Rattus_norvegicus Locus Irak1_predicted
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Irak1_predicted
Rattus_norvegicus
Irak1_predicted
X
SNORA61
4865..4994
10997
CAAGTTCAGGTGGGTAGACAAGAGACTGGCTATGCCATCTTCCTAACAGCCATAAAAGA
ACTGGGATTCTAAGGGCTTTAGTGATTTGAACCTGAGGACAACGACATGAGCTGTGAGCT
CCACCCAAGCCATACAATCCATGCAGGTGAGTGGCGATGGCTAAGAGTAGTGCACTCATG
CAAAGGGGACTTAAAGAGAGCATAATGAGAAAGTACTATGTGCTGAGATGTGTGCCATAG
AGTGATCAAAAAGGCCAAAGAAATCCCTGAATGGATAACAGTAGAGGAGTGGGCAAGAGA
CACTCACATGGCTAAAAGTTACATCAGGTGGTGTCACCAACAACTGCTCTAGAAGGGGGT
AGGAGAAGCTGCTAGATCCTAGGGTCCTTATGGGGAGAAGTGCAAACTAAAATAAAAGTG
CAACAGAAAAAGAAAAGCTGACAACCGTGTATATGTTAAGAGACACAAATGTGTTAGTTG
GCAAGTTAGGATCCTGCACAGGCAGATTCTGTGATCTAACACTTTGCTGGCCCAGCTGCT
GGAAGGTTCCTGGAGGCAGAGGTGGGGGCACAGGGATCTAGCACACAAGCAGCAGCACTC
TTGGTATACACTCTTCCAGATCATTCTCAGGACATCCATCCTTACCACCAAATGATTAGA
GTCTGCCAGAGGGCTATTTTGTGACCCACATTTGACCCTGACTGAACAATTCGGCTGAGT
CTCCACTGCTCCCCAAGTAAAGCCAAGGGGAGCCTCTCTGTGGCTTTCACCGGGCTTGGC
ATAAATTGCCTTTGTAGAACATCGTGTAAAACATCATGCCCTTTGTCTCCAGAACTGGAA
ATCTTTCTTCATCCTGTTCAGCCTTATTCAGATGGTTCCCACTGCTGGAAGCCCGCCGTC
CCTGTAGAACCACAGCCTTCTGTTCTCCCACTAGGGACGCCCTCCTCCCTAGCAGAGCTC
CTTCCCGGAGTTAAGGGCCTCACGAGACGCCCCCGTGTGGCGGAAGGCCGCGGAGGGCAA
GATGGCGGCGGGCCGAGCGCCGCCTCTTCCGCCTGCCGGGTGTCGCACGAGGCCGGCTTG
AAGGGGAAGTGAGTCAGTGTTTGTGGACCGGGCTGGCTAAGGCCCGCGCCCGCCGAGGCC
CGGAGAGGCCTCGGCCCGGCGGCGGGGGCGGCGGCAACGGTCATGGCCGGGGGCCCGGGC
CCCGGGGAGCCTGTGGTTCCCGGCGCCCAGCATTTCTTGTACGAGGTGCCTCCCTGGGTT
ATGTGCCGTTTCTACAAAGTGATGGACGCCCTGGAGCCCGCCGACTGGTGCCAGTTCGGT
GGGTGACGGCAGGCCGACGTGGGGCGGTGGACCCAGGCTTCTGGAGCTGAAGCCTGATGT
TCCCCGTCCCGCAGCGGCCTTGATCGTGCGCGACCAGACAGAGCTGCGGCTGTGTGAGCG
CTCCGAGCAGCGCACGGCCAGTGTCCTGTGGCCCTGGATCAACCGCAACGCGCGTGTGGC
TGACCTCGTTCACATCCTCACGCACCTGCAGCTGCTGCGTGCGCGGGACATCATTACAGC
CTGTGAGCGAGCATAGCCCCAGGGACCCTAGGGATGGGAACCCAAGAGGGGTGACGGGTA
CAGAGCTTCCTGAGACAGGGGACCATATGGGAGCTCCCACACCCTACATATAAGGATAGA
GAGACCTGAGACACCACCCTCCTTTCCTTCCTTGTTATCCCAGGGCACCCTCCTGCCTCT
GTTCTGCCCCCAAGCACCGGTGCCCCAAGGCCCAGCAGCATCTCTGCAGGCTCTGAGACT
GAGGACTGGAGCCCCCGGAAATTGCAGTCCTCTGCCTCCACCTTCCTCTCCCCAGGTAAA
AAGAACCCGGGTGTTGGGCTTGATATGCGTGAGGAAAAGGCCACCATGAGTACTGACATG
GCTGTTGACTGCTGCTGGTCTCTGCCTCTCACTGCCATCTTTATGAAGCTTTTCCAGGCT
CCCAGACCCATTCTGAGTCAGAGCTCCTCCAGGTTCCACTCTCTGATTCCCTCGGGCCAC
CACTACAATCTTCAGCCCCCTCCTCCATCAAGGTAGGTGTCCCTTAACCCCCAGGGAAAT
TTCCAAAGAGGAAGAAACTTATCTTTGGTGTACCACAGAGCCCGAATCAGCACAGCCAGG
TCATCTAAGAGACAACTAGTGTTGAAGGGAGCTTTCAACCTGGACCAAGGGGAATAGACA
GTGTCCTCGCCTAATCCATGTCTCTTCCAGCAGCCAAGCCCAGAGAGCCCAGTGTCTGGC
CTCCAAAGAGCTCGTCCCTCCCCATTTTGCTGGCCCTTCTGTGAGATTTCCCAAGGCACT
TGCAACTTCTCTGAAGAACTCAGGATTGGAGAGGGTGGTTTTGGGTGTGTGTACCGAGCA
GTAATGAGAAATACTACATATGCTGTGAAGAGACTGAAGGAGGTAGGTATAACAGTGGGG
TAGCCACCTTGTTCGTCCAGTTCCTCCCTCCATCAGCACTTCACTTCTACAGTTCCCTGC
CTCCAGCCTCCCCCAGCAATTCCTTCAGCCCTGATTCCAGTTCAAGGACCCCAAGCCTTC
CATTGTTGTGGGCCTGGAAACAGCTGGCAAGCTTGGCTTATGCTGCCTACTTTCCCTACC
TCTTCCCCCACCATGCCTGGGGCTACAGGAGGCTGACCTAGAGTGGACTGTGGTGAAACA
GAGCTTCCTAACAGAGGTGGAACAGCTATCAAGGTGAGCCTCGGGGGGTCCCTCCAGTCT
AGGGGCACAAGGAGAGCCACACCAGGGCCTCATCAGTCTTTAGGGCTGCACAACACAAGC
TCTGGCTCCCTTGGGCCCTCAAGGCCTTGCCAGGCCCAGGTGAGGGAACATCAAGGGCTG
CCCACCCAAGCCTGGTCTGATGAAAAGTAATGGAACCCAGAAAACTAAAGAACTCAGACT
CTACTCTTTGGTAACAGGTTTCGTCACCCAAATATCGTGGACTTTGCTGGCTACTGTGCA
GAGAGTGGCTTCTACTGCCTTGTTTATGGCTTCCTGCCCAATGGCTCCTTAGAGGATCAG
CTTCACCTTCAGGTAGTCCTAGCTGATCTGGCACCATTACTAGCATAGCCCCTTAGCCTG
TGACAGGCAGGACTTGGGCTTCTGGCTCCCCTTCAAACTCAAGGTTTTGCCCAATGTTTT
CTTTCTTCCATTTTATTTGCTTTGAGACAATGCCTCACTACCCAACCCAGGCCAGCCTCA
AACTGGCAATTCTCCTAACTCAGTCGACTCTATGCTAGAATTATAGGCATGTACCATTAC
ACTCAGCTTGATCCAAGATTTTCCACACAATTCTTTCCTCTGGCCTCTCCTTACTGTTCC
TCTATTGGGAGTTATTGGCTTTATAAGCAGAGTAGCTAAAGGATTTAGTTCATGTAGCTC
TTGGGGAATGGGGACCAATGGAGACAGGCTGTCAGACTGAATCCAAGCTTGAGCCATGCC
TGAGTATCAAACTCACAAGCCACCACATATACAGGATAAGAACTTCCTTCTCAAACTGTT
TGGGAGAGGAGAGGGAGAAGGGCATCAGCATTTTCTGTGCAGTCAGGTGAACCTGAACCC
ATTGCATTTTGTCTTAAGTCCTGAGAAATGTTCCCTAGCTGTTATCCCAGCTGTACAGTG
TTTGCCAAAACCTTCGGAATAGCTTTAGCCTCCACTTGCTTGTGAATTAGGTCATAAATA
GTCTTGTTCCTCATTCTCCACAAAGGGAAACTAAGGCTCAGAATAAAGTGGATAGCTTGT
TCCAAGCCAGAGTGACAGATGAGGGGAGGTTGTGGGGATGGGAAGGGTCAAAGAACAGCT
GCCCCGAGATGCCCCTGTGCCTCCATCTTTGCCACTCCAGACCCAAGCCTGCTCCCCACT
TTCCTGGCCTCAACGACTGGACATTCTTCTGGGCACAGCCCGGGCTATTCAGTTTTTACA
TCAGGACAGCCCCAGCCTTATCCATGGAGACATCAAGAGGTGAGGAGGGGCTCAGAAGAG
CTATAGTCTTATGGCCAGGGAAACAGTGACCCCTGCTCAATGAACAGCTATGTTCTGAGT
GTCCCTGTGATATTCTTCCAGCCCTGTCCTGTGGATATAGGGACAGGTGTTGCCTGGGAC
CTCAGAGATGAGAATACTTAGGACTATAAGCAACCCTGCATGGTGCAGGTATAGAAATAT
ACCCCAGTGGTGAACAGAAGCCAAAACATGTGAAGGGGCTCAGGGACAGCAGGCCCTCAA
ACAGCTGGGATGCAATGCCAACTCTTTCCATAAGCAGTATGTCAGTTTGAGCCTCTAATC
CAGTTTATCAGGACCATTTAGGTGTGGGGGACAGAAAAAAAAGGTAGTAGGACCTGAACT
GGTGCCATTCTTCCCTTTGCAAGTTCTAATGTGCTTCTGGATGAGAGACTGATGCCCAAG
CTGGGAGACTTTGGTCTGGCTCGTTTCAGCCGCTTTGCAGGGGCCAACCCAAGCCAGAGC
AGTACTGTGGCCCGGACTTGCACAGTTCGAGGTACCCTCGCCTACCTGCCTGAGGAGTAC
ATCAAGACAGGCCGGCTGGCTGTGGACACCGATACCTTCAGCTTTGGGGTGGTAAGCCAC
CAGCCCTTCTGTTGGCCTGGGGAGGGAAAACCACCAGTAAGTAAAGGCAGGAAAGCCTAG
AGAATTCTAGGCCTAGGACAGAGGCAAACCTAGTGAAAAGTTAACATAACTTTGACCTTG
GGGTTCACCCTGCCTCATACACCTCCATCTTCCCTTGAGCTAAGTTATGTTCATAGTTTG
CATCAATTTGCTTCATATAGCCACTCTGAATTGTTTAAGCTTCAGTCCCATAACAATGCT
GTCTTACCCTCCTGTTTCCCTTTCCCATCGGATCTTGACACTGATCTTGGTGGTCCTTAA
CGAGGAAGAGTACACTGAAGCTGGCCTCACAGCGATGCAGCTTGGTGTAGAGCATCAGGC
CAGATTCGAACATGCCTAGGAAAAAAAGGAGAAAAAAAAACCAATGCTGGGGTTGGGGAT
TTAGCTCAGTGGTAGAGCGCTTGCCTAGGAAGCGCAAGGCCCTGGGTTCGGTCCCCAGCT
CCGAAAAAAAGAACCAAAAAAAAAAAAAAAAAAAAAAAAAACCAATGCAATGCTGTCTTT
GCTGGAAGGTGGTCTTTACCTGCCTGTCCCAGGACTGCTTTCCCATCAGCCCTGATCCAT
GCCCATGCTACAAGCCTCTTTTCTGTATACAATTTCTCCTGCTAAGGTGATGCTGTCCAT
CCCATCCCCTCTAGGTAATACTGGAGACCCTTGCTGGTCAGAGGGCTGTGAGGACACAAG
GTGCAAAAACCAAATATCTGGTAAGCCTCCTAAGGTGGGACATGGGGGGGGGGTGGAGGG
GCAGATGCAACCAGTGGGTACAGCCCCAGCCAGAGGGGGTGAATAATATAGATAGATCCT
TTACAGGGCCTCACAGTAGCCTGTTACTGTTGCTGCTGACTCACCTTTAGAAGTGGATGA
ATCCCCAAGCAGTTTCTTTTACCTTGCAAGGAAGAACCTGTCTTTATTCTGTACATAGGC
CTTGAGTATGGGATATAACCTCAGTGGTAGAGTGATTGCTTTATTGTATGCAAGGCCCTG
GGTTCTATCCCCATCAAAGGGGGAAAAACTGCCTTGGGCTGAGGACAGAGGGGGTTATTC
CTGATACCCTGGGACCAAACCTGCAATGGAACTTAGAGAAAGCAGGTCTGAGTAAAGGTG
GGAGATAGGCAGGCTGTTAAAGCAACAGCTCCAAGCTATCCTGACCTATACTCCTACATT
CCTGTCTGTCATGCTGTACACTGAAATAGGGCTAAGGAATAAGAGACCGAAAGCTTAGTA
TCTGAGCACATGATTTTGGTCCCAACATTCAAGAATCTGAGGCAGGAAGGTTGCTGGGAG
CTAGAGGCCAACTGGGGCTATATACCCTCTGTCAACAACAACAACAAAATTAGTTGATTA
TGGTGGCATATGTCTGTAATCCTAGCATTTGGAAGGTAGAAAGGGGGTAGGGTTCAGAAA
TTCAAAGTTATCTTCAGTTACATAGTAAATTCAAGGGCAGAGTAAGTTAACATGGTGCCC
TGTCTCAAACAAACATACAAAGAAGAGACAAGAGACCTGAGTTTTAGTCCCATCTATACA
GTGGCCATGGATCAAACTCCTGCTCTTCATTGAGCCTCAGTTTCCCATATAGAAAACAGA
CTTTAACACATGAACACTATTCCAGCAATTTCTGGGCCCAGAACATGCTTGGCTAATGCT
AGGTTGTCACCTTTTACAGAGTTGTACATCTCCTGTTGCTTCTCCAAGATGGAGCCTATT
TTTGTCTACTGTTGGGCTCAGTGGGGGAATTAACTCACCAAACAAACTGAACCAGATTCT
ACCCATCCCTCTTTCCTTTAACCTTTTACATCCATTAGCACATCCCAACTCAAATACTAT
TTGCTCAGGCCCCATGGACCTTGCTAGTAAGTTTATCAGCATCTATTTCCCCCGCTGCAA
TGGAATATCAGGACTGTAAAACAAGGCCCAGAGTGTTTGGTTTGTGGCTCTTATCAGTAG
AGCCCCAGACAGTACCAGGCACACAGTGGGTGTTTAATGAACCCAGGGAAAGGAGACGAT
AGGACTGAGTGGCAGTGGCCTGGAAGATTTGGCAGAGCCATGCTGACAGTATTTGTTCTA
CAGAAAGACCTGATTGAAGATGAGGCTGAAGAGGTGGGAGTGACCTTAAAAAGCACCCAG
CCTACTTTGTGGATGGGTGTAGCCACGGATGCTTGGACTGCTCCAATTGCTGCCCAGATC
TATAAGAAGCACCTGGACTCCAGACCTGGGCCCTGCCCACCCCAGTTGGGCCTGGCCCTG
GCTCAACTAGCTTGCTGCTGCATGCACCGTCGGGCCAAGAAGAGGCCACCCATGACCCAG
GTAGTCCTGGGGAGGCCAACTACCAATGGGGACATAGCGGCCAGCAAGAAAACTTGGGTA
CTTGCCCTCCTTGGTAGCAATAGCTACAAAGTGTCTACCTGATCTCTTTATAGAGGCAAA
ACTCCCAATGTCCTTGCTTCCCCTTTGGCTCTGTTTGGGGAGGCGCTCTTTGGAACTAAG
TGGTAAAGGGCTGCTACTTTGCTGGGTAGGGCTCAGATCCCAGGAACAGGTAGAAGGATA
TGGCTCTGTGTGGGGCACTGTGCCACTCACTACCTTTGTCTTTTTCACTTACCTGCCACC
TCTTCCGGTGATGGTTGAGAATAGAGTTCTGGGATTTGGTGGTCATGTATCTCAACAGTC
CTTGAGATGAGACAAAAGAACAAAGGGCAGTATTTTCCCAGCTGCAGAAGGTACCAGCTT
TGTGTTATCTGTCATTCCTATGGCTAAACACAGCCAAGTCTAAGCCAACCTGGAGCAGCA
GAATCGCTGTATGGTTTGACCACAGAGTGTCAGGTCTGGGCTGTCCTGTCCAGCCAGAAA
CCCATGTTCTGCCCATACTGAAAGGCTTTCTCTCCACACAGGTATACAAGAGACTAGAAG
GGCTTCAGGCAGTACCTCCCTGGAAGCTAGAGGTTGCCGGCCATGGCTCTCCTTCCCCAC
AGGAGAACTCCTACATGTCCACCACTGGCAGTGCCCAGAGTGGGGATGAACCATGGCAGC
CTCTGGTAGTGACCACAAGAGCTCCAGCCCAGGCTGCCCAGCAACTCCAGAGAAGTCCCA
ACCAGCCAGTGGAGAGTGATGAGAGTGTTCCTGGCCTCTCTGCTACCCTGCATTCCTGGC
ACTTGACTCCAGATTCCCACCCAAGCCCTGTGTCCTTCAGAGAGGCTAGCTGTACACAAG
GAGGCACTACCAGAGAATCAAGTTTGAGGAGTGGCCCAGGCTTCCAGCCTACGACCATGG
AAGGTAACTCTGGGGCTAGGATCTCCCTTCTTAGCCCTTCTTAAATACTATGCCTAAAGT
CAAAAGTGTAGAATTCTAAGCTCTGTCTACAGCCTGGGAGCCTAGTTTGGGATCTGATCC
CTCCCAGTCTGGGCCCCAGAATTTACTGGAGAATACTACCCTGCAACCAGCATCACAGGC
AGTGGGGGCTGGGAAGACTCTGGAGGCTATAGTGTCACTCAGGGTTGCCAGGGACAGCTA
AGAAGTTACTATCTCGGGGTTGGGGATTTAGCTCAGTGGTAGAGCGCTTGCCTAGCAAGC
GCAAGGCCCTGGGTTCGGTCCCCAGCTCCGAAAAAAAAAAGAAAAAAGAAAAAAAGAAGT
TACTGTCTCTGCCCAGGCTCATCGATGGGCAGTTCATCCCTGCTGTCATCAGAGCCACCA
CAGATCATCATCAACCCAGCCCGACAGAAGATGGTACAAAAGCTGGCCCTGTATGAAGAG
GGGGTCTTGGATAGCCTGCAACTGCTGTCATCAGGCTTTTTCCCAGGTACCTGCAGATGG
CTCTAGCTCAGCTTCCCCAAAAGAGCCTCCCACCACTGTCTTACATACATACAAACATGC
ATACATGCTCATACTCTGCAACTTCAGGGCACACAAGTACAATTCCTTATGCCAACCCTA
AACAACAGAGCATTTGTTCTGGCTGCACAATTAAACGCCCCACTCATTAAGAATAGAGCT
CCGAGCTTTTGCTCATTTGTAGGGAGATGCCTGGCTCAATCCCTTACTTCCCACTAATAT
CACAGTCCCTTCATCTGTGGGTACCAGTCTCCTTCCACGTGCTCCCAGAAAATGTGAAGT
CCTGTCAGGAATTTTCTACTCCAGGTACTATATGAAAAGCTGCTATTTAGAAAAAGAATG
CATTGGCTGGAGATAAGAGTGTGCCTGTAAAGGTCATCCAAACTAGGAGGTTGAGGAGAC
TGCTCAGTAGATAAGGCCATGAACTGCTTTTGCAGATGTCTTAGCTTTAGTTTCCAGACC
CCACATTAGGTAGTTCACAAATCTTTGTAACTCTAGTCCCAGAGGATCTGAGTTCCTCCT
TTGGCCTCCACAAATACCTTTATATATACATATGGTACATATAAAACTCATTCAGGCACA
CATATATACACACATATAAAAGTAAAAATCTTTTTTTTCAAAAAGCAAACTAACCAAAAA
GGAAAACCTTGGCTCCAAAGACTGCCTGGAGCTGGGCAGTGGTGCCACACGCCTTTAATC
CTAGCACTTGGGAGGCAGAGGCAAGAAGATCTCTAACTTTGGGGTCAGCTTCATCTACAG
AGCAAGTTCCAGGGCAACCAGATAGAAACTCACCCCACTCCACCCCGTCCCAAAAAAAGT
TAGGGTGGAGTAGGTTGTGGACTTAGCTCAGTGGTAGAGCACTTGGTTAGCAAGTGAAAG
GCCTGGGTTCCAGTCTCCTCCCACATGCTCAGTTGGGGGTGGGAGGGTGCCTTATAAGTT
CTATGGTCATGGTTCAGGTCAGGGCATTTGGAAGACAAGAAATTGTCCCCAACTTACTAA
GTGGTATTTCTTCTTCCATAGGCTTGGATTTAGAACCTGAAAAGAGAAAGAGACCTGAAG
AAAGTGATGAATTCCAGAGCTGATTTATTCACTCAGACTCAGATGTCAAAGTTCTCATTG
TTGGAAGTTCTCATGGTGTACAAACTCCTCAGTACCCCAAAGGCATCAGGTGTGGTGGCC
CACCCTGGCAAAGGAGAGAGGGTGGTGGACCCTGTTATTCTCATAATGTAAGCACAGACA
AGGCCAGCCAAAGAACCTGATAGAAGCTGATAAGGCTGGCAGTGTTGGGCCAGCATTTGT
GAGCAAGGCAAGCAGAGCACCTAAGGGATTGGGTAGTATATAACAGAAGACTGCTAGCTA
CACAGGCCCAGAGGACGCAAGTGGGTCTGTTTCTATGGTGGAGCTGGCTCCCCTGAGAGC
TAGACAGAATATCTGCAGCCTAACTATGAATCCATTCCTATGAACTTCCCTAGAACCCCA
AGAGAAAGAAGCTATTGTGCTTTTAAAATGCAAATAATAATAATAATAGTAATAATAATA
ATGAGTGTCTTACAGTTCAGTCCACTAGCTAAAAATGAGCACTCTGAGATTCTCCCAAGA
GTCCGAGTCCAGTAAAACCCCCATCACCATCTTGGGTGGGTATGTGCAAACCTTGGCACA
TACCAGTGAACTAGTTTCATGTGCCTACTGCCTGCTAGGCAGGCTGTTTCTAGACCCTGC
AATTGACTGGATGCTCAGATTGAGCTGTAGACCAAGGTTCTGCTTATGGCAGAAAGGTCC
AGCAAAGCCCAGCCCAGACAGTGAGAAGCCCCAAGAAATCAGAAACTGAGAGCAAAGCTA
AGTATTTGAGGAGGGAGGAATGTTACATTGTAAGAAACAAGTTTTTGTGTAACCAAGTGT
CTTCACAAGTCACCCAGGGTTATAGCCCAGGCTTACAGTGATTCTGTGTTCGAGTCACAC
TACATGCTCCTGTGAAATTGGTGACATCCAATTTGTCCTTGAGTAATAAAAGCATACATT
TCACTGTCTGATTAAACTTGTGGAATTTGTTGTACTAAAAGCTTTATGCTTTCCTAATGC
TTTATATCTCTGGGTTCTTAAGTTTCCTCCTGAAACTCAGGCCCCTGGAATTTGTTCTTT
TCTCTTGCCAAGCCCAGACTGGTGATAGATCCCCAATGCTGCTCCCCTTGCTTTCGTGTC
TTGCAGATTTCATGGATATTGATGCTATTGGAAATGATGTCTGAATTACTCATCAATCAT
ATATAGAAATTTAATTAAGTTTTGACTCTGATCTTTATTCTGTGACCTTACTTAAATGCA
CTTACTAGTCCCAATTGTTTTGGGGATGATTACTCTGGGATAGTTTGTATACAATCATCC
CATCTGAAAATAAAGACAATTTTACTTCATTGTCAACCTATATGCCTTTTAATTTTCTTT
TTAGAACTAACTATATAGCCCCGACTGTCCTTGATCTTGATATGTAGACCAGCCTGGCCT
CAAACTCCTGAGGTCTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1317, 1394..1561, 1723..1854, 1968..2071, 2253..2441, 2668..2732, 2957..3071, 3880..3998, 4403..4610, 5294..5359, 6723..6959, 7541..7922, 8296..8445, 9501..9997
1182..1317, 1394..1561, 1723..1854, 1968..2071, 2253..2441, 2668..2732, 2957..3071, 3880..3998, 4403..4610, 5294..5359, 6723..6959, 7541..7922, 8296..8445, 9501..9562
AC_000069.1
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved