Rattus_norvegicus Locus Ncl
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Ncl
Rattus_norvegicus
Ncl
9
SNORD82, SNORD20, SNORA75
4527..4598, 7966..8045, 8729..8865
10525
CAGTGTGCTCTAGGACGGCCAGAGCAAATAGTGAGGCCCTATCTCAACCCCCACCAGCA
CCTCCACAGGTAATTTTTAATCGATATTGTCAGCTGATGAGGGCACCCGTTTGCTACGCT
TGGAACCAGTTAGTGGCAATCCGTTTAAAGCAATCCAAGACAACTCTCTCGTCCTCTGCC
ACGGAGGGAACTCGTGAGCGGTCCCAGGCAGGCCGAGTACTTCTCCCACCACACACCAGG
AAGTCACCTCTCTGAACCTGGAGTTATACCTACCGCGTGAGGTCAGAGATTAAATGGACT
GTTTGTGCACTGCTCACACACACACACACACACACGCGCGCGCGCGCGCGAAATTGCTTT
TATTAGGAGCTCTCAGGAAAGTGGTGGCTCGCATCAGGCTACCACAGCCAAGAGGACCGC
CACCTCTACCGAGGGCAGGCCAAGGCCCACTAAACGGCCCGAATGAACTCTAGGCCTTCC
GGCGCTCTCCAGCTCTTCAGCGCGGCGAACGTTCTAGGCCCCTGAGAAGTCCACCGGGAG
GCGCAGGTTTCCGCTACGCAAGGGAAATCCCCGAGAAATGCCCAGACCACCTAAGCACAG
ACGTCCATGCGGCGTACGGATACCTGAGGGAATCCGGGCCATACCGCCACCTACTCGCGC
CTCACTCAAGCCGCGCCAAACTCGCGCGTTTCACTGCGCAGGCGTGTAGCGAGCGGGCGC
TCAGGAACACTCAAAGGACCAGCACACTGACCAATCAACGTCCGCCTTGGCCAAAACTAG
TCCCGCCCTCAAAAGCAGACGTCAGGCCCTGCCCCTAAGAGCCCCGCCCTCCCCCACGCT
TTAGGCCCGACCCACGCCGTCCTGGGTTAAGGCTCGCGGTTGGTTCGGGGGACGGACGCG
AGCTCTGGTTGGTGGAGGTGAGGTCACGAGAACACCTTCGTCGCCTTTCCAGAGGCGATT
ACTGGGCAAGCTCAGTCTTTTGCCTCAGACGCTAGCTGTAGCTGGCAGGCGGTTGTACGT
GCTCCAGAGTCTTCATTACCCGCCGATCCAGTCGTCTTCGCGTGGGTTCCGCTAAGCTCT
TCTGAGCTGCTCGCTCTCTACACACGCCGTCGCCGTAATCCGCCATCATGGTGAAACTCG
CAAAGGTAATAGGCCTGACGCGCGAACACGGACGACTAGGCCTGCTTTCTGAGAGACGCG
CGCGCGCCCGTCGCGGAGGGGAGGAGGGCCTGCGCACAGTCCCGGGCGCGTTCGAGGGCG
CCATGCTGAGGGAAGTCTCGCGCGACTAGCGGGAGGTCTCGCGGTGTTTGGCCTCTGACT
TGAGGGATGAGAGGAGCCGAGGCAGGTTCTGGGAGGGCGATGTAGAGTGCACCGGGGCCG
GGGGTCGGTGTGAGGGGAAGTCGGAGGAGTTGAGCGCGGAGAGGGGGTTGGAGGCTCGGC
GAGTGAAGTGGGCCAACCTTAAGCGGCTAGCGCTCTCGGCCCCGCCTCCCGGCGCACGTG
CTCCGGTGCGCGGCCCGCCACGTGGGTTACGGCGCTCCGCACGTGTCGCGCGTCCGAGGC
AGTGAGGGGAGTGGGAGTACACCGGGAAAGGGGACAGTAGAGTTGGCCTAGTTACCTAGC
GATCCGCAGTCCCTGACCGTGACGGGTAGATGGACACGTGGTGGGCTCCTGAGGTAGCGC
GTGGTGACCGGCTAGGTGACTCCACGTGGTTTGGCTGTAAGCGTGAGAAAGTAGGAAGTA
GCTCCGATACAGAGATGCTTTTAAGAGGTGCCTTCGAGATAACCCCCTTCCCCGGCAAAT
AGTTAAAATGGAACCTTTAACTGGGTTTTTTTCTTTTTTGTGGAACGTGCCAGAAAATAA
AGTGCCACGACTAAGTAGACTTTAAAAACCTGTGGCTGTTTCCTGGTGAAGGTTTCTGTC
TGTAAGACAAATTATGCGCAGTTCTCAGAAAAATTTGCCAGGAAGAGTGTCGTGCCTGGC
CACGAGAAGTCTTTATGCTTGTGTTCTTTAGTAAGAAAGGAGGTGGTGGCCGAGGACAAA
GTGGCTTACAATGCGGGTGATTTTTTTGTGTGCATTTGTAGGCCGGCAAAACCCACGGAG
AGTCCAAGAAAATGGCTCCTCCTCCAAAGGAGGTGGAAGAAGATAGTGAGGATGAAGAAA
TGTCAGAAGATGAAGATGACAGCAGTGGAGAAGAGGAGGTAGGATGCTATTTGAAAAATT
GTGTGATTTGCAGTGGTAGATTGACTGGAAGTGTCAGAAATAACAGTCAGTTCGGGGGGG
TGTCTGGGCAGAGTTTCGTATGTTGTATTGAGTAGAGTTTACTGTAGATTTGTGGGGTGG
TTTTCCCTCCGTTTTTGGGAAAATTGCTTATTCTAGCCTAATTTTTATTCAGTCCATGGT
CACTTGGCTTTGTGAATTTTGGCAGGACATTATGACAGGAAGCTGTAGACCAGCCTAACC
TCAGATAGGTTCTCCTGAATTAGGTGTTAGCCACAGTATCCAGACAAATGACAAGTTTAG
TGAGAAACCCAGACTTTGATCTAGGTAGAGATGGAATCAGGGTCTCAGCTTAGGTGGTAC
CATGTGAGTTTTTTGGGGTTACCCCCCCTTCTATATATTAAGGGACTAAGCTGGACACTT
TAGAGGAGAGGGTAGCCTTTTTAGATTCTTGTTCTCTAAGCAAAATTTATTATTCCCCGT
ATTCTTTATCTCACATGGTTTGTTTTTGCAATACTGGTCCCTATCACTGAGCTTCAGCTT
ATTTGAATCTTAATTCCAATCATTGTTCAAAATACATTGTATGGGTAGAAAGCTGCTAAT
AACCCATTTGCTAGATATGACATTCCCAAGTTTCATTTAAAGACAATCTAGCACACAGGA
GACAGAAATAGGAGTACATAGTGAAACCTTATCTCAGGACAGTTTTTATGGTCATGCTCA
ATCAAATTTCTTAGAAAAGCTCAGGTGCTGAGTTAAGAGTCCAGTTTTTTAAGCATTGAA
GGCCATGTATCCTTATTTAAGGGTTTAATGTTTATCTTTATGTGTGTGAGTGCATTAAGC
ATGCTTGGTCCCCTCATGCTAGAATAGAATGTACTTGGATATCCTGAAACTGGTATTACA
GCTACATGTGGATGTTAAACTTGTTATAAGAGTAACAAGTGGGGCTGGGGATTTATTTAG
CTCAGTGGTAGAGCGCTTACCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCTCCGG
AAAAAAAAAAAAAGAGTAACAAGTGCTCTTAACTTCTGAGCCATCTCTCCAGTTCTTTAC
TTTTTAGAAACATATCTAATGTCTATCTTGTGTTAGTAACTTAACATAGCATTGGATATA
GAGGAATGCTTATGATTTGTTTGCTTTCAAGGTTGTCATCCCTCAGAAGAAAGGCAAAAA
GGCTACCACAACTCCAGCAAAGAAGGTGGTTGTTTCACAAACAAAAAAGGCTGCAGTTCC
CACACCAGCTAAGAAAGCAGCTGTTACCCCAGGCAAAAAGGCAGCAGCCACACCAGCCAA
GAAAGCTGTTACACCAGCCAAAGTAGTTCCAACACCTGGTAAAAAGGGAGCTGCACAAGC
AAAAGCATTGGTACCAACTCCTGGTAAAAAGGGAGCTGTCACTCCAGCCAAGGGGGCTAA
GAATGGTAAGAATGCCAAGAAGGAAGACAGCGATGAGGATGAAGATGAAGAGGATGAAGA
TGACAGCGATGAGGATGAAGATGAAGAGGATGAATTTGAGCCACCGGTAGTAAAAGGAGT
GAAACCAGCAAAAGCAGCTCCTGCTGCTCCTGCCTCAGAGGATGAGGATGAGGAAGATGA
TGATGATGAAGAAGATGATGATGATGATGATGAAGAGGAGGAGGAGGAAGATGGTGAGTT
AGAGCTTAGGATATTGAGTACTGCATGTACACTCCCTGACCATCATGGTTGGATTAAAAA
CTCATATTTTATGCTTTTAATTCTTTCCATAACTTAATGGGTTTTTATTTCCTTTTCAAG
GTTTTCCTTTTTTAAGTATTTGTAGTGTTTATGTTGTCTGGATTGGTAGCAAATGCATTT
GCCTACTGAGCCATCTTTCTTTCAGACTCTGAGGAAGAAGTTATGGAGATCACACCAGCC
AAAGGAAAGAAAACTCCTGCAAAAGTTGTTCCTGTGAAAGCCAAGAGTGTGGCCGAGGAG
GAGGAAGATGATGAGGATGATGAAGATGAAGAGGAGGATGAAGATGAAGAAGATGAAGAG
GACGATGAAGATGAGGATGAGGAAGAAGAGGAAGGTAACCAGATTAACTTATAAAGTATG
CTGACTTAAGTAATGCTTATTAATGGAAATGCTAAAAAGTCTGTGTACTCATGAATGACA
TTTTAAAACATGCAGAACCTGTTAAAGCAGCACCTGGAAAACGGAAGAAGGAGATGACCA
AGCAGAAAGAAGCCCCTGAAGCCAAGAAACAGAAAATAGAAGGTAAGCCTGCAAAATTGG
GACTTAAAAGGAGATCAGAGTAGCAATAGCACAAGTGATGACTAACAAAGGGACTTAATA
CTGAAACATCTGGGATTGAAATGCAGTATGCTGATGTGCTTTATAGTTTATGATGAAATT
CACTTGTCGTATGCTTAAGTGGACTAAAAAAGCTCATTTTTTGTGCAGGCTCAGAACCAA
CTACACCTTTCAACCTGTTCATTGGAAACCTTAATCCAAACAAGTCTGTTGCTGAATTAA
AAGTTGCCATCAGTGAACTTTTTGCTAAAAATGATCTTGCTGCTGTGGATGTCAGAACTG
GTACAAATAGGTATGTTTTTCATTAAATGGTTTGTGTGTATCAGCTAGTATTTTTACCTT
CCAGTTGTGTTCTTCCACGCCCTTAAATACTGGGATAGATAAGGCACTACAGTAATAAAG
AGGTTAGATAGTAATGAACTAAATCATCAAATTATAGGACCTGCAATTTGAAGTCCTGTG
TTTGACTTGGGGGTGTCAAATAGCAATTTTAAGAATTTTACATTTTGGGTAATTTTGCAC
TTTGGGTCTGCATAGTCACAGCAAATGCTTTTAGCTAAAAGGATTCTCAGTACTTACCAG
GGTCCATGCCAGCTACTGCTGTTACAGTATGATGAATGAAGAAACCAAGGACATGGACTC
GATTTTATGGGATATAAGAATGATCTGGTTTTATTTTGTTAGTGTTGTACATGCTGCCTG
TGTTCGTACCACACGGTACAGGTGTAGATCACCTCATGCCTATAATCTTGTTTTTTACTT
TTTTCAAGGAAATTTGGTTATGTTGATTTTGAGTCTGCTGAAGACCTAGAAAAGGCCCTG
GAGCTCACTGGTTTAAAAGTGTTTGGCAATGAAATTAAACTAGAAAAACCAAAAGGAAGA
GATAGTAAGAAAGGTATGTAAAAGAGTCTGGGTAACTCGGCACTAATGCTTAGGAGATAG
TCTTGTCCCCCTTTCTCCCTTAGTTTCATCCTCATTGTGAACCAGTGAAATGATGTGGAT
CATGTGATGACTGACAGATTTGATTCCTGGGATATGTCAGGGCTGGCAGGATGGTTAGTT
GAGTAAAGATGCTAGGTACAAAATTTGATCTCTACAAGCCACATGAAGAAGGGAAGAAAC
AGCGTGTTTCAGTGTACTAGTGCACATCCAGCACTCAGGAGGCAGAGGCAGGGGGATCTG
AGTTTTGAGGCCAAAAAACAAAGCAATTCTAGGACAGCCAGGACTATTAACGCTTTCAAA
AACTCCCAAGTTGTCATCTGCCTACATGTGTGTCATGGCATGCTTGAGGCTTACATATCT
CTTGAAATGAATTCTTGTTCTCTATTTTAAGTTTGAGAATGTGGACTTTGAAGTGTTTTC
TTATTTATACAATGTAATACATACAGTCTAGGGGAAATATATACATGTAAACAAGTAAGA
GGTGAGCCTCATCTGAAACTGGACAGAAGTTTGAGTCACCAGGTAGGTAGGTGACTAAGT
GCTGACGATTGGACATGGGTCCTCTTTGTGCAAAAGGCTAGTAACCATTGAGCCACCTCT
CCATCCCCCTTTTTTTAAAGCACAGATTCTTATCCTTTATAGGAGCTATTTGCTTTATTC
TCTTGTGACTTCTAAAATGATGTTCTTAAATCTTGTTTCAATATAGTTCGAGCTGCAAGA
ACACTTTTAGCCAAAAACCTCTCTTTCAACATCACTGAGGATGAATTAAAAGAAGTGTTT
GAAGATGCTGTGGAGATCAGATTAGTCAGCCAGGATGGGAGAAGTAAAGGGTATGTTTTG
TTCCTTTGAATGTTAAGTTTTATTAGCAGAATTTGAGTTTGTTGTTATCTTCTCCTACCC
TCCCCTTAATAATCTCAAGTAGTTTTCATAACCAGAAAAAAAAAAACAGAATACCTGGTC
CTTTGGCCTCCATCTCCCAAGTTCTGAAATTAAAAATGTTCAACTATTGGGTCTTGAAGC
TGTGATAAATTTTACAGCTGGCCTCAATCCAAATCGCATCTTTGGCCACCAGTACTATCC
TTGCCTATTATATGAGATAAACGTGATTCTAGGCAGTTCAGTCTATTATTGTATCTGCTT
TTTCTCCTCCTTACATAGGTGGCCAGCTTCAAGAATGATTTCAGAGGAGCTAATACAGTA
AAAGAACAGTAAAAGCTGTTTGGTCATAACCACCTGTTTCAGTCACATGCGACTTAAGTC
CTTATATCATAATATGCTTGAGTGACATTTTGTCTAATGTATTAAGTGAATTGTGCGTAT
AAACTCTTAATCTCTTTTAGGATTGCTTATATTGAATTTAAGTCTGAGGCTGATGCAGAG
AAAAACTTGGAAGAAAAGCAGGGGGCAGAAATTGATGGACGGTCTGTTTCACTCTACTAC
ACTGGAGAGAAAGGACAAAGGCAAGAGAGAACTGGAAAGAATAGCACTTGGAGTGGTAAG
TTAAGGTTTAATTGTATAGTGGGGGTGGGAATCATTTGCATCTTTGCTTCTATGTTTAGC
TAGAATTAATTCACCTTTGTTCATATAGCTCATGCTTAGTCTTCATGAGTGAAAGCTATT
TGAAATCATATCCGTTGGAGTGTAGTAGGCAAATACGGCTTTGTTGGGTATTTTTTCTGC
TTTAAATGGCTTAAACTATAATTTGGAAAAAAATGCTAGGAATCATCTAAGATTGTTACA
GTGTATGATGGGTTTACACTGTGGTGGTGTTGGTAGTCTTAGGATTATGGTATATGTGGT
CCATGGCTAAAGTGCCATTGTTTCAGTTAACATGTAGCCACCTTGTGTGAAATAGGTTAG
AAACATGCTTTATATGTGGTCCACTTACTGAGAGCTTTAATACACACAGACTTATTCTAA
CATGCATTGCTAATGTGTATCATTGTACTTACAGGTGAATCAAAGACTTTGGTTTTAAGT
AACCTTTCCTACAGTGCAACAGAAGAAACACTTCAGGAAGTATTCGAGAAAGCAACCTTT
ATTAAAGTGCCCCAGAACCCACATGGCAAATCTAAAGGGTAAAATAATTTTTATGTTACA
TGTGGGCTGTATATACTCCTACACAAAGAGTAATACTGTCCTATTAGCTAAAAAGAAAAA
AAAACTAACATTTTTAGCTATACAAAGGCTAAGTACAGCATTGGTAATAACCTGCTGATG
CCATGTGTTTCTAAGCTTTACTCTGAAAACTGATTTTTCAATCCTCAGGTATGCATTTAT
AGAATTTGCTTCATTTGAAGATGCTAAAGAAGCTTTAAATTCCTGTAATAAAATGGAAAT
TGAGGGCAGAACAATCAGGCTGGAGTTGCAAGGACCCAGGGGATCACCTAATGCGAGAAG
TCGTAAGTCCCTTGACATGTGTGACTTGGGTTGGGTGACATTTTGATTTTATGTGTATCC
ATGCTCACTTGGGGCTGGTTTTTGTTGTTGCTGAGTACATGACAACTGGATATGATGACT
GATTACCTGAGAAATAACTGATGAAATCTCAAGAAAATTCCTCTAGATAGTCAAGTTCTG
ATCCAGCTATGTCAGCTCAAAGCAGCAACTTTTGGATTTGATTGCCCTGAGTTCACTTAG
ATATGTCTGATCCAGTCTAATAGCTTTTACCTTAGTTTATCTGCATTAATTGCTTTTTCT
GGTAAAAACAAGAACATTGTACAAAATGGGTGTCAGAGATGACTGGCTCAGCAGTTAAGA
GGACTGACTACTTTGAGAGGATTTGGGTTCAAATCCCAGCATCCACATGGCATTTCACCG
TAACTCTTTTGGTTCTTTTTTTTTTCTTCGGAGCTGGGGACCGAACCTAGGGCCTTGCGC
TTCTACCACTGAGCTAAATCCCCAACCCCCTGTCTGTAACTCTTAAGATCTGACACCCTC
ATAGATAAAATGAATGTAGATAGACAAAACACCAATATGCACAAAAATTTTTTTAAAAAG
GAATCTACTTTAGCTGAAGGTGGCAGTACTTACCATGGGTTCATAGAGAAACCTGTAAAA
ACAGGCATTTTTTTCTCTTCCAGAGCCATCCAAAACTCTGTTTGTCAAAGGTCTGTCTGA
GGATACCACTGAAGAGACCTTAAAAGAATCATTTGAGGGCTCTGTTCGTGCAAGAATAGT
AACTGATCGGGAAACTGGTTCTTCTAAAGGGTAAGAAAGCATAGTGTTTCTTTTTAGTGA
ATTCTGCATGGAGAACTTGGGTCTGCAGTATCTTCTCATTGAGCTCCTTTCTGTCAACCA
GTGACAGATTATGGATTCGCACGAGAAGAAGAGAAAGTTCACAGAACTAGCACTTAATCT
TCTGTTTTTGCAGGAGATCTATTTGGCTGTTATGTGTGAGACATTCAGAGATAACTGGGT
CTCCAAGAGTACTTTCTGTATGGTCACTGTATTAGTCTATGTGGGTCACTTAGTGCTTAT
TGTGTTACTCTTAAAGGTGCTTGCTTAATTTAAAATGGGTGGTTTTTACTGTGTTTTAGG
TTTGGTTTTGTAGACTTTAATAGTGAGGAAGATGCCAAAGCTGCCAAGGAGGCCATGGAA
GATGGAGAAATTGATGGAAACAAAGTTACCTTGGACTGGGCCAAACCTAAGGGTGAAGGT
GGCTTTGGTGGTCGAGGTGGAGGCAGAGGAGGTTTCGGAGGCAGAGGTGGTGGCAGAGGC
GGAAGAGGCGGATTTGGCGGAAGAGGCCGGGGAGGCTTTGGAGGTAAAGAAGGAAAAGGA
ACTAGAACCTCCTTGAGGAACTACCTTGTGCGGGGAGGTCAGTTCCTAACTGTACCAGCC
TTTCATGATATTTTTCCTTCTGTAGGCAGAGGAGGCTTCCGAGGCGGCAGAGGAGGCGGG
GGAGACTTCAAGCCACAAGGAAAGAAGACGAAGTTTGAATAGTTCCTTCCATCCCATTCT
TTCCCTCTTCATTTTAAAGAAAGGACTCTGGAGTTTTTACTCTGTTACCTGTTGAATGAC
AGAGCCTTTTAAGGACATTCCAAGACAGTAAAGATCCTAAACTCTGTTGCCAGACTTAAT
ACTTCCTAGAGGTTACATTTGGATTGTTGCTTAAGAGCTTGACAAGACCAGCTCTGCCCA
GTGGGAATTGGAGTTGTGTTCCTACTGCTTTCCAGCTACAAATGTGGAGATTGGTTGTGG
GGGGCGGCTTCATGATTCTAATCTGGAAGATTTAATATTTCATTTGTACCTTAGATGGGT
GTGTTCTGTGTTGGAAATGCCATACAAGAGCTTGTGTGGTATATATTCTATTCCCAGAAC
AAGAAGAAAAGTATAGCATAATCTGAAATGACCTGGACAAGGTATGGTGGCACATGCCTT
TTTAACTCCACATGGGAGGGAGACGCAGGCAGATAAGAGTGAGGCCATCCTGATATACAG
AGTGAGTTCCAGAACAGCCAGGGCTGTTTGTTAGAGAAAGATCCTGTCTTGAAAAAGACC
AAGGGGAAAAAAAGATAACACAGGCAACCAACCAAATACAAGTTTTGGCCACTGAATACT
AAGTCTCAGCAGCCAGGTGTTAGTGACATAATCCAATCCCAGGGAAACAGCGGCCATCTC
TGAGTTCAATGCTGGCTGGGTCTGCAGAACTGAGTTGCAGGACAGTGAGGGATACATGGG
AACCCTGTCTTAAAATCCAAGAACAAAACCTGTCAAGTCTTAGAGAAGCTTTGGATAACA
AAATTTGTAAGTTGCAGCTGATTATAGTGTTCACCTAATTGCAGAGAGGGAACCCAGTGG
CCTTTTTGACTTGACTTAATAGGAAGTTTGTGCCAGAATAGAGGTCCAGTATAATTAGGA
ATACAATGGCCCTTGACCTTTGTACTTTGACTTCCAGTGGTCTATCAAGGATGTACTATC
ATAACTATTAGCATGAGGCATGGGTGCTTAGATACCTTAATAGAAATTATTTCCTAATAA
TTTTTCCATGTCCCACTCCGAACAAATTGACATTCAAGAAAGGTCAGCTATTGGGTGAGG
CCCTTTCTCAGCAATCCCAAAGGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1144, 2081..2197, 3391..3892, 4105..4293, 4395..4481, 4668..4809, 5288..5412, 6166..6289, 6800..6954, 7414..7537, 7728..7861, 8543..8669, 8999..9222, 9325..9525
1127..1144, 2081..2197, 3391..3892, 4105..4293, 4395..4481, 4668..4809, 5288..5412, 6166..6289, 6800..6954, 7414..7537, 7728..7861, 8543..8669, 8999..9222, 9325..9401
AC_000077.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved