Rattus_norvegicus Locus Josd3
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Josd3
Rattus_norvegicus
Josd3
8
SNORA40, SNORA18, SNORA8, SNORA1, SNORA32, SNORA25
5652..5779, 6908..7038, 8158..8294, 8492..8624, 9120..9241, 9403..9531
10705
CACAGGTTGGACTCAGCTCACCACGTGGCCTCCAAAGCTTGCAGTCGCGAATTTGAAAG
GAGCATTCAGGTAGGAGTGGTTCCTAGATAGGGTTCTACAGTGATTATCTTCGGATCTAT
CCACAGGTGTATAGTGGGTGCAAAAAGGCCAACCTGAAATTTCAGTTTTGATGGGTTAAT
TTAAAAAGGCAGTTCATGCAGTGGGTATTTTGCAATCTAAGGACATAATCACCTGTTTTT
CTTAGCCTTGAAAACTGTGATTAGTTTAGTTCTAGGATTTGTGTAGCCTAAGTTAACTTT
TGAAGTTTTTTTCTCCTTAGCACAAGTGGCCCTCTTACCTACTTCTTACTTTTACACACG
TGCATGCAGTGCTCACAGCCCACAAGAGGGATATCGACTCTCTTAGGAATGGTTACAGCT
ATTTTTAAGCTGCCATGTGGGTGCTGCGAGTCTAATCTTAAGACCATTGAAGAGCTCTTA
GTCCATTGGCAGTACTCTTAACTACTAGGCCATCTTTCCAACCCTAATCTAAAGGTTCTT
GTACACGCTGTTAGTATCCCAACTACCCGAACTGATGCTTATTTTAGTGTCTAGTGGGCA
GCCCAGATTGGAATTAGAAATGCTATATTACTATGTGAGGCTATGTGGTGGTTAAAGCAA
AGTGGGCAGATTTTTAGAGAGAAAACAAACTACATTGGAATGTGGTTTGCTTCCACATTC
TGTGGAATGTATGCTATGTGTGTGAGTACTCTGGAAGGCAAAGTGCCGTAGCCTCATGGA
GCTGGAGTGAACTGCTTACAATCGTAAGCAACCCGTTGTGGGAACTGAAATCTGGAAAAG
CAGAGGAGCTCTGCTTAGCTCACTTAAGGGCTTCAAAAGTAGATCTGAAATGTAGGATCC
ATAGGGATTTTTACAGAAACTGACATAGTGGTAAGGAGTGTGTTGAACTTTCTATTAGAA
TGCTGTGTATGTGAAGGGGCATCATTGAAATTTGTAATTGCAGAAAACTGGGTAAAGCAA
AGTGATGGCTCAATCAGAGGTGGATTCTGTTGACTGTGTGACATCGGATAGAGATGGGGA
CATTGGAAATCAAAGGTAGGTAAACTATAGATTCAGTCCAAATGTTCAATTTATTTTGAG
GAGGGTCTCAATAAATAGAGCCATGGCTGACCTCACCCAGATAATCCTGCCTATCTACCT
CCCAAGAGTTGGGATTAAAGGCATGTCACCACACCCTGCAGTCCAGCATATTTGAGTGCT
GGGGAGTTTTATTTGTATTGCTTGTCCATAAAACATGGAAAAGCTGAAGATTAACATATT
ATTAGCTTGACTAATCGTTAAAAAAACTGTCTTGTGGGGCTGGAGAGACGGCTCAGCGGT
TAAGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAATTCCCAGCAACCACATGGTGG
CTCACAACCATCTGTAATGGGATCTGATGCCCTCTTCTGGTGTGTCTGAAGACAGCTACA
GTGTGTTCATATGCATAAAATAAATAAATCTTTTTAAAAAACTGTCTTGTTTTATATAAA
ATAGTAAGGACACGGTGGTTAACTGGTACTGAGTTCATTCTGAAATGCTGGGTATGATTT
TAGGGGATTGTACTTGGAACATGTACTTTTAACATGTTTTTTAGAGTGGATTGCGTGTCT
ATTCTGGTGCTCTTAGGTGTGGGAGCTGTGAAACTGAAGGGATGCATGATTGTGAGCTGC
CTGGGAGAATGGCCTTGCCACTCCTGGGGGATTAATTATATCTAGTGGTAATTCAGTAAT
GCAATTTAACTTTTGTTTTAGTGATGACTCATCCAATAGCAGCTTATTTAAAACACAGTG
TGTTCCTTCACCTACAAGAAAGCAAAGAATCCCTACTGTGAAATGTGTTCCTTCACTTGC
AAGTGTTGAAACAGATTCATCAAGTGACTCTTCTCTAGAACCAAGGCCTTTGACTTTAAA
GGCTATTTTTGAAAGATTTAAGAAAAAGAAAAGGAAAAAGAGGAAAAAGAGAAAATATAA
GCCAAAGTTAAGACGACAAGGAAGACCATCTGGAACGAGGAACATTAGAAGGTCACAAAT
AGATGCAAAACAAATTAAAGACAAAGGAGCTGTGTTTCCATTCTTAGAATCTGAAAGTGG
AAGAAAGACTTTACCTTGGAAGAAAATTTTAACATATGAGGTGAGTGATTTTTTTTTTTA
ATGTAGGTGAATACATTAAGTAGGATGGAATGGTTTGTTGGTCATTCTTTTTTCTTTTAA
AAGATTGATTATATATAAATACACTGTAGCTGTCTTCAGACACCAGAAGGCATAGGATCC
CCATTTCAGATGGTTGTGAGCCACCATGTGGTTGCTGGAATTTGAACTCAGGACCTCTGG
AAGAGCAGTCAGTGCTCTTAACCACTGAACCGTCTCTCCAGCCCTTGTTGGCCATTCTTA
ATTGTCTGAGGGACACCTGGAACAGATCTATGCAAAGTGCTCCATTCTTCATCTCACCTG
TATCACTAGTGAGAGAAATAACCACAACCATTATTTATCAGTGTCACACAGATTAAGGTA
GTTGTACTCCAAGTTTCCTTATACAGAGTCCCTTCAAACAACTGAAGCATATCATACCCA
ACTTTTTTTTCAGCAGTAGTGAAACGTGACATTACAAGGTGAGCAGGTATGGAATCACTT
CTTAAGGCCCAGTTTTTGAAGAACCTAAGAAAGGTGGAGAATAGGACCATGAAGGAAGCT
GCTGCTCATGTGTACTGTTAGCCTAGAGCCCTTGCTTGTAATGGTAATGCCCACAATCTA
GGCAACCACTATCCAAAAATAAAGCAGTGTCTTGGTTGAGGATCCATTCTCAGGTTATTC
TGTGTCAAATTGACAGTTAGGTTAACTAGGACAAGAGCAGGGGAGAAAACCCAAGTAGCC
AGCTACTCAGGTTTTTCAGGTGTTTGAGCATTAAATGTTAAATGATTAGAATGGTTGAAT
TAGTGTCTGCTTTGCGTTTTTCTTTGTGTGTGCACATGCAGACATAGCATCTTCCTATTC
ACCTTGTTCCTATGTACTGTCTTCACTCCCCAAGTCTGGAACCGTCATGCACAGAGCATT
TACATGGTTTCTGTGCATTCAGATCTGGTCCCTTTGATGAACAGCAAGCCATTGTCCAGC
CCCTTGGTATAGTGTCAAGCTTGATTAAGTATTTGATGTTTTAATATTTAAGGAATTGTG
TTTTCTAACTTGCAGCAAGCAGTTGCAAGAGGATTTTTTCACCACATTGAAAAACTCAAG
TATGAACACCACCTTAAGGAATGCTTGAGCCAAATGCATGCTGGGGAAGATTTAGAAAAG
GAAGACTTTGACAGCCGTAGACACAAGTACATGGATGATGATGGTCCGCTTTCTCCTATT
GAAGAGCCGTCGTAAGTTGGATTTGTCCATGGAACTTGTAGTTCTCTAAGCTCATTTAAA
GACAGTCTCACTACTGTATAGCTGGCTAGGGCTGAACACACATGTACCGAGTGCTGGGAT
TAAAGGCAAGTGCCATCTATAAAATGAGTATCTTATAAGATTCTGCAATAGTAATCATAA
CTTCTAGTAAATTTAGGATTGTTTACTCTGAGGTATGTGCATAGGACATCAGTTTGGGAA
GGTAGTGGTTTTCTTTGGTTTCAGCGATATCCGAATACTAGGTGACTAATGACTAAATGG
CTCATTTCATTTCATGTTACAGAACTGAAGATGAAGCAACAGATCCTCAGTCTGAATGTG
ATATTAAGTTGGTTGTAAGTGGCCGAGTTTTATTATCTCATTTACGGAATGTAGAAGTTA
TATACTATTTGGAAATTTCATTTAAACTTTTTTTTTTTTTTTTTTTGGTTCTTTTTTTCG
GAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCGCTCTACCACTGAGCTA
AATCCCCAGCCCCTCATTTAAACTTTTAAGAGTGAAACTGCTTACTATTTAGGATATTTG
GTACCGAGGGCTTTTTATGTTTTTGTGGCTCTTCCTCTTAGCTCCAAGTATTGGGGTTCA
GAGCCTTGCCTGCATTAATGACAAGGCATACTGCTGAGTTATAACTCAAGCTTTGAATAT
TTGTGTATAGGGTATGTATGTATCTGCATGTTGGTATGAGTATACATTTATGGAGTCCAG
AATTTGGTCTGGCCTCTTGACCACAACCTAGTGGATTAACCTATAGCAAAGTTTTTGCTC
TGCTATTACTGGCTTACAAAATGGTGCCCGTGCCTGGCTCCAATATTAACACTAAAAATT
CACCAGGTGTATGTTGGTGTCTGGGTAGGCTAGAAGAGGTGCAGTTGGATCCCTTAAACT
GGAATTTTGGTGCACATTGTGGGTGCATAGAATTTTCTTAGTCCTTTGCAGTAAGAAAAG
AAGACAATGTTGTGGATTATTTTTGTATTTTTGTTTTTATAAGTGTGAGTGTTCTATCTG
AATGTATACCTGATTAATGGAAGAGGGCACCAGGTCACATTACAGATGGTTATGAGCCAC
CATGTTGTTGTTGGGAATTGAAGGCAGGACTCCTGAAAGAACAGCCACTGCTCTTACTTA
ACTGCTGAGGCATCTCTCTAGCCCTGTGAAAATCCAGTGTGCTTAGCCACTGAACCATCT
CTAGCTCCTGATAAAATAACATTTAGCAAGTCTGGTGTGCAGTCAAATGAGAAAATAGTG
CTGGTGTAGTGAGGAATAGATTTATACTTGTGGGCTGAAAGATGACTCAGTACTGGGTTA
AGAGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAGTCCCAGCAACCACATGGTGGCT
CACAACCATCTGTAATGGGACTGATGCCCACTTCTGAAAGCACCTACACTGTATATAATA
AATAGATAATAAATTTAAAAAAAAAGATTTATACTAACCCACAGTCAGTGGTGAGTTTAG
TTACTAATTTTTCTTTTAAATGCAGGAAGACAGTTGCTTTATAATAAGTACAGAATTCCC
AAGGAAGAGAAACTTAGAACAAGAAAAGATTAAGAAAGAATCTGCATTCTCTAAAAAGAG
CAAAGCCAAGGATGCCACACAGAGAGGGAACAGGAGGTCCTGGAAAGGAGGTGAACATGT
GAGTATCGAGGAAGGTAAAGAGCACGGGATTGTCTTGTGTATGTCAAGAAGATGAAGGAA
CAAAAATCACTGAACAATCTGGGAAAGAAAATAAACTTGCTGGGGGGAGCTAGCAAAACA
CTTGGGAAAGCTCTTTTCAGTGCTGATTTCAGAGTAAGAAATCCTTCCTATAGGGATTAT
TCTATTACAGCAAGTACGACTTTTCTGGAAGGAAAATGCTAACAAAAATCCTATATGTGG
CTAGTTTCAAGAACTCCAGCCTCTTCAGTGCTTAGCCCAAACTAACTTATAAAAAAGAAT
TACTTCATATTTGTGTATTTTGCCTACATGCATATGTGTGGAGTATGCACCATGGCCTGT
GGATCTCAAGTTACAGGATGGTAATTAGCTATTGTGGGGGTGATGTGAGCTGAACCACAA
TTCTATCTACAAGAGTGTTCTTACCTTGTAACACTGGCCTTGTGCCAGTATATACATACA
GCTTTGTTGGCTAGCACTTGTGTTTGTTTTTGTTCAGCTGTTGGACAAAGGCAGGTTGAC
AGGTGCAAAAAACAAATCCTCTTTTGCAACCCAGAACTCATTGTTCAGTATGAGTTTTGA
TACATACAAGAAGGAATATAAGCACAACGGTGTTACTGATGAGGCTGTTTCTAGCAATGT
TCTGTGTGATTTATCCTATAAAGGTAATGATAGATGAATATTCCTTTCTTTAAAGGCTTG
CCTTCATTCTGAAGTCAGTTAAAAGATGCCCATGAATGGATGTTTGTTTCAGTGTTGTAA
GTAGCATGTCAATTTACATCTTCACAGTATGTTAGCTTGAAGTAAGTGATGCTATTTCTA
TGAAAGTTTTAGAGTACTCCAATCCTTAGGAAATCCTAGAACATTAGAATCAATAATTTG
AACTGAGATAAGTAAAGAAGGCTATAAGGTCTTATACTCAATTTATAATATTATAAACTT
TTCTCAAGCATGGTTTATAAATTATAACAAATTTGTAACATCACAAATAATAATGTTTGA
AAAGTATGAGTTAACTAAAATAGGTACTATTCTAAAAAATCAGGTTGCCCATAAGGCTCT
TCATGAAAATTCAGTTTTATGCTGGCACTTAAATTATCTTTAATCTGCCTGATGTAATTG
TCTCTGAGCCTTACTGCCTTTTTGCTAAATGAAGGCCTAGTCTTGGAAGCTTCTAGCCTC
TGCACAATCTGATTTAGGCCTAGAATGTTTTCAGCCTCTGAGACTTAACTGCTGAATAAA
TAATCTCACACTTTTCTTGTTCTTACTGAATTTTTGTCTGGTTTAACAAAGCTGTTGTGG
TTCATACTCTAACAAGGTGACTGATTTAGTCTGACTTCTGCCTCAAACTACCTTGCAATT
TGTTCTGATATTTTGGGCTCCTCTCTCTTGGCATATTCTGTATTTACCTGTGTCTAGCTT
GTTCTTTCTGCACCTGTCTTTAAATCTGTCATTTTGTCTGCCACTCAATTAGACTTCTTT
TGAACATGGGTTGTTTCTAGTTATGTATGTGCTAAGGGTATGTCAGTATTCCAGCCAGCG
TAACCATGTTGCTGGATTAAAATCCCTGTACAGTAAAAGTGAGTTTGAGAGCTCCGGACT
GTAAGAATGTATAACCTTAAGCTTAAGCTAGGCAAATCTCCTGAGATTACTTTGTGATTT
CCTAAGTTCCTATTAATAGACGTCCATAAAAGGTAGCTGGAGAGAGAGCTTCATGATTGT
TGGATGCTTTTGAGGTCTATCCCGATGGGGCTTCGTTAGTAGCCACACATCGTTGGAAAC
GCCTCATATAGTAACTTGTGGTTTTGCTTGACTCGCAGGACTGTTTGTTAGGTCTGTGGG
AAGGAACTACAAGACAGCTAACAAAGTACAAAACTGATGTGCAATTTTGGTTTTGTTTCT
AGAAGCACTGGCATTTCCTTCATAAAGATTAGGATTCTGAGTGTTAGGTGAGTTTTAGTG
ACTCTGCAATTTTGGGGAAGTATAGCTACAGTTCAGATGATGAATTAAACTGTTCAACTG
CTGTATGATACAGACATGAACTAAAATTTAATTCTGACAGAACTGGTTACAGGTGTTAGG
TTGGAGTAAACTTTAACTGTAGTTTCTAATAAAGTCATATGTACTGTTCTCCAGGAATGG
ACATGAAAGACTCTACAGAGATGTTGGTAAGTAAGTATAAAACTAGATTTCTGTTGGGTT
TTAATATGATAAATTAAAAATCTCCAGGGGTAATGTGTAAGTTCTCAGCAAGAACATTTG
CTCTGTGTGTACAAGCTAGGAAGTACTTTCTTGGGCTGGAGAGATGGTTCAGTGGTTAGG
AGCACTGACTGCTCTTCCAGAGGTCCTGAGTTCAAATTCTAGCAACCACACGGTGGCTCA
CAACCATCTGTTAATGGGGATCTGGTGTGTCTGAAGACAGCGACAGTGTACTCAGAGACA
TAAAATAAATAAATCTTTTTTAAAAAAGTACTTTGTGCTAGGCTAGTTCATCTTTTAGAT
TCCAGATTAAAATGATTAGAGAAATGCTCATTCAGTAGGGATATTGAGTTCTTTTTAAAA
GAAACCATGTACTAGTTCCACACCTGTAATTATAGGAGTCTGATGTGGGAAGCAGGGAAA
CTTCTCAGAAAATAAAATTCTTGGTTAGGTAAATGGCACAGTGGATATATAGTTCAAAAC
CGTAGCAACCAGGTAGATACGGTAGCTGAATCTGGAAGTTCTGACTTTAGTGAGAAACTC
TAAGGTGGATAGTGTGATCAAGGAAGGTAATCAATCATCAGTATGTGTGCATGAATGTAT
GTACAAAGAACATTAAATCTTTTGATTTGAGCACTTTTTCCATTTGTGGGGGATTTTGGC
TGAGATGGAACTCTAAATTTCCTGTCCACCTTTAGCCCCCTCAGAATGTGAATTTATGTT
AACATTTAAAAAGTTAGCTTCTTTATTAGCACAGGGATTGAGAGTGCTATAGAGACTTTG
CACTGCATGGTATCTGCACTCAGCAGTTCTTTCCTGTTGGGTGTTCAAAAGACAGTGCGA
TAGAAATTCATTATCTGGCATCGTTGGTTTCTTGGCTTTGTGCATGTTAAACCTGGTATT
TCTAATGATACAGTTTATTTCATATGTACATATTTCTTCTGGATGTGGGTTCTGGGGAAT
AATTGGTCTTTAAAACTTGGTTGCCTGCTGAGTGAACCATTCCTTTTCTTCCTAGGGCGT
CACAAGGGAAACCTACCTTAAAATGGTAAGACATTTTTCTGTTTCTAGCTGTCTTTACTT
GAGTAGATGACACGTATGAGACTCAAGAACTAAGCCTCATTGTACATAAAAATGGGCATT
GTTGTTGGCCAGTGTCCAGTGTCAATGTGGCTACATTAAGATACAGGTCATGCTTCCATC
ACAGCAGATTAAATGACAGTGGTGACAATGAGACCTGCAACATTTGTCTACTACCCTCCA
GTGAAGACATGTCAATTCATTTTATATTTTCTTATGACCAATCTTACAGGTTTTTAAAGC
TAATTGAAGAAGGGTCCCTAAATTAAAGTAAATTGAAGAAATCCACAAATCTTCTGGTAA
GATGTGGACTTTGAAACCTTGTGAGATGATAATACTGAAATTCACTGCTAAGATTTGAAA
AAAACAGTACTACCATAAATGATGTTGTGATGATGGGCAAAATGTTCAACTGCTCTGAAT
GGGCTGAATGAAAGTAGCCTTTCTGAACATCTGTGTTGGGTAGATAGATTCTGTGTATGC
AGACCTGCTGACTGACTCCCCTAAACTGTGGGAATATTCTTTGAATCTGGCATCATGTAG
AATTAAAAATTTTAATTCTTTGAAACATATTTTCTCCCACAGGCTAAGAACTTAGAAGTT
GCCAATGACTGTTGGAAAAGACAGATAAAAGAGGCAAGTAATAGCCATTTATTTTTACAA
TGGTCATTACCAAGGCTTTTAGAATGCAGTTTCTCATTTGCTGTGGACATGACCATAAAG
AAAAATTCCCATTAGGTTTTCCATATGCTACTTGAGTAGCACTTAACCTGTTGGGAACAT
TTTTTGAGCAAATCTTTATCCAGTTGTTACTTTATATGTAGATGGTTCTAGAATACTGAC
TACTCATCCCATTACTCCCATGTTCTTATTATGCAGGGCTAAAAATAAAAAGCACAACTG
GATGCCCTTGAGGAAAGGTATGTGTATGGGAAGCGGGTAGCGAAGGTCATTTCAAAGAGG
GCTTGGTGGCTGTAAAACCAAAAGCTCTTAACGCTGTGACCAAAGATTGATGTTCTTCAC
AGAGCAGACCATGCACTTTGTGATAGTGCTGTTTTTCTGAGAAGATAACATGCATTTCCC
TGAATCACAATTTATCATTAATTTCATTTTGTCTCTTTTAGGGCTATTTTCAGAGTGCCT
GGATGGACAGCAAAGAAATCAAACCAACCACTTAAATAAAAATTTATTGACAATAAATAA
TTTTATACATTAAAAAAGAACCCTTAACACAATTTGTAGGAAGTCAGTATGTATTTTTGG
CTTGACTTGTGCTTTCTGTAGAAAAACAGCTTGTCTTCATACTTATATACACTGGCTCCT
GTTTCTCTTTGCTGTTTCATCTCCACTAACAGCCTCTGTAAGAGAAATTTGTGTAATTAG
ATAGGCACATGTAGCAAAACACTAGAAGCAAGCAAAAAAAGCCTTTTGGTACACGAGGGC
TCAGGTAGCCTTTCTTCCTTGACACTAACCTTTCAGGTGGCTCAAGGATGAACCTGAAAA
GCAGTGATTAATGGGTTGAGTCTAAAAAATACTTAAGCTTAAATACTTAAATCTCTACTG
TAGATCATACAGTAGAACATACTTGTAGATAGCTTCTCTTTGGATACTTTGGCTTGAGGG
AGCGGAGTTTTATTCCAGATCTCTCTCTGTCTCTGGTAGGATCGTTCCATAAATGTCTTT
TTTCTTTTCATGAATGCTTCCCCCAAACTACCTGGTATAGCTGTAATATTTGAAAAAAGT
TATTCATGGTTTCACCTCATCATCAGTGGATGTTGTATCAGGCTTATAAGGGAGGTACCT
GAAGATGCCACTGTGGGTTGGTCCGCCCAAGGCTCTGATGCAGCTCCACAAAAGGTGGTT
TCCACTGAAGACGAAGGCTGCACTGCACCTGCCTATTAGTAAGAAAGTTATTGGCTTGTT
TTCCTCCCAGCATCAGCAGCCCCATGAACAGCCTGGTCTAGCAGCTCTGGTGAAGGCATT
TACCTGAGAACACTGTGCTTCATTGTCTTCAATGGTTAAGTTTGCAAGATCTGTGTCAGT
GATGCTGATGTCACTCGTACTCAATAGAGTGAGATCTGGTTCTTCCATTATGCCATAACC
AGTTTCTGTTTCCTGTTTTAACAAGTGAAAGTGAGGAACTGTCCTGCATAATGCTTATAT
GGAACTCATACACATCTGCCTATCTGCATTCCATTGTGTGTGTCTGTGCAGGAGTGTCAC
ACCCTGTCATGAAAAGCTCTTAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1094, 1821..2199, 3255..3430, 3742..3793, 5005..5157, 5875..5935, 7314..7345, 8395..8424, 8689..8755, 9042..9092, 9336..9376, 9581..9705
1024..1094, 1821..2199, 3255..3430, 3742..3793, 5005..5157, 5875..5898
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved