Rattus_norvegicus Locus Ppan
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Ppan
Rattus_norvegicus
Ppan
8
SNORD105
2077..2160
6660
AAACTTGGTAAGCTGATTTACATTAAAACTGGCTGGAGAGATGGCTCAGGGTGTTCAAT
TTCTAGCACCTACATGGCAGTTCATAACCATCTGTAACTCCACTTCCCCCTTCAGGATTC
CCTTCTTGCCTCCACAGGCACCCAAACATTTATTCATGTAAAATACCTATGGGCATAGCA
TAATAATAAATAGTTTAAAACATTTTAGAGAGTCTGCCAAGGTGGCCCAGTGAGTAGAGA
TGCCTACTGCCACCAAGTCTGAGGATCTGAATTCCATCTCCAGGCCTCATATGACAAAAG
AAAACCAACTCTTAAAAGTTATCCTCTGACCTTCCCATGTGTGCCACCACATATGCACCA
CCACAGATAATAAATAAATAAATACAATTTATTTGGAGAAGGGGTGGACATGGTGGTACA
TGCCTTTAATCCCAGTGCTTGAAAGACACAGGCTCACGGATCTGAGTTTAGGCAGCCAGG
AATGGTGGCACATGCCTCTAATCCCAGTGCTCAGTATAGGCGGATCTCTGTTAGTTGCAA
GCCAGCGTGGGCTGCGTGAGAGCCTGTTTCATAATTAAATTAAAAAAACAAAAAAACAAA
AAACAAAAACCTGCCTGAAAGGCCAAAAAAAAAAAAAAAAAAAAGGGGTTAGGGATTTAG
CTCAGTGGTAGAGCGCTTGCCTAGCAAGCACAAGGCCCTGGGTTCGGTCCCCAGCTCCGA
AAAAAAAGAAAAAAGAAAAAAAGAAGAAAAAAAAAAAAAGGAAAGAGTCGCACGCCTTGC
AAAACCATGCAGGATAAGGATTTGAACCTTCAATGACTGTGCGTCCCCCTCCCATTTCCG
TAAAAGGGGCATAGCATCGTTTTTACAAGCCCTGTAAAGATCCCCTGGTCCTTTAAGCTA
ACCAGCGCTAAGGCCCGCTGGATGACCTCAGAGGCCGGCGCGCAGGAAGTGGGAAGCGCT
AGAAACCGCGCGGCGCCGGAAATTGGCCACGCAGTGCGTAAGCTCCGTGCTCTCTGAGTC
TCTTGCACGGAAGTGAACGGTGTGCGCCGGAAGCGACTACAGGGGCTGCCTCGTGGAGAA
GCAGGCAGCATGGGGCAGTCGGGGCGGGTGAGGCGCGGCGACCGGGGGGCGGGCATGGGG
CGCTGGTGGGGTCGCGACCGAAGCCGGGGCGCTCACCGCCTGCCTGTCATCCCCGCAGTC
CCGACATCAGAAGCGCGCTCGCGCCCAGGCGCAGCTCCGCAACCTCGAGGCCTACGCCGC
ACAGCCGCACTCTTTCGTGTTCACGCGAGGCCGAGCGGGTCGCAGCGTCCAGCAGCTCAG
CCTGGATGTGCGGCGGGTCTTGGAACCTCTCACCGCCACACGGCTGCAGGTCTGCATCCC
TTAGCCCTTCAGCTCCAGTCTCAGGGCTCGGCATCTTGGCGAGGACTTGGGGCCAGAAGT
TGAACACGGCGCCTGCCTTCCATGTGGGAGGCCCTGGCTCAATCCTCAGCACGGCTTGAT
CCAGGCATAGTGGTGTACAGGCGAAATCGGGAAGAAGAACGAGGGGGAGATCACCTTAGA
AGCCATCGTGGTTACATAGTGAGGTCTCGGGTTAAATATAATAATAACGTCGCGCGTTGG
GGAGCAACAGTAGGTGACTCAGCGGGAAAGGGGGCTTGCTGCTAAGTCAGAGTTCAATTC
TTGTGCCCCACGTAGTGGAGGGGGTGAACCAGCTCCTGAAGGGTTGTCTTCTGACCTCCA
TCTGTGCACCCCTACACGATTGTACAAAAATACTTTTTAAAAAAGTTTTTGAGTGCTAGG
GCTATAGTTTAGGGATATGGGTAAGACCCCAGTACCTCCAGACAGGGGAGGTGTGATCAG
AAATAATACCTCAGAATCATCAGTTGCTCAATAGAAACGGCTGTATCCATTTCTTTTTCC
ATTTATCAGGTTCGAAAGAAGAACTCACTGAAGGACTGTGTGGCAGTGGCCGGTCCCCTG
GGGGTCACACACTTTCTTGTTTTGAGCAAAACAGACAGCAGTGTATACTTGGTGAGTGGG
CACCATACCATGCCGTTCCCTCCCTGGGCCCCAACTGCTCCTGTCTCATGATGATCCCCA
CTGCCCTGAGCTGTTGTGATGCAGGCTTCAAAGTAAACGCTCTGAAGCAATGGAGCAAGG
CTCTCCCTTTGCCCCATCCACTAGCCAGAGCCCCCAACCTCACCCAACCTTTCTTTGGCA
GAAGCTGATGCGACTCCCAGGAGGCCCCACTCTGACCTTTCAGATAAACAAGGTGAAGAA
GGGTAGATGTGAGAGCCGGGCTTGCCTTGGAGAGGGCCCTAGTCACACAGGTGGTCCTTA
GCCTCTCTTTACCCTCCTTTCAGTACACACTGATACGGGATGTTGTCTCTTCCCTGCGCC
GGCACCGGATGCACGAGCAGCAGTTTAACCACCCGCCCCTCCTGATTCTGAACAGCTTTG
GCACCCCGGGCATGCACGTCAAACTCATGGCCACCATGTTCCAGAACCTGTTCCCATCCA
TCAACGTGCACACGGTGAGCCAGATCGAGTGACAGCTGCTGGGAGCGGTTGGGTGTTTGG
AGAGGGAGCAGGTATCGCAGACCACGTGTTATGTCTCCATTGTATGGAGAGATTTACTGT
CATAAAGCAACGTTAAATTCAAAGGCAAGGCTAGAGTTGATGTGATTTTTGTTGATGAGA
GGATCTCATGCATCTCAAGATGGCCTCCAACTTTGTGGCTGAGGCTGGACTTGAACTTCT
GATCTTCCATCTCTTCTATGCTTAGTGCACCTTGAGAAGTGTACAACTTACTTTTTAGGT
GTTGGTAATCAAACTTGGGCTTCACGCATTGTAGGCCAGCACTCTACCAACTAAGCCATA
TGTCTGCCCCTTTTTCTTCATTCAAGGTGGTATGTTAGACCAGGCTAGGTCTTTTTGCAT
TAGCCACCTAGCAAGACTAGAGTGTCAGCTGCAGTCCTGACACCAGGGGCTCTCAGATTA
GGCTCCTTATGAGGGCTAATGGTTGACTTTGGTGGCCCCTGCACCTGTGACTTGTAGCCA
GTGCTCCAGACAGTCTGAGAACCTTGGTTGTAGGCCCTTACACCTGAGGTACCCCAGTGC
CCTCTGCAGGCACAGACTGCTGGAGAGAGCCCCTCCTTCCCAGTTGCAGCCCCTGGTTTC
AGCACTTAGTCCACAGGCAGCTCACAGGCCCCCTTGCCTCTGCCCCAGGTGAACCTAAAC
ACCATCAAGCGTTGCCTCCTCATTAACTACAATCCCGACTCCCAGGAGCTGGACTTCCGG
CACTAGTGAGTGTTGTGGGAGGGACTCAGGGTAGGACACCCCATGCATCTGATGAGAGCT
TTGCTGCTGAGATTGTGTGATTGCTCAGACTCAAAGTAAACGCCCTGATGCATGCGCAGC
GGAGGGCAAGGAGCTAACCTGGGACCCTGGGACCCTTCACCTCTCCCTCTGCTCCCACCA
TTGCAGCAGCATCAAAGTGGTCCCCGTGGGTGCAAGCCGTGGCATGAAGAAGCTCTTACA
GGAAAAGTTTCCTAACATGAGCCGATTGCAGGACATCAGTGAGCTGCTGGCCTCGTAAGA
AAGCGGGTGGGTGGGGGCTGGGGATTTAGCTCAGTGGTAGAGCGCTTACCTAGGAAGCGC
AAGGCCCTGGGTTCGGTCCCCAGCTCCGGAAAAAAAAGAACCAAAAAAAAAAAGAAGAAA
GCGGGTGGGTGGCGGCTGCAGCTCGTAGGTCCCGGATCTGGCCTGTGGAGCACCCAATGT
AACCTCTTGTCCCGAGGAGGGGTGTGNGGCTGTTAGGTAGTTGTGGAGAANCGCAATGAG
AACACACAACCACAGAACTGCCCCTGGCGNTGTGTGGCCGNGGGACTNTGCAGGCCCACC
TGACAATGCCATGCAAGCACTGNTNNNGNGNNNNTNCTGTCTGTTTNTTTATCTATGTTT
GGAATTGGGTCCAGTNTNNNCNTNNNNNNNNNNAANNATAGCTGAGGNNNNTNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNACTCTCTCCCTGTCTGTGTGTTGCCAGATTGGGCCCCGG
ATGACACTGCAGCTCATTAAGATCCAGGAGGGCGTTGGGAACGGCAATGTCCTCTTCCAC
AATTTTGGTGAGGGGACAGGGTGAGGCCAGCCTGAGAGCAGTGTTGGATCCTATTGTGAT
CTTGACATAGTCTGATCTTGACAGTCTGATCTTTCCTCAGTGCACAAGACCGAGGAGGAG
CTGCAGGCCATCCTGGCAGCGAAGGAGGAGAAGCTACGGCTCAAGGCACAGCGTCAGAAC
CAACAGGCAGAGAACTTGAAGCGCAAGCAGGAACTGCGTGAGGCTCACAAGTATGCAGAG
GCATGGGACAGAAAGGGCTGGGATCCTGGTCACCTGGGCAAGCTGACCCGGGACACACTT
GTCCTCCAGGAAGAAGAGCCTGGCAGGCATAAAGCGAGCACGTGCAAAGGCCGATGGCGA
CAGTGACGCTGAGGACCCAGGGGCACCTCCAGAAGCAGTGGGGATGAGCCAGCTGGAGGA
GGAAGAGGATGATGCAGAGTATTTCCGCCAGGCCGTGGGCGAGGAGCCTGATGAAGGTGG
GCAGGGTCTGTACTGGCCACACCTGAGGTCCTACCTTTTACTTCTGAGGAACTTAACAAC
CATTTCTCTCCCTACAGACTTGTTCCCCACAGTGGCCAAGCGGAGACGGCAGGGGGGCCC
TGTGGGCAAGAAGCGGCCTGGGAAGGAGCAGAGGCCTGGTAATAAAGGCCGTGGTCAGAG
TGGCAACTGGCAGGCTCTGAAGCCACATGGCAGATCCCAGAGAGTCAAGACCAAGCTGGG
ACCCAGAGCCAGGTCCCGTGACTTGGGTCCACCATCAAGGAAAGGACCCTGAACCTGCCT
GTCAGTGGGTGGACCATGTGTGGATGCCCCAGATTGGGGCCCGGAAGCTGCCCTGGGCCC
CAGTGCACTCCGGTTTCCTTTCATAAAGGAACTGCCCAGTTACCTCCAATAAACCTGAAC
ATGACACATTGAGCTTTCTCTCTGGCTGGGGTGGGGACAGCTACTAAACTGAGACAGGCC
CAGCCTGGATAGTACGAGGAGGAAGCAGGCTGGGTGGGAGGGTTACTCTGGCTGTGCAGG
TAGAGACTGGCTCATTACCGGCCTGCTGGGAACCCAGATGGGACCTTGGATAGCCAGAAG
CTGCTGGGAAGATTAGCCAGCACTCAGCTCATTGAAGTGGGACGTGTGTTCTATGGGGCT
AATTATATCNCACTCAGGACATTAAGGGAGTGGTGGGAGGGTGCTACCAGAGTTTGTAAG
TTGGGGGTGGGGTTGTTTGGAGTGGTAAGGCTACAAAGTGGATACCTCCTCACTGGTACT
AGGTACCCTCCAGTGGTTTGGGGGGAACCTAGCAACTTCAGAAGGGGAGTGCTCTGAAGT
TCACAACTGCAAGCTTCTGTAGTCTCAGTACAGAGTCCTATGCCTACCCAGCCTTGTTTC
CAAATCAGTGTGGCCCTGGTCCATCCCACCTAAAGGTAGGTTGGTCTGGTCAGTAAGGGG
TCTACCAGGCTGTGTGTCACTTGTAGGAACTGGTGTATGGAAAAGGAGGAGTAGGCCTGA
GGCGGGTGGCTCAGTCAGGTACTCTGCTCACAGGGAGCTTGTCCAGCCCACAGAAGTACT
TGGGAGCTACTGGCAAGTACATCCGTCTTCAGGACTTCCTCTGGCTCATCCTGATTGCAG
AGCTCCTCTTGGCCACAGTGGGCAAGTTTATCACCCAAGTACAGAGGCCTTCTCTGTGCA
GCCAGCAGTCAGCAACATGTTCTATGCACGAACACTGCCTCTCTGGCTGCCTACTGCCAC
CCGCCTGAAAACTGGAGCTTGGGGATGGCTATGGGCCTGCAACCTGCTCAGCAGCAGCAT
CCTCTGCTTGCCTCGGTTTCAGCCAATACAAGGTGGTTGTGCACCCCTTCTTTACACAGA
CACCTGTCACCTGCAACCCAAGCACCTGGGCTATCGGTGCTGTCAGCTGGGTCATGGCCA
TCCTGAGTGCTGCCCCCCACGCTTTCTCCTACCAGAGACAGCCCAACAGACGTGGGGCAG
CAGCAACAACAATCTCAATGCCTCTGTCAAGTACCTAGAAATGGGGGACGGACAGCCAGA
GGCCTTCAGAGCCTACAGTGTGATCCTGGCAGGCCTGGGTGGCTTCCTGCCTCTGCTGTT
CACACCAATGACCGACAGTGTCCTGGGGCTGGTGGTGCCAGGGCTCAACCACAGCCCAGA
AGCTGCGTGTGGTAGTGCTGGTGGCCAATGGTGTGGCTCTCCATGCCTGCTCCTATGCGC
CCTACCACATCACACAAGTGCTCCATGTGGATGCCAAGATGTGCTGGTTGGCTCACTGCC
CCAATTTCTCCAATAAGGCGCAGGCTGAGCAGGAGCTGGGGCCCTTCTTTGGCTGACAAT
ACACATCCTTGTGCCCCTGGCCGCATGCATGTACCCCTTGCTCTACATGGCTGTGGTACC
CAGCATGTGCTGCCACCCATGTCATGTTGTGACAACAGATCCTAAGCAAGGGTCCTCCAG
T
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1106, 1198..1368, 1929..2030, 2221..2271, 2363..2533, 3228..3304, 3486..3593, 3716..3759, 3840..3915, 3999..4005, 4128..4206, 4300..4429, 4509..4675, 4757..4958, 5633..5660
1089..1106, 1198..1368, 1929..2030, 2221..2271, 2363..2533, 3228..3304, 3486..3593, 3716..3759, 3840..3915, 3999..4005, 4128..4206, 4300..4429, 4509..4675, 4757..4958, 5633..5660
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved