Rattus_norvegicus Locus Mono:325:SNORA51
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:325:SNORA51
Rattus_norvegicus
Mono:325:SNORA51
2
SNORA51
1001..1133
2133
TTTCATGCAGGGACTGACTGTCTTGCCATCAGGACCAGGTACTAAATAGAAAGGTTAAG
TGTACCTAACTTGTGAGTTCAGGGAAGAAAACACACAAGTTGAATCAGTTAGATATAGCC
TGTCTGATAATAAATTATTTCTTGCTCAGATATGCCCTGAAAGATAGTATTCTAGTAACT
CGCTATATAAGGTATAATCTTATCCCTTCTAGAATATTTAGAAGACAAGCTTTTCCAAAT
GTCATGTGAACCAGTGAGCTTGTTTTGCTATCTAATGCTATGTTAGAAACATTCTTTTAC
TGTTACTACCTTTGTCACCTGAAGACAAAACTATTCTAAACATATAGTGCACATTGGGAA
AATGAATTAGACCTCGGCTTACATTCTGGTTCTACTAGTTAGCTATAGGACTTTGAGAAA
GTTACTTTAAGCTGTAATTTCCTGTTCTATAAAATGAGTATCACAATTCTGTACCCCAAA
TGTATAATAAGTTGTATTGAAATAAATATCAGCAGCATCTATCAACACACACGGTGCTGA
GTGGCTGTGGGTTTGCCTACAGCACTTTCCAACAAAAATCAGAAAGAGTGAACTCAAGGC
CATGTCACTGTGACTCATGTAGGACGTTTATAACTCATGAACTATTTTAAGACCTGGCAG
GTAGATATGCTCTTTTCGTTTGTACTTGTTTCTCATTCCTAAAGTTCAGGATCTGCTGAA
GCCTTTCTCTACTCCTCTCAGAATACAGAAACTTAAGTGGAAGCTCTCAGTTAAGATGAC
TACAAGGCATGCAGCAACACAAAAGCAGTTTTGTAGTCACAGTGCAGCGTGGGTAGGAAC
ACACAGACACACACACAGACACACATACAGACACACAGACACAGACACAGACACACACAC
ACACACACAGAGAGAGAGAGAGAGAGAGACAGACAGACAGACAGACAGACAGACAGAGGG
GTGGGGGCAATATCAAAAATAACACATAAGAACAGAGAATGAGCCTCCTTGTGCTTAGCA
CAGGCTGTGTTCCTACACTGACTGTATAGAAAGAGGAAGGAGAATAAAACTACCCTGTGT
ACACCTCAGCCTAGGCCACTGTGCCTGGTCTGTATTGTGAATGAGTAGACATGGGGGGAA
AAAAAACAAGAACAAAGAATGGAGGGAAGGTCAGGTCTAAGACATAGTTATGCACATCAA
CTTTTACAGCTAGTGAATGTCTGAATGGCTTTGAACATATTTAAAAGAAGGTCTGCAGGA
CTCAAAGTAGTACTTTTTCATCAGGCTTCGTTCGTATAATGGGCCTATAATTCCCACTAA
GCAAGAGCATGAGGTGGAGGACAGCAAGTTCAAAACTAGCCTGGGTGACTTGTGAAGTGC
CGTTTAAGATCATGCTTGCCAATTCTTTGAAGAGTTTCACTGTGTGCTATTGGGTGACAT
TGTTCATATCACATGTCCCAGCACATAGAATGTTCACTAAGTCTTTCAAATAAATGTTAG
TAAATCTCATTCATGTATCAATGAAAACAGAATCCAGTCCATGCCACCTGTGGATCTCTC
AGACATTCCCACCTCAACCTTGTTTCTGTGCCTTGTTGCTGTGTCCCAGCCTCCAAACTC
CAGCAGACATCCACTGCTCAATCATTGGTCATGCCTGCCAGAAGACCAGGTAGGCTGCCC
TGGGACTTTCTCTCCCGTTTCCTGAGGACCAATTCTCAAGGCTGCTCTTAGCATTGTAAC
AAACCATTCCTCATGGCCTCCTCTTTACCCAGTCTCTAACATTTCAAAGCATTCTATACA
AACATAGCAACTAAGTAGGCCAGTAAAACAGGTAAGACATAGCCAATACAGAAAACATAC
AGAGAGAAAACAAACCAAAACCAAAATAACTATTCAACAGAGACAAAACCAGCAATCCAC
ACCTAGACCTAAAATCACCCCAAACCCAGAGGCCTAGACACAAGTATAAGAACACAATCA
ATAACAACAAGGGTAATATAAATAATAAACCAGAGCCCACCTATCCTACCACAGGAGGTC
CTGATTATTCTAACATCTGAATACAAGATAAAGACTTTAAAACCAACTAACTATATGAAG
ATGATAGAGGTCCTTAAAGAAGAAATGAATAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved