Rattus_norvegicus Locus Poly:24:SNORD116
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:24:SNORD116
Rattus_norvegicus
Poly:24:SNORD116
1
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1093, 4210..4302, 6773..6865, 9345..9437, 11924..12016, 14493..14585
15585
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNC
GGAAGGAGTGCTGAGAGAGCCCATGTGTTCCATAAATTAAGAACTAACAACAATGCATCA
CAGTCTCCATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACTT
TCAGGGACAGAGTCCCTGTCTCATACCGGACAAGGACGGCTTGCAGAGGAACTGAGTAGG
AACATCAGATGAAGTTGGAAGAAGCCTAACATCGCCTGCCCTGATGTCATCAGTTGAAGT
CTCTTGCCTGAGGATACCTGAATTGAAAGGTAGGAAACACTTGACTTTCCAAAGGAACTC
AAAGTGCTCAGGTGTTGATGGACTCGCAGGAATTCCCAACCTTGAATCATGATCCTTTGG
GACCTGGTTCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGGT
TCGTGGTAAAGGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATTTTG
AGTATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTTCCA
ATAAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCAATACCGCCACTATCAT
CGTGACTGAGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTCACATGGCCTCCA
TTCATCTTGCGAGACTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTTGCTTGCCTAA
ATCACCAGAAATCATGGCCTAAATCAAGGCTTCACCTTTTGCTCTAATGATAACATGCTT
TCCGGTTGAGGAGATCATTGTCAATATCTTGGAAGTTAGCCCTACCGACTCCATCAGCAA
TAATGTATAGTAGGTTGTGAGGCAAATGTAAGTTTAGTGGGGGCAGCATAGTTCAACAAT
GTACACTGGAATGTCAGGAAATGTGTTTCTGTCCGTGACTGCAGCCTTCTCATGAATGAT
AACCCTTCTGTTTCATAAAACAGAGATACATAACGGGAAGGTTACAGGCGACACGTCGAA
TGAGGCAGTAGCAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTGTGTGAAAACAAA
GCTCTGTTTTCTTGAAAGACTGATTGTGGCCATGGAAATTAGGTTGGAAAGAGAGCCTTG
GAATTTAAAAGGTTGGCATGTAGCCTTCTTGTCAGTGGATTCTAGAAGTGCATGCTTTCA
AATGTCCCAGGATTCATACCACCTTTTTGGATGTATGGAGAACGCCCATTTTAATCCTAG
TTTCTATGTTTATTGTTGGGACATTTTTTGTCAGTTTATCCGTGTAGTTTGCCAGCAGTT
CTTATGGATTGACTGTACCAAAATGATCTGGACATACATCTCCTCCTCTTCTAGGATCTA
AAAATTTGAGCATGCAAGTTTCTTTCTTACACACACTCCTTCTAGGAATTTTATATTTTG
GTATGGCCGTAGAAGATAGGCATGGTGTGTCTGTGGGATTATCTTTTCTTAAGGTTTTAT
TGGGGCCTCGCTGAAGGTTAACTTGGCATTTTGGCTATGTGTTTTGGGGCTGATGGTAGT
CCTGTTATCTTAGACATTGTTCTTTTCTCCAAGCAAATATCAACAAGAAATTGTTTTTCC
ATTTGATTATGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATATATCT
CAGTGACTACAGGTTATGCTTGTGTTTGGTGACCTGAGAGGGTTTGAACAGACACTTTCT
CTGTGGTGATCAATGTCAGATCCCACAGCAATAGCACTCACAGGAATTTCGTACCAGTCA
AAACCTGAATAGGAGATATATGAATATGGGCAGAGAAAGAGAGAAAGAACAATTGTTGAA
GAGGCTAAGCATGTGTGAGACAGAGGAAGACAGTGAGAGACAGTAAGAGAGAAAGGGGGG
GAGGAGAGATGGGGGTTGAAGTGGAAAAGAGGACACTGTGATATTAAAGCAGATATCTTG
ATTGACAGAAATAAGGAAACCAAATAGAGAGAATGTGAGTGAGAAACTGAGAAGCTAGGA
GAGTCACTGCAAGACAATTTCAGAGAGAAAGTGATGAAGCGAGATAGAGAAAGAGTACAT
AAGAAGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGTTCTCAT
CGATGGCAGAGTAGGACTAATAGGTGTAGTATGTTATGATTATGGAGGGTGCTCCGATTG
TGGCCAAAGCATTTAAGATTCTGGTGGTTTCCATGGGAAGAGTAAGGCCTGATTTTCTCT
GTCATATCCGGATAACTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNGTGACCTGAGAGGGTTTGAACAGACACTTTCACTGTGGTGATCAATGTCA
GATACCACAGCAATAGCACTCACAGGAATTTAGTACCAGTCAAAACCTGAATAGGAGATA
TAGGAGCATGGACAGAGATAGAGAGAAAGAACAATTGTTGAAGAGGCTAAGCATGTGTGA
GACAGAGGAAGACAGTAAGAGACAGAAAGAGAGAGGGGGGGAGAGAGGGGGGGAAGTGAA
AGAGTACACTGTGATATTAAAGCAGATATCTTGATTGACAGAAATAAGGAAACCAAATAG
AGAGACTGTGAATGAGAAACTGAGAAGCTAGGAGAGTCACTGCTAGTCAATTTCAGAGAG
AAAGTGAAGAAGCGAGATAGAGAAAGAGTACATAAGAAGTCCATTCATCTAATGTGGATG
AGAATCTTATATGATATTTGAATCGGTTCTCATCGAAGGCAGAGTAGGACTAATAGGTGT
AGTACGTTATGATTATGTAGGGTGCTCCGATTGTGGCCAAAGCTATTAAGATTCTGGTGG
TTTCCATGGGACGAGTAAGGCCTGATTTTCTCTGTCTATCCTGCTGAACTGAGATTTACT
TATTTTTGTAGACATCTTCCATTAAGCCATGTTAGTGGTCTCATTCTGTTGTGTACCTCG
TGCCAATTTCTTTGGATGGTTCTCAAGTGATGTACATACTACTGTAGTTTTCGGGATCAG
ATATTGGCTTCGTCCCATCTTAAGAACTTTGTTGCATGGTAACCTCCAGGAATTCGGTGA
TAGAATTGGGAAAATTATGTCCCCAAACAGTTCCTTGGAGGAAAAATATCTCTGATATGG
ATTGTGAGGGCAAATTTCTAGAGGACGGAAGGAGTGCTGAGAGAGCCCAAGTGTTCGATA
AATTAAGAACTAACAACAATGCATCACAGTCTCCATGATTTGCAAGGAATCCAATAAAGT
GGGGGAATGTGCTATTTGCTTTACTTTCAGGGACAGAGTCCCTGTCTCATACCGGACAAG
GACGGCTTGCAGAGGCACTGAGTATGGAACATCAGATGAAGTTGGAAGAAGCCTAACATC
GCCTGCCCTGAAGTCATCAGTTGAAGCTCTCTTGCCTGAGGATACCTGAAGTGAAAGGTA
AGAAACACTTGACTTTCCAAAGGAACTCAAAGTGCTCAGGTGTTGATGGAGCTCGCAGGA
GTTCCCAACCTTGAATCATGATCCTTTGGGACCTGGTTCAGGCTCACTGCCTGTGGCTAC
TCCTGTGATTGGAGAATAGGCCCATTGGTTCGTGGTAAAGGATGTGAATGTCTTGAATTC
TGTTCGCTCACCAAACCTGATCTATTTTGAGTATACTAAGTGTCATGGCAGGGGGTACAC
CAGCGTGCTTGGATCGATGATGATTTCCAATAAAACATTCCTTGGAAAGCTGAACAAAAT
GAGTGAAAACTCAATACCGCCACTGTCATCGTGACTGAGGTCCAGCTCCTGGGATCACAA
ATGTCACTGAGGGACTCACATGGCCTCCATTCACCTTGCGAGACTTGGATCCAGTGAGAG
AGCCTTCAGAATGTTCTTTGCTTGCCTAAATCACCAGAAATCATGGCCTAAATCAAGGCT
TCACCTTTTGCTCTAATGATAACATGCTTTCCGGTTGAGGAGATCATTGTCAATATCTTG
GAAGTTAGCCCTACCGACTCCATCAGCAATAATGTATAGTAGGTTGTGAGGCAAATGTAA
GTTTAGTGGGGGCAGCATAGTTCAACAATGTACACTGGAATGTCAGGAAATGTGTTTCTG
TCCGTGACTGCAGCCTTCTCATGAATGATAACCCTTCTGTTTCATAAAACAGAGATACAT
AACGGGAAGGTTACAGACGACACGTGGAATGAGGCAGTAGCAATTCTCAGGAACTATGGG
AATGTGGACTCTTCCTGTGTGGAAACAAAGCTCTGTTTTCTTGAAAGACTGATTGTGGCC
ATGGCAATTAGGTTGGAAAGAGAGCCTTGGAATTTAAAAGGTTGGCATGTAGCCTTCTTG
TCAGTGGATTCTAGAAGTGCATGCTTTCAAATGTCCCAGGATTCATACCCACCTTTTTGG
ATGTATGGAGAACGCCCATTTTAATCCTAGTTTCTATGTTTATTGTTGGGACATTTTTTG
TCAGTCTATCCGTGTAGTTTGCCAGCAGTACTTATGGATTGACTGTACCAAAATGGTCTG
GACATACATCTCCTCCTCTTCTAGGATCTAAAAATTTGAGCATGCAAGTTTCTTTCTTAC
ACACACTCCTTCTAGGAATTTTATATTTTGGTATGGCCGTAGAAGATAGGCATGGTGTGT
CTGTGGGATTATCTTTTCTTAAGGTTTTGTTGGGGCCTCGCTGAAGGTTAACTTGGCATT
TTGGCTATGTGTTTTGGGGCTGATGGTAGTCCTGTTATCTTAGACATTGTTCTTTTCTCC
AAGCAAATGTCAACAAGAAATTGTTTTTCCATTTGATTATGAAAGTGAGCTGTATGCTTA
GGATCATGCTGTTGATAATAACATATATCTCAGTGACTACAGGTTATGCTTGTGTTTGGT
GACCTGAGAGGGTTTGAACAGACACTTTCTCTGTGGTGATCAATGTCAGATCCCACAGCA
ATAGCACTCACAGGAATTTCGTACCAGTCAAAACCTGAATAGGAGATATATGAGTATGGG
CAGAGAAAGAGAGAAAGAACAATTGTTGAAGAGGCTAAGCATGTGTGAGACAGAGGAAGA
CAGTGAGAGACAGTAAGAGAGAGAGAGGGGGGGGGAGAGAGGGGGGTTGAAGTGGAAAAG
AGGACACTGTGATATTAAAGCAGATATTTTGATTGACAGAAATAAGGAAACCAAATAGAG
AGAATATGAGTGAGAAACTGAGAAGCTAGTAGAGTCACTGCAAGTCAATTTCAGAGAGAA
AGTGAAGAAGCGAGATAGAGAAAGAGTACATAAGAAGTCCATTCATCTAATGTGGATGAG
AATCTTATATGATATTTGAATCGGTTCTCATCGAAGGCAGAGTAGGACTAATAGGTATAG
TATGTTATGGTTATGGAGGGTGCTCCAATTGTGGCCAAAGCTATTAAGATTCTGATGGTT
TCCATGGGAAGAGTAAGGCCTGATTTTCTCTGTCATATCCGGCTGAACTGAGATTTACTT
ATTTTTGTAGACAACTTCCATTAAGCTATGTTAGTGGTCTCATTCTGTTTTGTACCTTGT
GCCAATTTCTTTGGATGGTTCTCAAGTGATGTACATACTACTGTAGTTTTCGGGATCAGA
TATTGGCTTCGTCCCATCTTAAGAACTTTGTTGCATGGTAACCTCCAGGAATTCGGAGAT
AGAATTGGGAAAATTATGTCCCCAAACAGTTCCTTGGGGGAAAAGTATCTCTGATATGGA
TTGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATACCGGACAAGGACAGCTTGCAGAGGAA
CTGAGTATGGAACATCAGATGAAGTTGGAAGATGCCTTACATCGCCTGCCCTGATGTCAT
CAGTTGTAGCTCTCTTGCCTGAGGATACCTGAACTGAAAGGTAAGAAACACTTGACTTTC
CAAAGGAACTCAAAATGCTCAGGTGTTGATGGAGCTCGCAGGAGTTCCCAACCTTGAATC
ATGATCCTTTGGGACCTGGTCCACGCTCACTGCCTGTGGCTACTCCTGGGATTGGAGAAT
AGGCCCATTGGTTTGTGGTAAAGGATGAGAATGTCTTGAATTCTGTTCGCTCACGAAACC
TGATCTATTTTGAGTATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGA
TGATGATTTCCAGTAAAACATTCCTTGGAAAGCTGAACGAAATGAGTGAAAACTCAGTAC
CGCCACTATCATCGTGACTGAGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTC
ACATGGCCTCCATTCATCTTGCGAGACTTGGATCCAGTGAGAGGGCCTTCAGAATGTTCT
TTGCTTGCCTAAATCACCAGAAATCATGGCCTAAATCAAGGCTTCACCCTTTGCTCTAAT
GATAACATGCTTTCCGGTTGAGGAGATCATTGTCAGTATCTTGGAAGTTAGCCCTACCAA
CTCCATCAGCAATAATGTATAGTAGGTTGTGAGGCAAATGTAAGTGTAGCGGGGGCAGCA
TAGTTCAACAATGTACACTGGAATGTCAGGAAATGTGTTTCTGTCCGTGTCTGAAGCCTT
CGCATGAGTGATAACCCTTCTGTTTCATAAAACAGAGATACATAACGGGAAGGTTACAGG
AGACATGTGGAATGAGGCAGTAGCAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTG
TGTGAAAACAAAGCTCTGTTTTCTTGAAAGACTGATTGTGGCCATGGCAATTAGGTTGGA
AAGAGAGCCTTGGAATTTAAAAGGTTGGCATGTAGCGTTCTTGTTGGTTGACTCTAGAAG
TGCATGCTTTCAAATGAACCAAGATTCACACCACCTTCATGGTTGTATGGAGAACACCCA
TTTTAATCCTAGTTTCTATGTTTATTGTTGGGATATTTTTTGTCAGTCTATCCGGGTAGT
TTGCCAGCAGTTCTTATGGATTGACTGTACCAAAATGGTCTGGACATACATCTCCTCCTC
TTCTAGGATATAAGAATGTGAGCATGCAAGTTTGTTTCTTACACACACTCCTTCTAGGAA
TTTTATATTTTGGTATGGCCGTAGAAGATAGGCATGGAGTGTCTGCGGGATTATCTTTCC
TTTTGGTTTTGATGTGGCCTTGCTGATGGTTAACTTGGCATTTTGGCTATGTGTTTTGGG
GCTGATGGTTGTCCTGTTATCTTAGACATTGTCCTTTCCTCCAAGCAAATATCAATAAGA
AATTGTGTTTCCATTTGATTATGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAA
TAACATATATCTCAGTGACTAGAGGTTATGCTTGTGTTTGGTGACCTGAGAGGGTTAAAC
AGACACTTTCTCTGTGGTGATCAATGTCAGATACCACAGCAATAGCACTCACAGGAATTT
AGTACCAGTCAAAACCTGAATAAGAGATATATGAGCATGGACCGAGAAAGAGAGAAAGAA
CAATTGTTGAAAAGGCTAAGCATGTGTGAGACAGAGGAAGACAGTGAGAGACAGAAAGAG
AGAGGGGGGGGCAAAGGAGAGGGTGAAGAGGAAAAGAGGACACTGTGATATTAAAGCAGA
TATCTTGATTGACAGAAATAGGGAAACCAAATAGAGAGAATGTGAGTGAGAAACTGAGAA
GCTAGGAGAGTCACTGCAAGTCAATTTCAGAGAGATAGTGAAGATGCGAGATAGAGAAAG
AGTACATAAGAAGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGG
TTCTCATCGAAGGCAGAGTAGGACTAATAGGTGTAGTATGTTATGATTATGGAGGGTGCT
CCGATTGTGGCCAAAGCTATTAAGATTCTGGTGGTTTCCATGGGAAGAGTAAGGCCTGAT
TTTCTCTGTCATATCCAGCTGAACTGAGATTTACTTATTTTTGTAGACAACTTCCAAGAA
GCCATGTTAGTGGTCTCATTCTGTTGTGTACCTCGTGCCAATTTCTTTGGATGGTTCTCA
AGTGATGTACATACTACTGTAGTTTTCGGGATCAGATATTGGCTTCGTCCCGTATTAAGA
TCTTTGTTGCATGGTAACCTCCAGGAATTCGGTGATAGAATTGGGAAAATTATGTCCCCA
AACAGTTCCTTGGAGGAAAAATATCTCTGATATGGATTGTGAGGGCAAATTTCTAGAGGA
CGGAAGGAGTGCTGAGAGAGCCCAAGTGTTTGATAAATTAAGAACTAACATCAATGCATC
ACAGTCTCCATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACT
TTCAGGGACAGAGTCCCTGTCTCATACCGGACAAGGACGGCTTGCAGAGGAACTGAGTAT
GGAACATCAGATGAAGTTTGAAGAAGCCTAAAATCGCCTGCCCTGATGTCATCAGTTGAA
GCTCTCTTGCCTGAGGATACCTGAAGTGAAAGGTAAGAAACACTTGAATTTCCAAAGGAA
CTCAAAGTGCTCAGGTGTTGATGGAGCTCGAAGGAGTTCCCAACCTTTTATCATGATCCT
TTGGGACCTGGTCCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCAT
TGGTTCGTGGTAAAGGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTAT
TTTGAGTATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATT
TCCAATAAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCAATACCGCCACTA
TCATCGTGACTGAGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTCACATGGCC
TCCATTCATCTTGCGAGACTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTTGCTTGC
CTAAATCACCAGAAATCATGGCCTAAATCCAGGCTTCACCTTTTGCTCTAATGATAACAT
GCTTTCCGGTTGAGGAGATCCTTGTCAGTATCTTGGAAGTTAGCCCTACCAACTCCATCA
GCAATAATGTATAGTAGGTTGTGAGGCAAATGTAAGTTTAGCGGGGGCAGCAGAGTTCAA
CAATGTACACTGGAATGTCAGGAAATGTGTTTCTGTCCCTGTCTGAAGCCTTCGCATGAA
TCATAACCCTTCTGTTTCATAAAACAGAGATACATAACGGGAAGGTTTCAGGCGACATGT
GGAATGAGGCAGTAGCAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTGTGTGAAAA
CAAAGCTCTGTTTTCTTGAAAGACTGATTGTGGCCATGGCAATTAGGTTGGAAAGAGAGC
CTTGGAATTTAAAAGGTTGGCATGTAGCCTTCTTGTTGGTTGACTCCAGAAGTGCATGCT
TTCAAATGAACAAAGATTCACACCACCTTCATGGTTGTATGGAGAACACCCATTTTAATC
CTAGTTTCTATGTTTATTGTTGGGACATTTTTTGTCAGTCTATCCGGGTAGTTTGCCAGC
AGTTCTTATGGATTGACTGTACCAAAATGGTCTGGACATACATCTCCTCCTCTTCTAGGA
TATAAGAATGTGAGCATGCAAGTTTGTTTCTTACACACACTCCTTCTAGGAATTTTATAT
TTTGGTATGGCCGTAGAAGATAGGCATGGAGTGTCTGCGGGATTATCTTTCCTTTTGGTT
TTGATGTGGCCTTGCTGATGGTTAACTTGGCATTTTGGCTATGTGTTTTGGGGCTGATGG
TAGTCCTGTTATCTTAGACTTTGTTCTTTTCTCCAAGCAAATATCAATAAGAAATTGTGT
TTCCATTTGATTATGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATAT
GTCTCGGTGACTACAGGTTATGCTTGTGTTTGGTGACTTGAGAGGGTTTGAACAGACACC
TTCTCTGTGGTGATCAATGTCAGATACCACAGCAATAGCACTCACAGGAATTTCGTACCA
GTCAAAACCTGAATAGGAGATATATGAGCATGGACAGAGAAAGAGAGAAAGAACAATTGT
TGAAGAGGCTAAGCATGTGTGAGACAGAGGAAGACAGTGAGAGACAGTAAGAGAGAGAGA
GAGGGGGTGGACAGAGGGGGGGTGAAGTGGAAAAGAGGACACTGTGATATTAAAGCAGAT
ATCTTGATTGACAGAAATAAGGAAACCAAATAGAGAGAATTTGAGTGAGAAACTGAGAAG
CTAGGAGAGTCACTGCAAGTCAATTTCAGAGAGAAAGTGAAGAAGCGAAATAGAGAAAGA
GTACATAAGAAGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGT
TCTCATCGAAGGCAGAGTAGGAGTAATAGGTGTAGTATTTTATAATTATGGAGGGTGCTC
CGATTGTGGCCAAAGCATTTAAGATTCCGGTGGTTTCTCTGGAAATAGTAAGGCCTGATT
TTCTCTGTCATATCCGGCTGAACTGAGATTTAATTATTTTTGTAGACAACTTCCATTAAG
CCATGTTAGTGGTCTCATTCTGTTGTGTACCTCGTGCCAATTTCTTTGGTTGGTTCTCAA
GTGATGTACATACTACTGTAGTTTTCGGGATCAGATATTGGCTTCGTCCCATCTTAAGAA
CTTTGTTGCATGGTAACCTCCAGGAATTCGGTGATAGAATTGGAAAAATTATGTCCCCAA
AGAGTTCCTTGGAGGAAAAATATCTCTGATATGCATTGTGAGTGCAAATTTCTAGAGGAC
GGAAGAAGTGCTGAGAGAGCCCATGTGTTCGATAAATTAAGAACTAACAACAATGCATCA
CAGTCTCCATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACTT
TCAGGGACAGAGTCCCTGTCTCATACCGGACAAGGACGGCTTGCAGAGGAACTGAGTATG
GAACATCAGATGAAGTTGGAAGAAGCCTAACATCGCCTGCCCTGATGTCATCAGTTGAAG
CTCTCTTGCCTGAGGATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGGAAC
TCAAAGAGCTCAGGTGTTGATGGAGCTCGCAGGAGTTCCCAACCTTGAAGCATGATCCTT
TGGGAACTGGTTCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATT
GGTTCGTGGTAAAGGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATT
TTGAGTATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTT
CCAATAAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCAATACCGCCACTAT
CATCGTGACTGAGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTCACATGGCCT
CCATTCATCTTGCGAGCCTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTAACTTGCC
TAAATGACCAGAAATCATGGCCTAAATCAAGGCTTCACCTTTTGCTCTAATGATAACATG
CTTTCCGGTTGAGGAGATCCTTGTCAGTATCTTGGAAGTTAGCCCTACCAACTCCATCAG
CAATAATGTATAGTAGGTTGTGAGGCAAATGTAAGTTAGCGGGGGCAGCAGAGTTCAACA
ATGTACACTGGAATGTCAGGAAATGTGTTTCTGTCCCTGTCTGAAGCCTTCGCATGAATG
ATAACCCTTCTGTTTCATAAAACAGAGATACAAAACGGGAAGGTTTCAGGCGACATGTGG
AATGAGGCAGTAGCAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTGTGTGAAAACA
AAGCTCTGTTTTCTTGAAAGACTGATTGTGGCCATGGCAATTAGGTTGGAAAGAGAGCCT
TGGAATTTAAAAGTTTGGCATGTAGCCTTCTTGTCGGTGGATTCTAGAAGTGCATGCTTT
CAAATATCCCAGGATTCATACCACCTTCATGGATGTATGAAGAACAACCATTTTAATCCT
ACTTTCTATGTTTATTGTCGGGACATTTTTGTCATTCTATACGGGTATTTTGCCAGCAGT
TCTTATGGATAGACTGTACCAAAATGGTCTGGACAAACATCTCTTCCTCTTCTAGGATCT
AAGAATGTGAGCATGCAAGTTTGTTCCTTACACACAGTCCTTCTAGGAATTTTATAATTT
GGTATGGCCGTAGCAGATAGGCATGGTGTGTCTGCGGGATTATCTTTCCTTATGGTCTTG
ATGTGGCTTTGCTGAAGGTTAACTTGGCATTTTGGCTATGTGTTTTGGGGCTGATGGTAG
TCCTGTTATCTTAGACATTGTTCTTTTCTCCAAGCAAATATCAACAAGAAATTGTGTTTC
CATTTGATTATGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATATATT
TCAGTGACTACAGGTTATGCTTGTGTTTGGTGACCTGAGACGGTTTGAACTGACACTTTC
TCTGTGGTGATCAATGTCAGATACCACAGCAATGGCACTCACATGAATTTAGTACCAGTC
AAAACCTGAATAGGAGATATATGAGCATGGACAGAGAAAGAGAGAAAGAACAATTGTTGA
AGAGGCTAAGCATGTGTGAGACAGAGGAAGACAGTGAGAGACAGAAAGAGAGAGGGGGGG
GAGAAAGGGGGGTGAAGTGGAAAAGAGGACACTGTGATATTAAAGCAGATATCTTGATTG
ACAGAAATAAGGAAACCAAATAGAGAGAATGTGAGTGAGAAACTGAGAAGCTAGGAGAGT
CACTGCTAGTCAATTTCAGAGAGAAAGTGAAGAAGCGAGATAGAGAAAGAGTACATAAGA
AGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGTTCTCATCGAA
TGCAGAGTAGGACTAATAGGTGTAGAAATTTATGATTATGGAGGGTGCTCCGATTGTGGC
CAAAGCATTTAAGATTCTGGTGGTTTCTATGGGAAGAGTAAGGCCTGATTTTCTCTGTCA
TATCCGGCTGAACTGAGATTTACTTATTTTTGTAGACAACTTCCATTAAGCCATGTTAGT
GGTCTCATTCTGTTGTGTACCTCGTGCCAATTTCTTTGGATGGTTCTCAAGTGATGTACA
TACTACTGTAGTTATCGGGATCAGATATTGGCTTCGTCCCATCTTAAGAACTTTGTTGCA
TGGTTACCTCCAGGAATTCGGTGATAGAATTGGGAAAATTATGTCCCAAACAGTTCCTTG
GGGAAAAAATATCTCTTATATGGATTGTGAGGGCAAATTTCTAGAGGACGGATGGAGTGC
TGAGAGAGCCCCTGTGTTCGATAAATTAAGAACTAACAACAATGCATCACAGTCTCCATG
ATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACTTTCAGGGACAGT
GTCCCGGTCTCATACCGGACAAGGACGGCTTGCAGAGGAACTGAGTATGGAACATCAGAT
GAAGTTGGAAGAAGCCTAACATCGCCTGCCCTGATGTCATCAGTTGAAGCTCTCTTGCCT
GAGGATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGGAACTCATAGTGCTC
AGGTGTTGATGGAGCTCGAAGGAGTTCCCAACCTTGAATTATGATCCTTTGGGACCTGGT
CCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGGTTCGTGGTA
AAGGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATTTTGAGTATACT
AAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTTCCAATAAAACA
TTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCAATACCGCCACTATCATCGTGACTG
AGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTCACANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved