Rattus_norvegicus Locus Rpl10
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Rpl10
Rattus_norvegicus
Rpl10
X
SNORA70
2563..2698
4211
TCCCTAGATTGTAACCTTATATGGGAGAGTAGTTAGTGGTTAGCTGCCAATCCTCCCAG
ACTCATCCAAGTGTACATTTTTGAATTCTTCATAGTAAAAGGGTGAGCTACAGCTTGTTT
TTCTTTTGGAACCTGGAGCAAAGGAACTCGGACTCTCCTACTAGGGCGTGGCACAAGGCA
TTGTGACCCTCCTCTGGCCAGCAGGAAGTAGTGATGTCGCCATCATCTTTGTCCAGTCTC
CAATCTCCCTAAGAACACATCTTTACCCAAGAATTAAGAGTGGGGCGGGCCCAACTAGTG
AAAAGGACCGCGATCTCCTACGGAAGATTTTAATTGGTCTCTTTTTTTTTTTTTTTTTTT
TGGTTCTTTTTTTCGGAGCTGGGGACCGAACCCAGGGCCTTGCGCTTCCTAGGTAAGCGC
TCTACCACTGAGCTAAATCCCCAGCCCTTAATTGGTCTCTTGAACTCAATCAAGCGCCTA
TCATGGTGCTCTTTGTTGGCTCTTCGATGCGGGTAGGAGCTTTGTGGGTGGGTCTCCAAT
CTCCCAGGTGACAAAAGAACTTCTGAGTCCCTACCATAGAGCGTTCGCGCCATTTCCTCT
AGACTTGAGGAAGCCCTGAACCAATAATCTAGAGCCCTGTAAGCAAGGGAACACCTCCGT
GACCGTCCAGTTCCACTGAGAAAGTCTTCTCTTTTCAAGTCTCAGAATATTGGTAGTCAT
TCCTTATAGCAAAACCTGTCAATGGCTCCCCGCCCAAAATGGCCAGGCGGAAGCTGATTT
CTCTTGCCGATGTGTCGAAACCCCATTCGCCAGCATGCGGCTCCCTATTCCGGTATTCAG
TCACCAATAGGGTCCGTGTATGTTTCGGTCCCGCCTGGTACACATGCGCAGAGCACCGCC
GCATCTATGATTTTAGTGTCTGATAGAGCGTCGACACCACCCCTTGGCTGGGACTCTATG
GTTCTTATACTGGAAGATAGGCCGCCTATATAAGGCATGCGCAGGCGTGGGAGCGTCTCT
TTTCCTCTGGCGCGGTGAGTGTGCTCAGTTCCTTAGTCGTTTACAGTGGTCTCATAATTT
TTTTTTCCTTTGGGACTTTTACACTTATTCTGTGTCTGTATTCTTACTTTGACTATTTCA
TTACAGCCATCGACGATCCTAGTTGTCATCATGGGCCGCCGCCCCGCCCGGTGGTGAGTG
TTGAACCCATACAATTTTCCTACTGTGAAAACGGAGGAAAATTTGCACTTCTTTCAAAAG
ACTTTTATGGGTGGACTCTCCGCTACTCAGTGACCCTGAAGTAAATCCTCACCCCGGGTC
TTTAATACTTTACTGGGAGCTTTGTCTTGTTGAGGCTGTGCGTGGCTTTACCAAGAACTA
GTTAAAGCGCTTGAGTAGAACTAGAAGCCTGTGTGTATGCATCCAACCCCACTGCCTCGC
AAATAAGCCTTTTCACAAAGCCTACCATACCATACTTCTTGATGACTTTTGTGTCCATCT
TTATTTCCCGGCCTTGAGCTCTGGTTTTAACCGGACACCATGGGCTGACCAGTCAATAAG
CGCCGCCTAGCTGCGTGTCCTGAAGAGGGCGCCATATTCTCCTCACATGGCTAAGGCGGA
TATTCTGTCACATGCTCTGAAAATTGTGTTATCTCACCTTACTCTGGTTAGAGGGTGAAC
TTGGTTCTTGATTTCTTTGTTGTTTTGTAATTTTATGTAATCTGCTTAATAGTTTCCTTA
GAATCAGTTTCCCTTCACGGAGACTAAATTCAGAGCTGGTTTAATCCTGTTGTCATCCTT
AATTACATCTGAGTTTCCTTCCTCCTGTAGTTATCGCTATTGTAAGAACAAGCCATACCC
AAAGTCTCGTTTCTGTCGTGGTGTCCCTGGTAAGTAATGACAAACTGCAAACTGGGTCAG
TGTTCTTGTCTAGTTCCCACTTGGGCACTCATACCACGTGTTTTTCAGATGCTAAGATCC
GCATCTTTGACTTGGGACGGAAGAAAGCAAAAGTGGATGAATTCCCACTTTGTGGCCACA
TGGTGTCAGATGAATATGAACAACTCTCTTCTGAAGGTAAGACCCCCCCTTTTTTTTTTT
TTTTTTGTAAGACCCCTTTTTTAATTGGTACTTTATTCTGTGTACACTCTTTACGTGGTT
GTATATTGTAATTTACCCGATTACATGACTACTCAGTCCTACTTCTATGGCATGCTGTTT
CACTGCTATTGTTTCCCCATTCAGCACTGGAGGCTGCCCGTATTTGTGCCAACAAATACA
TGGTAAAGAGTTGTGGCAAGGATGGCTTTCATATCCGGGTGAGGCTCCACCCTTTCCATG
TCATCCGTATCAACAAGATGTTGTCCTGTGCTGGGGCTGACAGGTAAGCTGTTGGAATCA
AGTAAGTTTTTGAGACAGGGTTTCTTTGTGTAGCCCTGGCTGTTCTGGGGTTCTGTGTAG
ACCAGGCTGATCTTGAACCCTGAGATTTGCCTGCCTCTGCCTCTGAGGTTATTAAAGAAT
ACCACTGTCTTACAGTATTTTGAGGATTTTTTGTTTTGTTTTTGTGCAGCTAATTAAGCC
GATCAAGTCCCTTTCCCCATGGGGACTTTGGTGTGCAATGGTTGCAAACAGCAGCCTCCT
TGGTAGTGTATGTAGCCTATTGTCTATATGGGTTACCTCAAGGGACCTTGGAAACAGTTT
TCTGGCAGTTGAATAATCAAGTGTCTGATCATAATTGCTGTCCCTGATCTAGGCTCCAGA
CAGGTATGCGTGGTGCCTTTGGGAAGCCCCAGGGCACAGTAGCCAGGGTTCACATTGGCC
AAGTCATCATGTCTATCCGAACCAAGCTGCAGAATAAGGAACATGTGATTGAGGCTCTGC
GCAGGGCCAAGTTCAAGTTCCCTGGCCGCCAGAAGGTAGGTGGTGGTATTTATTTAAGTT
CTGCTTTCTTGCTCTGGTACTCCTTGCTGAGTTTGTTATTTTTCATTTCCTTCTAGATCC
ACATCTCAAAGAAATGGGGTTTTACCAAGTTCAATGCAGATGAATTTGAAGACATGGTTG
CTGAGAAGCGGCTCATTCCTGATGGCTGTGGTGTCAAATATATCCCCAATCGTGGTCCTC
TTGACAAGTGGAGAGCCCTGCATTCCTGAAGGCTTCCACAGTGCTCTCCTATACCCTATC
AAATCATGTTCAATAATAAATCTCACATCAAATCTGCTTATGTATTTGTTTCTGATTCTT
TTTCTGTTTTTTTTTTTTCCAGAGCTGGGGACTGAACCCAGGACCTTGCGCTTGCTAGGC
AAGCGCTTTACCACTGAGCTAAATCCCCAACCCCCTATTTCTGATTCTTAAATACCATGA
AGTTTGTGACAACTTAGTGAAGTAAGCATACACGCAAAAGGTTAAAATTGGTGGTTTTAT
TGAACATTTTAAATGTAATACCAGTGCATGAAGATGTGGACATAAGAATTTTGAAGCAAG
CCTAGGGGATGTTTTTCCTAGTTTTTTTTTTTTTTCAGTGTGGACTCAGTGTGAGTTGCA
GAAATCTCTTAAGTATCATCTGAGCCCATTCCTACTGTAGCCTCCTTTGTCACTGGATTA
TCAGGCAAGAGAGCAGACTTATACTACCAGCACTGGCTTACCTAGGATAGCAAGCAGCAG
AAACTACATTAAAAAAGCTGTAGTTGACTTTCAGGTCTTGCTTCAGGAGACTACCAGTGG
TGGTCAATCAAGTCAATGGCTATCTAGCCCAGCTGAGATAGTGACAGCAGCAGTAGAGTG
GACAAACAGTGGGGTGGGATACCCTGAGCTGCCTTGTTCAGTTCCACTTCCACAGGATAA
TGGTCACTGACGCGAAGAGCCTAAGAGAACAAAACGTTCCGTGTCTGTGGCTGAGCTCAC
CTCCACAATTCTGCCCTCACTCTTGTGCCAACCCAGTTTCTCTACCTCTTCCTCAGTCAG
CTGAAACCTCCTGGGGAAGTCAAAGGTAGCTGCAGCCTTCAGCAGCTTCTGGCAACCCTG
CCCATGCATCACAATTCGGTCATAGGTACAGTTAGTGCTGGCCCGCACTGTAGTGTCCTC
CCCATCAGGAATCACCCAGTGGAAGCCTGCCTTAGTCCTGAGTAGCAGGCTGTTCAGACG
TTTCTTTGCCAGTGATGCACAGTCTGCATTGAAGTCTCCAAGCAGAATCACATTCTAAAG
ATGAGACAAGCT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1033, 1146..1192, 1830..1888, 1968..2075, 2244..2382, 2752..2914, 2996..3211
1170..1192, 1830..1888, 1968..2075, 2244..2382, 2752..2914, 2996..3148
AC_000069.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved