Rattus_norvegicus Locus Mono:65:SNORA32
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:65:SNORA32
Rattus_norvegicus
Mono:65:SNORA32
8
SNORA32
1001..1119
2119
ATGAAGGAAATGTCCTTACATTACCCCACATGCTATGTACTCTCACATCTACTTTCCAA
CAGCCACGCCTTGAAATCCCTAACTTTAACCGTAATCTAATAGAACAAATTTCTATTCTC
TGTGCTAGGAATGGTTCTTCATTTCTTACCTTGATGAAAATACCCACCGTGTTTATCTCT
ACTGAAATATTTATATGTAAGATAAACCTTTTCTACATTCTTTCATGAAATAACTTAGTA
CTGAATGTATCTTTATGATTTACATCAACTTCAATAGGTATGAATAATTATGATTTTCTT
GTAAAATGTTTAATTTCAATAACCACACTTATTCTTAAGAATTTAAAATAATTTGCTTTA
CAGAAATTATGGTTGATTTAACCAAGTACATATTTTATGCATTGACCCCATTAACTTTTT
TAAACTGTCATCATGACTATGTGAGCACACATTCTCACATGCACAGTTTTTATGTTTTCT
TTATTCTCATTTCACTTTATTTTAATGACGTGGCATTATTTTGTCCTCATAATATGCAAC
CCACATTATTTTTACATATCTTATAAGAACACACATGGTATTTTCTGACTAAAGGAACAT
AGGTTCATTAATCAAAAATGTTGCACTCATTCAAAATAATGGAATTTGAATGAATTAAAA
ATAATTGTATTTATAATAATCCATATTTGATGAATTTCAAGTTTAAATATACTGCTAAAT
AGCCCTGCAAAACAAAATTATTGGATATGCAGAAGAAAAACTTAGATTTTTGAGAAGGCA
ATTGCATATGACAGGAACCACAATAGAATATGTGAATTATGACATCATTATTGCTCACTT
CAACCCTACAGTGCAGTAAAATAATATCAGGGTATAAAATTATTTGTAGCTTGGTGACCT
TTAGTAATTATCTCAGAGGCACAAAAATAATTAATTAGTAAACCAAAATTTTGTTCCTAG
AAATTCGACTTGACAGTCTAATTCCTAAACCAAGCTGCATTCTGCCCTTATAAAACTTTT
ATATCTAAAATACTTATTATATGGATATGACCATAAAGAAAAATTTCCATTAGATTTTCT
TTATGCTATTTGACTAGCACTTAACCAGTTGGGAACATCTGTTGATGAAAAAATAAAAAA
TAAAACAAAACAAAATTAAATTAAATACTTATTATAAAATAGAATAATAACAGTAATAAT
AGTAGCAATAAAATAGATCATTTATTGATTGATAAAAAGCCATTTTAAAGCTCTGAATAA
ACGTTATAATACTAATATTTATAAAGTAAATAAGATTTTGTTAATAATATATCAATAAGT
ATAAATTCAGAAAATAAATATGGATTGGGATATTAAAAAATCATTTATTTATTACAAAAC
TTTAGGAACGAGGAAGTGTCATGGTTCTTAAGGAATGTATGAAATGTCTTATGACAATTT
TGTAGCTAGTGCATACAGAAAAGTTAAGAGCAAGTTTAAATAATTGAGTAAGTATAAAAT
GAATATTTATGCTAAATAAAATATGAGGTTCAAAACATTATAAACATATAAAGTAAAATG
AGATTATTCTTGTCTAAGGACATCAAGGTACTGGGAAGGATCATGAACGGTCAAGAACAC
CCATCCAAAAACAAGAGTGTTAAGTCATGAGGGAATGGTGTCAGTATGAATGTTCTCTTA
ACATTTGTGTGTTTGTTAAGGAGAGAAACCTCTGGAATGGGAAGAGAAAATCACACAGAA
GTATCACAATTTCTCCTACTGGGTCTCTCAGATGATCCTAAATTTCAGCCTATTCTCTTC
GGGATGTTCTTATTTATGTATCTGATCACAGTGCTGGGGAACCTGCTCATCATCCTGGCT
GTCATTTCTGATTCCCATCTCCACAACCCCATGTACTTCTTCCTCTCCAACCTCTCTTTT
GTAGACATCTGTTTCACTACTACCACTGTCCCAAAGATGCTGGTGAACATCCAGACAAAG
AACAAAAATATTTCATACATGCAGTGCCTCAGTCAAGTCTATTTTTTTATGGTTTTTGCA
GGAATGGATAATTTCCTACTGACTGTAATGGCCTTTGACCGCTTTGTTGCCATTTGTCAC
CCCTTAAACTACACAGTCAT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved