Rattus_norvegicus Locus Mono:388:SNORA62
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:388:SNORA62
Rattus_norvegicus
Mono:388:SNORA62
18
SNORA62
1001..1156
2156
AGAAAGTGACTGTTCTGTATTAGCCAACTGCAGAACAGCATGACTCCAACCATACTGCT
CAGAATGAGGCATGAGAACTCTTCGTGATAGGAATGATCCCGGGGAGACTCCTGGTTTCT
TCTTTATGCCCTTACACTTGGCTCCTACAGAAGTAAAACCTTAGAGCCTGCAGAAATACA
TCGGATTGCGTGGTCATCAATTGGTCCTGAGACTCTAATTCTGTTTCTTTTATCCTCACG
TGAGGTTTGCCTTTAGCCAGAGGTCCAAAACAGCTAATAGAGCTAAGCAGTCCTGCTCAC
GGTGGATACCACTTGTCACTGACCCAGCACAATCAGTCTTGGCTCCAGTCTCTCTGGCAA
AGTGACCTGACAAGTTGCCAGAACTATGAAATTTCCTTCCAGGAGATAAATTCCTCACTC
TAGCTGGCATAGTCTTTAGCCTTTTTCTTCTCCCAGCATGATATCCCTGGAAAATGACAA
TTTCTTAGAGTCCATTGACTCAGTAGTCGAATAGCTGGAGAGGAGGACATAGGATCTCCT
TAGGATGTCTGCATCCCTGCCTTTGTACTTTACAGACTATGGCGATAAGCTATTGAAATG
TTAGACACCCATCTTCCATGCAGCAAGTCCTGTTTTAGTTAGTGGTGGTCTATAATCATG
TGCTAAAACTAGGAACAGACCCTAATAGACTTATAACAGGAGTTGCTGGGAACATGGTGT
AAAGTTGGATAAACTCATGGGGGACACTTTTCTCCATTTCTTTCTATGAGCCAGGTCTGG
AACTGAGAATATTTTCTCTACATCTTGAGATAAAAAAATATGATCCTTATTCAATGTATA
AAAGATGATGAAATTCAAATGGAAAGTTTAGTAATGTGTTGTGGTAAATATTAAAAAAGA
ACTCACCAACCCATGTTAGTGTTGGCTTCAGTGGGCCATGGCATTTGCTGGGTATTTTCA
TCTCAATCAGCAAAATGTCTCCACCCAATTCATTAAGTTTTCCTGCACACTATTAAAGCC
CAGGGTGGAGGCCAGTCTTGGCCAGTGAACTTCTGAATGTCGGAAGTATGCTACATTGAC
CCTACGGCAGGATTTTCGCTAACACCAGTAGAGCTTGCCTCTATGACTGGAGTTTGGTAG
TGGTCACTGCCACATACATAAAAAAGAAAAGAAAAGTTCCCAATTTCCATCCCACATTGC
CACTGGCTACTCTCTGGGGCCCTGCGGCAATCTCGTCATCTATCTAGTTCTCAAGGCCAG
TTCCACTCAGAGACAGCCTATCTCATGGCTCTCTTGTTTCGAACTCTGCTCACGGTCCCA
GCACCCACTCCCTGTGGTTATAGTCACAGCTCCCAGTAACCCGTTCAAATCAAAACTCAA
TAAGCTTGTAATTTATCAATCAGATTTATATCTTAAATTCTCACTCCACAAAACATCCAC
ACAATAAACTCGGGGCCAGTTAATATTGATATAAACTGCCCACCTAGATAAGACAAATCG
TCCTGTAAAATTCCATACCTTATAAAATATTCATAATTACCTGTGGCCCATTAAGGCCAC
TCAGATTTGGGTCTTCCTTCTTCTCCTCCATCTTGTTTCTTCCTCCCCTTTCTCCTCTCT
CCAAAACTCTGTGCCCACCTTACTTTTTCACTGCCCAATCACAGGCCTTGTCTTATCTTG
TGCCCGCCCTCACCTACATATAGTCTGCAATCTACAACAATGTGCTCTGCATAGTTGGGA
ACTGGGAAAAGAAGCCCAAGGACAATGGAAAAGAGCAAGGAGAAGTTGGAGTGTACTCAG
TTAGTGATGTGTTTGCCACACCAGCATGAAGCGCTACCTGAGATCAAGCTTGCTTTCGAA
ACGCCAGATGTGGTAGCGTGCACCTACCCAGCTGCTGAAGAGATACAGATAATTAAGTCT
CTGCCCTCAGTGGCCAACCAGCCTTGCTTAATCTGAAAACTCCAGACCAATGAGACATCT
TTAGAAAAGATGGATCACTCTAGTTGAACAACTGCCAAGGTACCTTTCTCTACAAACCAA
CACATGAGCACATGTGCACCCCTCCACACACACACACATACATGCAAACATGGAAAAAGG
TGAAATAAAAATTCTTTGAATGGTATCCGGGTCTTAAGTCCTGATATGAGTCCTTTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved