Rattus_norvegicus Locus LOC365574
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus LOC365574
Rattus_norvegicus
LOC365574
9
SNORD51, SNORA41
2723..2800, 3062..3193
4988
GCAGTGGGACTCAGAGCTAACTTTTTAAGATTCACTTTTAATTTATGTGTGCATGTGCT
TGTCTCTGTGTGGTTATGTGCATTTATAAGTGCCGGTGCTCACAGTCCAAAAGAGTGGCA
AATTCCCTGTAACAAGGCAGTTGTCCCCCTTCTGACGGAGACAGTGGGAACCGAACTCGG
ATCTACTCTACAAGGCACTCTTAACCACTTGGCTATCTCTCCAACTCCGACTGAGCTTTT
AGTTTTTGTCATTCTCCCCGTCAGTGGAATGAATAAAATACTACCCAACATCATCAATGA
ACTGGACAAAATAAACAGTAGTGTGGGCAGTTTCAAGATAGCAACTAAAGAGACGCCTAA
TGTTTAAGTCTTTCCTGACACTGGGAAATGACCCGGTCTCCTCCAGACAGGGCCATCTCC
TGTCTTCCCCTGCAGAGAGAAAGTAGCTAGCAAGCCGGAACTCCCAAAGGTTTCCTGATC
ATCTTGCTTATGCTCCATCAGACCAGAAACTATGGCTAGTAACCTTCACCTGCCGGTTCT
CCGGGGTTCTGGAGGTGGCGGGGCAGGAGGTGGTGCCCAGTCAAGGACAAGAGGAGAATG
ACTTGTTTGACCTAAAGAACACAGTCCTGCTAAGAAAGAAAACACCACTCGAAGCACTTC
AACTTTCTCTCTTAAACGCGTCCTCACCTTTCCTCTAGAGCTCACCAAGTTGTCCCGCTG
ATTTGTCCGGATCCCCCTGACCCCTCAAAACCCAGCCGCTAAGTCAATATGGCGGCCACG
GCTAACTCCGTCAGCCTGACCTGGCGGACGGAAAGCCAGGAGGGACAACAAAGCCAGATT
CGACAATCTCCCCTCTTTGGACCTGTTCGGCAATTTCCGTCAGCACGAGAGGGAGCCGGG
AGAAAGCGGAGAAGACAACTTGGACCTGCAGTTCCGCCGGAAGTAGCCGAGGCCTTGAGG
CCGAATGCTTTCGTTCAACTCCGGCTCCTCAAGGGGCGTTTCCTTTAGTTTTAGAATCCT
TGGAGGTAGGCGTTTTAAAATGCATCTTTTATTAATTTCCTTCCAAACACAAGGAAAAGC
CCGCGGACGACCTGTGGGTCGTCTAATTCACAAGACGCAGTTTTACGTGAAGGAACGAGA
CTAGTAACGTACTTTGACCTTTAACCTCTAGCCGGTGCAGTGGAGGGAAACGCCTCCGTC
TCTATATAAGGACTTTTCCGGCCGGTCCCGGCCCTTTTTCTCCCTCAGCGCTGGCCGCGG
GCTTCTAGCGCTCTTTTCCTCCGCTCCCGGTTACAGTCGACGCCATGGGTTTCGGAGACC
TGAAAACCCCCGCCGGCCTCCAGGTGCTCAACGATTACCTGGCGGACAAGAGCTACATTG
AGGGGTGAGCCGGGAGCCCCGGGGGCCACGTGGCGCGGGCTCGGCGGGAGGGAAGCGGGT
CGCCGGAAACTAGGGGAAGCCGAGTTAGGTCTCCCGAGTCTCGGATGCCACTGGAGCAGG
ACCTCCCTGGAGGGGCTGCCAGCGCAATAATTGAAATAATGCTTGCTCTCCGTGTAACTA
CGTTCAGCCGGTTCTTCCGCGTCCTCTGACTAGTTAATTTAAACCTGTGGCAAGCCCGAG
GTAGCCTTTGAGTTCTCCCAAGTGGTAGAGAATTCTTGGCTTGTACAGATTGAAACATAT
TTTGTGCACTTCCGATTAGAAGCAATTTAGGTTAGCCCTGTAATAGTTCCCACTAGTAGT
TAGTTTGGCGGGTATGGGCTGTGTCATTTACCAGTTAGGTGTTTGTGTCTTTTCTTTTAA
AGGTGCGTGTACTTGTTTTTGTGTTACCTGCAGGTACGTGCCATCACAAGCCGATGTGGC
AGTATTTGAAGCAATCTCTGGTCCACCACCCGCTGACCTGTGTCATGCTCTGCGTTGGTA
TAATCATATCAAATCTTACGAAAAAGAAAAGGCCAGGTAAAAGTATCATTGTGCTACCTG
GATTTTCGCATGGCAAAGTAGGACCGGGGTTAAAGTTGCTTTAGCATTGTTGACCTAGTG
TAAACCAAATTTCTTTGTGACCTTAAATTAAGGCCAACAGACTGAAGTTCTCCATTTTCT
CACAGAACAGGTAGAACATGGACAGCTGCAGTTTACAATTTTCCCACACCTCATTAATGT
GTTTTGACCTGGGGGAGGGGCACCACTGGGTTGTGAGGGTAGCTGATTTAATTCCTGGCC
ATTCTTCTAAAACTAAAGAATGGAAGTGGGGATATATAATGAATCTCATTCAGATGTTCA
TTTTGGAAGAGTAAACCATTGAGTACTGAATACTATGTCTCCTTTAAAGTCAGGTCATTT
ACCTGGGGTTGTGCTAAGGTTAAGTAACCAGAAGAGATTGTGAGTTACTGGAAAGGAAGA
TTGTGTGTTTTGCCCAGAAAGAGCTTTGACACCAACCTAATGTTGTAGAATGCTTGTTTT
TCAAGCTTGCCGGGAGTGAAGAAATCTTTGGGCAAGTATGGCCCTGTCAGTGTGGCAGAT
ACCACAGGAAGTGGAGCAGCAGATGCTAAAGACGATGATGACATTGATCTCTTCGGATCT
GATGATGAGGAGGTATGCCTTTCTCTTTATACAAGTATATTGATAAGGCAGACAGTCTTT
ACAGCATGACTAACTGGTGCTGTAGCCACTGCCCGGACATGGATCCTGCCTTGGCTTTAT
TGTCTGCCTTTAAAAATTTATCACTGGGTACATGATGAATAAAATCGAATCACCATCTTT
CGGCTGAGCTCCTGATGGATTTGCTTTTTTCTGATGTCCAGTCATTTTTGTGATGACCTT
GTCACTACATTTAAGCAGAAGATAACCAACTTTGTGAAATGTTTTTTTCTCTGTACAGGA
AAGTGAAGACGCAAAGAGGCTACGAGAAGAACGCCTTGCTCAGTATGAGTCAAAGAAAGC
TAAAAGTGGGTAACTTACGGTTTATCTTCATTGTTAGTAATGTGAATGCCTTTGTCTAGT
GCTTGGCCTTAAAGTGGGTTTTCCCCCAGTTAAATTGAATGGGTCAATATTTTATTTACA
TCTTCCACAGCTACTGGTCTGCAGCTGTCTTTATGGTAGCAGTTGTAGCATTCCTCTGTG
GGAAAGAAACTGTTACACAATTTAATGCCTCTTTCTTAGCCACATAGAAAGAGGAATATG
CGTGACAGACACAAGGCGAGTTGTGTACGTTTTTGGCAAGAAGGTGGCCTGTTTCAAAAC
AAACAGATTTGACTTAATGGTGAAAATGTTGAGTATTTAGGTGTCGTTCATTTTTTCACC
TTTTTTAGAGCCTGCAGTTGTTGCGAAGTCTTCCATCTTGTTAGATGTGAAGCCTTGGGA
CGATGAGACAGACATGACGAAACTTGAGGAGTGTGTCCGAAGCATTCAAGCGGACGGCTT
GGTGTGGGGCTCCTGTAAGTGATGCTTGTGTTTGGGGGTTGGAATTTGGGCATCTTCAGT
TTTCCTATCACAAAGAGTTTCCTAACTTTTTTACCCCTTGATCTTTTTTAGCTAAATTGG
TTCCAGTGGGATACGGAATTAAAAAGCTTCAAATACAGTGTGTAGTTGAAGATGATAAGG
TTGGAACAGATATGCTGGAAGAGCAGATTACTGCTTTTGAGGACTATGTACAGTCCATGG
ATGTGGCTGCTTTTAACAAAATCTAAATCATCCTTAAGTCTGTGCACTTAAATAAAAGCT
TGAAAGATAACCCTTGACTCTTCATTTGCTGTGAGAAATGATATACTTTGTTTTGAAGAA
AAGGTGAAGTGGTGGGGACTTGGGCTAGAAAGAGAAATTTTGCTCAGCATTTCAAACCAC
TTGGGCCATGGTTATCCAGACCAACATGAAGTTGCCTTTTAGCCAACACTATCGTGTCAT
AGATATAACTAAAAAGAAGATAAAAAATGTGTTATTAAAAATTTAGCGGGGTTGGGGATT
TAGCTCAGTGGTAGCTCAGTGGGCCTTAGCAAGCTCAAGGCCCTGGGTTCGGTCCTTAGC
TCCGGGGGAAAAAAAATTAGCAATTAATTGTCACCCGATGTGTTCAATACCTTTTTGAAA
AGCAGAATGAATCTTGGGCCACTAAGCTGACTCCGAGGGTGCTTACCATTTGGTTCAATC
CCTAAAGATAGCGTTATGTCCTGAGAGGAACATTGTATAGGTTTATAAGGTGGTCAAGTG
TGGAGGTCTTTCCATTGAATCTGGAAATCTGAACCTAGAGCTGCAGGAAAGTGCTGGGAT
AAGCAGTGTGCTAAAAGCTACTTGTTGGAAACATTTGTGGGAGATCATACTGCTCAAGAA
GTACAGCATGGGGGGCTGGAGAGATGGCTCAGCGGTTATGAGCACTGACTGCTCTTCCAG
AGGTCCTGAGTTCAAACCCCAGCAACCACATGGTGGCTCACAACCATCTGTAATGGGAGC
CGATGCCCTCTTCTGACAGGCAGGTGTAGATAGACCACTCATATACATACATAAAACATC
TTTAAAAAAAAAGTACATCACAGCATTTCAGCTTTGTGTTAAAAATTTGGTACATACAGT
AACTAAATGTATTTACCATAATTTTTAAAGTTTGGGGTTTGTGTTCTGTGAGCCAGGTGG
TGGTAGTGCACATTTTTAAACACAACACTCAGGAGGAAGAAAAATGCAGACTCGTGGGTT
CAAGGCCAACCTGAGTTATAAAGTCCATGAGAGTTGTGTATACAAAGAAACATTGTCTTA
AAAACAAAGTTTTCTGTATTTTATAGATAGGACTCTAGAAGAATAATTCAGTTACTTCAG
TCAGACAGTACTCTTGCTCTCAGTCTGGTTTTATGTTGACTACCTTCAGTGAGGGAAGCT
TCACGTTCATACATAGATTCAATAAAACATGTACTAAGGAGAATATACTTCAACAGACCC
GTCCTAAAGTAGTAGAAATTTTTTCCAGGTTAGAATCATGAGGGCCAGCAGAGGGCAGTA
TTGTCAAAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1383, 1833..1955, 2465..2591, 2878..2944, 3308..3433, 3531..3719
1304..1383, 1833..1955, 2465..2591, 2878..2944, 3308..3433, 3531..3685
AC_000077.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved