAAGTTACAATGAGTTCTTTCTAACATTTTAT
TTTTTGCTCTTTTGTAGCTGTCCAGGCAGCCATTCTATCTGGAGACAAGTCTGAGAATGT
TCAGGATTTGCTGCTCTTGGATGTCACTCCTCTTTCCCTTGGGATTGAAACTGCTGGTGG
AGTCATGACTGTCCTCATCAAGCGCAATACCACCATTCCCACCAAGCAGACCCAGACTTT
CACCACCTACTCTGACAACCAGCCAGGTGTACTCATCCAGGTGTGTTCTAGAATTTTGTG
TAGTTTGTATAAAAAACCCAGGGAAGTTTCTCGCTGTGATGATGGATTCCAAAACCATTC
GTAGTTTCCACCAGAAGTACTGTGTTGGCTAGTTCCTTCCTTGGATGTCTGAGCGACTGA
TCTTCCCCCAAATTGAGCTTAAGCCACTATAGTAGTATTTTCTATGTGTCTTAATTTCTC
TTGTCTTTCTTAAAGGTGTATGAAGGTGAAAGGGCCATGACCAAGGACAACAACCTGCTT
GGGAAGTTTGAGCTCACAGGCATACCTCCAGCACCCCGTGGGGTTCCTCAGATTGAGGTT
ACTTTTGACATTGATGCCAATGGCATCCTCAATGTTTCTGCTGTAGATAAGAGCACAGGA
AAGGAGAACAAGATCACCATCACCAATGACAAGGGTAAGTATGTATGAACATGCTTTCTG
AATGGAACAATGTTCATAACCTTTAAAAGATAACCTCATGATTTTGTAACTTTCATCAGG
CCGCTTGAGTAAGGAGGATATTGAGCGCATGGTCCAAGAAGCTGAGAAGTACAAAGCTGA
GGATGAGAAGCAGAGAGATAAGGTTTCCTCTAAGAACTCGCTGGAGTCTTATGCTTTCAA
CATGAAAGCAACTGTTGAGGATGAGAAACTTCAAGGCAAGATCAATGATGAAGACAAACA
GAAGATTCTTGACAAGTGCAACGAAATCATCAGCTGGCTGGATAAGAACCAGGTACATGT
TTTGCCAATAAGGGGAAGCAGGTATTCAGAACAGGGCTTGAAAAGGGGTCACTATGATGA
ATGGTCCAAACATTCGCGGTTTCCACCAGAATGGACAGTGTTGGCAGTTACCTTCCTTGG
ATGTCTGAGTGACTCAATAGCTAACTAAGGAAGGGGTCTTTGTAAGATGTAGGTTTAGTT
GACAGTTCCCCCACCAAAAAAAATGATCTGGAGATCTTAATTTGATTTTTTTTTCTCCCC
TCCTAGACTGCGGAGAAGGAAGAATTTGAGCATCAGCAGAAAGAACTGGAGAAGGTCTGC
AACCCTATCATCACCAAGCTGTACCAGAGTGCTGGTGGCATGCCTGGAGGAATGCCTGGT
GGCTTCCCTGGTGGAGGAGCTCCTCCATCTGGTGGTGCTTCTTCAGGCCCCACCATTGAA
GAGGTCGATTAAGTCAAAGTAGAGGGTATAGCATTGTTCCACAGGGACCCAAAACAAGTA
ACATGGAATAATAAAACTATTTAAATTGGCACCATACAGTTGTCCTGACTGAGTTAAATA
TTTTTTAAACATTTAGTGAGACAGGATATCTCCAGGTGGCCTGGGACTCAGGTGCTTCTC
AAGCTGGGAGACAGCTACTGCCAGCCAAAACACAAACCTCTCATGAGTGACTATTTTAGC
CTTGTGCTAAGATTAGCCTTGTGCCCTGAACTAGTGGGATTAAGTAGCAAAGCAAAATTT
CCTTTTGGGATAGTTTAACCTGTAGCTTTGTGGATAACACTTGACAAGCTAACAGGACAA
AATGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNCTTCTTCCAGAGGTCTGCATGTGACAACCTAGTTTACAGGAAACTGGGTTTGTT
GCAAGTTGCTTTTTCATCCAGTCTTAAAGCCTGACAGTGCTCAGAGTACTGTATCTAGGT
GGGCAACCTGCATATTTTGCCATGGTAGGCAGGCCTCCTGATTTCCCTGATAATCTAATA
AAGCTATAGAGTACATAGGTACAGATAACAGTTCATCTGAAAACCAGGGTGGTTGCTATT
CCCCTGGGTATAAACATTTGCAGAGTTAAATGTGTGGGCACAACTGGAGGTAAAGTTTGA
TTCTTCCCTGAGATCTGGGGATTGAAGGCAGGAAGTAGGCTTGCTAGCAAACAACTCTTC
CCCTGCCCCTATGCTTGTATAAGTCAAGCCTTAAAGTCACAAGAGGTTAAGCCTGGATTT
GTTTAGCAAACCTGTTTTGCACAAAATGGTTCTGTGCAAAGAGAAACTGATT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 1469..1674, 1791..1943, 1995..2442, 2657..2859, 3075..3273, 3359..3591, 3846..4031
1001..1205, 1469..1674, 1791..1943, 1995..2442, 2657..2859, 3075..3273, 3359..3591, 3846..4028
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved