Rattus_norvegicus Locus RGD1308469_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus RGD1308469_predicted
Rattus_norvegicus
RGD1308469_predicted
9
SNORA19
6382..6512
10027
CATATATAAGTAAAGTAAATTAATTAAATCTTTAAAAATGAAAAAGTATGGGGCTGGGG
ATTTAGCTCAGTGGTAGAGCGCTTACCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAG
CTCCGAAAAAAAGAACCAAAAAAAAAAAAAAGAAAAAGTATGAGATGAACAGCAAAATTC
CCCACTGGGAATGGTATGCATGTTTTTGCCTGCATGTATGTCGGTGTGTCTGGTGCCCGA
GGCAGAAGAGGTCATGAATCCCTTAGAATTGGAGTTACATATGGTTGGGAGCCACTATGT
AGGTGCTGGGAACCAACCATGGGTCCTCTAATAGCTCAACCATCTCTCAAGCCTTTAATC
CTCGTTGACATTCATCTGGTAATGAGCAGCTGGCGTTCTGAGTGGACTAGTTTCTTAATG
TGTGTCAACATGACGCACCAATCCTCGGGTACTTAACAATTCCTTGCAGAGTCCCACTGT
AGTGATGTGTAGAAGAGACACAGAGGAAATAGTCTCCTGCCCATAAGCCAAAGGTGTAGA
AGGATAAAGGCGGTGGCGACTCCTTCAAGTGCTGTTAATGGCATTGTCCTAGGCTAGAGC
ATAAAAAGGCACTGTGCAAGAATGTGGCAACGTGAGTAAATTCTGCGATACTTAAACAAG
TGAAATAGCTGAGATGAAAAATGAACCCTTTCTAGGCTCGACTGTTTACCCAACTTGTGC
TAATACTTTGTAAATCTCAAAGCGCCTCCTAGCGGCTACTGGGAACGCCCATATATTAAT
TGTACTGATAAGGAAACCCGAGGTAAGAAATTCAAAGGCTCACAGAGTAGGAGACACATT
TTTATTTCCCCAAATCCTCCACAAATAACCGCCACCCAAGTGTGAGCGCCAAGACGGTCC
CTCGAGACTCCGGGGATTAAAAACATCACAGCAGCAAGGCTGTCCACTTCCGTAGAGCCC
GTGCCGGAAGTGTGTCATCGGCGCTGTAGTGGAAGCTGCAGATGCATTGTGGGAAGCCTT
TAACTCGTTGACAGGCGGCCGTGTTCGAGGCGCTACATTCCTAACCGAAAAAGGCTGGAT
CTAGACGGGTGTCAGACTCTAGAAAACCTAGAAGGAATGTGACGGAAACTCCTCCAGTTT
TTGCTGGAATCAGGGCTAGCAAGACCATTTCTCAGAACCTCACAGCCGCTAAGGAATCTC
AGGCCGCCTGAGTCCTCCAGCGTGAGCGAGAGTCCCGTCTCTATGATCAAGGAGACATAG
AGGCGGGCCTCTCTACCCTGCCTGGTGAGACTGCGCATGAGCAGTAGCTGGAGCACTGGG
AAGATGGCGGAGGAAGGGTGAGTGTGTTGGTCTTTGAATCTCTCTAGTGGGGCTTTGAGA
ATCCGATGCCATCCCTTCTGTTTGTACTTTGGTGCTACAAAAGGATACTGTGGGCTGTGG
AAAGGAAAGAAAAAGGCTCCATATTACGCAATAAAGATGGGGACTGAAATACCGTAGGGC
TCCTCGACGGTGGATAGGACATCTGGGGCGACTTTTGATGCAGCGAGGAAAGGAACTGAG
GGGAGAGTGGCTGGAGAGTGCCAGAGTTTGGTTCGCTCAACTTGGCTACCATATGTTTTC
ACAGTTTCGTACACATAGTGTTATTCTTGATCCTATCCCCTCCCCCTACCATCTCTTCCC
CCCCCACCCCCTGTCTTCCACCAAGCTCTTTCTCCCCAAGTCTCCCTCCTACTTTCATGT
GTCTCCCCCACCTCACCCTAGCTTGACTAACTACTCTCTTGGTGGATCTGTAACAGCCCC
AACCCTTTGCGGGTTTTACTAGTGTTTCCTTGCCGCTAGTGACTGTGACAGGCTATAGTT
GTTAAAGCTCTATGGACCAAAACGAACCCAGAGACCAAAGGTTTTTGGGGACAAGTAATA
CAGGTCCATGGTGAAGACTGATCAGAAACCATAGGTCCCAGGAAGACCAGGATCTCGACT
TGGTTTGGAAAGCCCTGAATGTTGGTTTAGTAATTTTTGTTGATGTCAATTTTTCTTTAT
CAGGGAAAGAAAAAAGATCCCTTTGGTTCCAGAAAATCTCCTGAAAAAGAGGAAGGCTTA
TCAAGCGCTCAAAGCCACTCAGGCAAAGCAGGCTCTTTTGGCAAAGAGAGAGGTAAATCT
GGGAGCAAGGGAAGAGGGATATTAGGATTTGAGGTGGATGGATTTTACTAGAGGATGTTT
GTTGAACTAGATTTGTTAGCAGATCCCTCACTGGTTTCTCCCATATAGCAAAGATTTACC
CTACATCTTTCTGTGAGCAAAATGCTAGAATGGCGTTTAAGGGAAAAGTGAAGACATTTT
CTAAATTCATATTAAGTGGTAAAACACCAAATTTGGGAGAAAAAAGTTCTTGGTTTTTTT
TGTTGTTGTTGTTGTTGTTTTTTTGGGTTTTTTTTTGTTTTTTTTTTTTTTTGTTTGCTT
CTTAGACAGGGTCTGCATATACGGTTTGGAATACTAACAGATCAGTCTAATTCGACCTCT
GCAATGCTGAGATTAAACTGCCAACTGAACTGTGGCAATTTCTGCATTCTGGAAGGTTGA
GACAGGAGAATGGAGAGTTTGGCTGTACAGTGAGAACCCGTCTCAAACCAAAAGTATCTT
AACAATTTTTAAAGTTTATTTAGAGTCTGTGTATGTGTGGATTCTGCACATAGTATATAC
AAGATTTTTGAATGAAAAGAGAAGAAAACCCTCTTGTATTTAATGATTCCTAATCTAGTG
TTGGGTTTCATACACACTTGTTGTAAATGTTACCAGCATATAAACTTACAGCACAAAGTT
TTCTTCATAACGTCTTAAGCTTTCTCAGTTCCACCTTGGCTTCCTCGTGTGTCCCTTATG
TAGAGTTTTGCCCCCCTTTGCAGAACATGGGAGAGATGAGCTCTCTTTTTAATGGCTCCT
GGGTTGATTGTGGAAGGCAAGAGATGGTGATATTTGTCTTCTCTACCTTAGAGAAAAGGG
AAAGAATTCCGGTTTAGACGACTAGAATCTTTCGTGCATGATTCCTGGCGGCAGCAACGA
GACAAGGTGCGTGTCCGGCGACTAGAAGTGAAGCCGCGCGCTTTGGAGGTCCCTGATAAA
CACTCCTTGGCCTTCGTTATACGCATGGAAAGGTACAGTACCAGTGTGTTTCAGGGTCCC
GGGGGCAGATGAGCTTTTGGTTCAACTTTGATGTCTCTGTAGGGAGATAAAGCCTAACCT
GTTACAGTAGATTGTGTAGGATTCAGAGTTAGGACCACAGGTGACATAAGTTCAGTGACG
CAGACACTCAGGGCGAAGGTGGGGCTCTTACCCTTTCTAAAGTAGGAACCACAGCTTGAC
ACAAGACAGGAAAGTAGGCCAGGTTTAACCCCAACACTGAAGCACAGAGAGAGGACAGAC
ATGAAGAAGTTTAGTATCACTCATGGACATATGTCCTGTGAAGGTACAAGGTATGGTGCT
GGGAAGCCGTGTCCACACTTAGCAGGCTTCATAGCTGTCCTCACTCAAATACAGCTGTGC
ACCTCTTGGTGTAAAACCTCTGTGTTTAAAACTCTGAGCTCTGCTCTCTTCAAGCTTCCC
TGGTTCTGATGTCAGACTCAGATCTGCTGTGACTATGTTCCCTGCTTTTACTGCCTACCT
ACTGAAGCAATCTGGCTTCCTCGGGTAGACATACTTGACCATATAGCCTAGCATCCCCCC
CAACCCCCCAGTCCATCAGGAACTGTATCCTGTAGCACCCAGGGATTGCTCCACAAAATG
GGCCGAGGTCTGTTTCCAGCCTGCCTCCCACTGCTCTTGAGCTCTGAGGTGGATTCTATT
TAGCAGTCTTGGTGTCAGAGCTGCTTGCAAGCAGACCAGCGTAGACTGAGCTCAGACGCC
TGCCTGTTGGTTTCAGGATTCAAGGAGTGAGTTTATTGGTAAAGAGCACCATCATGAAAC
TTGGCCTGAAGAAGTTGTTCAGTGGCGTCTTTGTCAAGGTCACCCCTCAGAGTATGAGAA
TGCTGCGCACAGTGGAGCCTTATGTGACCTGGGGGTAAGTACCGTTTTCCCACGTGAATC
ACCTCGTTCTTTGAGTGTGTAAGACACACAGGGTATTGTCTTCCAAGGTTCATGCTGTGT
GTTGGCCATTTTGCTGTGGCCAGTCACCAGAAATAAAGAGCCTTAGAACCTGGGAAGGTC
AGTGATGCTGATAATGCCCCAAGTGTTTGGGACTTACTCGGCTGTCGGTTAAGAGAAGGT
AAAATGGGGGCTGGGGATTTAGCTCAGTGGTAGAGCGCTTACCTAGGAAGCGCAAGGCCC
TGGGTTCGGTCCCCAGCTCTGAAAAAAAGAACCAAAAAAAAAGAGAGAGAGAGAGAGAGA
AGGTAAAATGAATGACACAGAGATTAGTGCTTGAAGCCACCGTGATAGTGATCGTCGCCA
AGTGTGGTGGCTCACACCTACATCCCAGCACTTGGAGTCTGTGGCAGGGAGGTTGCTGTG
GATCCCAGGCCAGCCTGAGCCATTCTGCTGCAAGATGTTCTCAAAGAAAGAAAAACACAT
TTTAGAACTGAGCATGGTGTCTTGGGCCTCCCATCCCTGTACACCAAAGGACAGACATGA
AGAAGTTTAGTATCGCTCATGGACATATGTCCTGTGAAGGTACAAGGTATGGTGCTGGGA
AGCCGTGTCCACACTTAGCAGGCTTCATAGCTGTCCTCACTCAAATACAGCTGTGTACCT
CTTGGTGTAAAACCTCTGAGGCAGGAGGATTGCTGCAAGTTTGAGGCCAGCATAAGACCT
GATCTCAAAAAATGCCTAAGTTTCTAATTATATTCTTTTTTTTTTTTTTTTTTTTTTTTT
TTTTTGAAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCGCTCTACCACT
GAGCTAAATCCCCAACCCCTCTAATTATATTCTTAAGCCTGTGCTGGGCTTTTCAGTTGG
CTCACTTCAGACTCCTGTATAGATAGCTCACGACCCTCCGGCCTCTGTCTCAGGTGCTGG
AATTGCAGGCTTGAGCCACTGTGCTTTTCATTCTTCCTCTCAGTTGTCACTCAGTAGTCC
ACGCCCTGCCTGTGGGAGGTCCGGGTCGAGAGGCTGACACCTCTTCTCAGCTTGTTCTTA
ATGGCCAGTGTCTCTGTTGTGCCTTGTGTAGATTTCCAAATCTGAAGTCTGTCCGAGAAC
TCATCTTGAAGCGTGGACAAGCAAAGATTAACAATAAGACTGTCCCTCTGACCGACAACA
CAGTGATTGAGGAGCACTTGGGTGAGTGCTGCAGCATGGGGGTTTGGTGGCTGCTGGGAT
TTGGACCCAGGGTCTGTTCCTCACATTACAGGCCCAGCTTTTTTCCTGTGTACCGGCTAG
TAGTGAACAAGGGGATCGATACCCTCTTGTTTTTCAGGGCAGTTTGGTGTCATTTGCCTG
GAAGACCTCATCCATGAAATTGCCTTCCCTGGGAAGCATTTCCAGCAGATCTCTTCATTC
TTGTGCCCTTTCCACCTCTCTGTGGCCCGTCATGCTACCAAGAATAGAGTGGGCTTCCTC
AAGGAGATGGGCTCGCCTGGCTACCGGGGTGACCGCATCAACCAGCTCATCCGGCAGCTC
AACTAGAGCAGGAGCAGGTGAGACCGGCGTGTGCCACAGTACAGCCAGTGCTCCTGTTGC
CAAAGACTTTGAGAGGGGCTACGGACGGGGTGTGTGGGAGCGGAGGAACAGACTGCTCAC
AGTCAGTGCTGGGTCGGAGCTGTGGCCTTGCTCTACTCTAGACACCTTTTTCTTTGTTCC
GTCTTCTCCTAAGATCCCCAGGTGGCTCTGTTCTCTGCTTGAGACTGACTGGATAGCTCA
TCTCTTGCAGATGATAAGGACAACTCTATTTTACATATCAGTCCAGATGTTGACTCCAGG
TTTCCAGAGTCAGCACCCATAACCCCAGCTCCTTAATTTTCAGGAGACAGCAAATGGCTT
TTTTTTTTTACTTTGCAAAAGAGTTCAGAGGTCTGCCCACCTCTGTTAAGCACATACAAT
AAGCCAGCTGGTGGGATCCCATCACCATCTCAACCACTGCTGGGCCCAACCTTGCTCTGT
CTCCAGCTGACCCTGGACTTAGGAACCTGTCAGCTTTTGTCATCGTAAACAGTGGCAACA
ACAAAACCTTAGCTGGGTGGGGTCTGTGACCATCACTCCCTACATTTGTCCCCTTCTTTA
CTGTCTTTCTCACAAGTTGGCTTACAGTAGAGCTGCTTTTGTACCCTTAGGTTTGATAGG
CCCCTCCTGTAATTCATACTGCATCTTTACTTCTTGAGAAATTATGTTTTTTTTAAAGAT
TTGTTATTTTATGGGTATACTACTGCACATTCATTGACCTGCTTTCCTTTGACTGTGGGA
GCAGTGTTAATTCTTATGTGCTATACTAATAGTTGAAGGTTCATTAGCAGAGTAACTGCA
TATAGTAATTCTGCCAGTCCCCTTCAGACAAAAAGAAAGAGTATACTATATCCATCCTTA
GACACACCAGAAGAGGGCACCAGATCTCATTACAGATGGTTGTGAGCCACCGTGTGGTTG
CTGAGGATTGAACTCAGGACCTCTAGAAGAGCAGTCAATGCTCTTAACAGCTGAGCCATC
TCTCCAGCCTTAAATTAACATGTATTTGAACCATGTATTTAGAGTCCTTATCCACAACCT
TCAGGCTGTCCTGAAGATCAGGACTTTTTTTTTTTTTTTTTTTTTTTTTGGTTCTTTTTT
TTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGCAAGCGCTCTACCACTGA
GCTAAATCCCCAACTCCCGAGATCAGGACATTTTGCTGAGACATTAACCACACCTTCACC
TCCCAGACTCACGCTGTCTCAGATTACCATGGAATCATTAATGTTAACTGAGAGGACGTT
CCTGAAAAGTATAAATTATTATACAGACATTTATGCAAACAGGTCTTTCGCCAGTAGTGA
CCACCACACTTGTGGAAGCCCACACCTGCTGGCTCTGTCTCAAAGACGGGAGCCATGTCA
TTCTGTCCCCACCAAGGCCATGCCAGACCCAGCACTCTCCTTCATTGGTTCTGAGAATCT
TTATTTGGGTAGTCTTCATGGCAAGAAGTCTTACTTAATGAGCCATCTTGTCAGCACCGT
GTCTGACTTCTGGTGGGCTGTGCTGTCACCTAGAAGTCCCTGTGAGCTGGAGGTACAGTT
GGCTAAGGATGCAAGCTCGTAGACCTAGTACTGCAAGGAGAGAGCTTGTGTGTGCTGGAA
TTTGAGAGTCCTTGGAAGACAGGAACACGCGTGTTGACCTGTTGGGACAGACCCTAATAC
AGCTCTGACTGCTAGGTCACAGGCTAGAAACCGTCTGTGTTGCTGTGGACATTTAGCCTC
CAGTGGAGAAGAAATCAATCAGCTGATTTCAGAAAGACTGAAGAGCAGTTAGCTGGTTTG
TTGAAGGGGTCAGCCTGGAGCAGTATACCGCTATTGTTGCTCTCAGTCCTAGACTGCCAT
TGGTTTGTCGACACAACTGTGTTTTCCTTCCTTAGGTTTTCCAAAAGCATGAATTGGAAA
TGCTTTTGTTTGTATAAAATTACCAAGTATCTTCAGAGAAGATTATTTTCTGCCTTCAAA
AACTGAAGGAAAGGGCCAGGAGAACCACAGTAGGGTGTGCGAGCATCGAAGACATTTAGC
AGGGACCAGTTCATGGAACAGGGCGATTGTTCTCCAGTTGGCTGCCCGTCTCTGAGATCC
GCACAAGCTGTGGAGGAAAGAACTGCCCTGCCTTCCTTCCATCTCGGTGTTTAATGTTGG
GTGAGCGACTAGCCCAAGTATCCCTCCCACGCCCTCCAAGACTCTTAAAGCAGTGGGGCA
GACCAAGGGGCACACTTGAATCTGGATGAAGAGGGTCTTGGTTTTACTTTTTATTTTTGT
CAGAGATGGTTGGTTTGTTCAATACAACGTCTTCCTGTGTGGCCCTGGCTAGCCTTAAAC
TCCACAGCAGCCCTGCCTCCGCCCCGCCCTGAAACCCACGCCCACCCCCAGCTGTTGGTG
TATAAGCCTGGGGGCTTGTTCCTCAGGCAGAAAGGCAACAATGGTGGTGCTCAGTCTTAT
GTGAGGCCATGTTACAACCGCTTTGGGACCTCTGGGGCTTGCTGCCCTTGATCAGTGTAA
CAGCATTTGTACCCTGACCTGCAGTGACAGTCCTTTCCTGTAGCTCAGGATTTAGAAAAA
CACAAGCATAAATCCATACACTGTGCTTGGAACTCCACAACGGTGACACACACCCTCTTG
GCACACGGAAGTCTTTTGTGAGGACAGCCTGTTTTTCTATGCACATTGGTCTGTGAAGTT
AGTCTTGTTCTGTGCTACAGGAGGGGACTGAAGTTCAACCACTTGTTTTCAACTACGAAA
TAGTGTTTAGCTGGGCCTGATGGCACACACCTTTAGTCACAACACTTGAGAGGCAGAGGC
AGGCAGATCTCCTGAGTTCAAGGCCAGGCAAGCCTGTTCTACAGAGTTCCAGGATACCCA
GGGCTACACACAGAGAAAATATTAAAGACCAACAAAAACCAATGATATGAAAGACTATTG
TTTTTAAACTTCCCATACCCAGGAAACGCCCCCTAAACTTCGCCCTTGGCTTAAGGATTC
CCGTCTTGCCTTTCCTTAAAACCCACATGAGTCCACATTCCTAACACATGCTTCCCTTGG
GCTTGCCTATAACCCTGACTTCATGGGGCCTTGGGATATCAGTGGTAACTGTTGTAGGGC
ATTGGGAAATGAGGTGACCAAAAATGCATTGCAGTCTTGGAGAAATGAGTCCTGGATCTT
ACTAAGTTGGGGAGCACTGCAGTGTTGGTGGTGCTTGTCTGCTGTGTAAGAGCCCCTGGA
TGAGCTGAGCCAAGTCTTCCATTTCTAGTTGCTCAGAGTTTAAAGCAAGGGTTTTTTCTA
TATAGTAAAAGATGATTTTTAAAATTTATTTTTGTGTGTGAGTATGTGCCATCAGTGTGG
GTCCCAAAGTAGCCAGAAACTGTCCCCATGTCTTGGAGCTAGATATACTGACAAGTGAAG
GTTCCTGTGGGGGCTGGGGCCAATTCTAGGCCTTCTGCAGAAGCAAGTCCTCTTAGCATG
TGCCTTCGGGCCCCAAAGGTAAAGTGGTTTATTCTAAGCTTGGTGATGCCTGCCAGGCGG
ACCACAAATTCAAAGGTAGCTTGGGTTAAATAGACTGTCAAAAAAACAAGTGGTGTTGCC
CCCTAACAATGAGTTGAAACCCCCAAAACAAGACGTTCTGCTGTCCATATTGCTGGTTAT
CAGCCAGATGTACTAGCTACTTAACTACATGGATAGGCATTCCCGCAGCTAGCATACTGC
CTGCCATTTGGGTTTTATAGACTATGGAGAAACAGCCACTGAGCCTGTCTGAAAGACTAC
AGGGAAGCTTGGTGTGGTGTCAATGTGGAGGCAGACACAGATCCATGTAATAAAGGCCTA
TCAGACACTGCCCTCAAAATCAGACTTTAGGGGGCCCAAGGTCAGCTCTTGGTTAAAAGC
TGTTCACCCAGCCCCAAAGCATCTGACAGGGTTTCACAAGTCTTCTGGGGTAGGGGAGTG
GAAGGGCGACTCAGGTTAAGAGCACTGATGCTCCTTCAGAAATCCTGGGTTTAATTCCAA
ACAATTCTTTTCAGCCTTGGAGATGGCTCAGTGGGTAAGGCATCTGGCCAAACCAGAGCT
TAACTGGGATGTCTGGTGCATGATGGGAGGTGAAAGCCTACAAGGGGCACCAATTCTCAG
ATTGCCTCTGCTCGCACTACCTGACTTAGCTGTTCCAACAATCAGGATTTAAAAGATTTA
TGTGTAGAAGTACACTGTAGCTGTCCTCAGACACCAGAAGAGGGCATCAGATCCCTCTTA
CAGCTGGTTGTGAGTTATGTGTTTTGCTGGGAATTTAACTGCAAAAGCAGTCAGTGCTCT
TTTTTTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1336, 2043..2151, 2991..3151, 3916..4053, 5191..5300, 5437..5656, 7595..9027
1296..1336, 2043..2151, 2991..3151, 3916..4053, 5191..5300, 5437..5645
AC_000077.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved