Rattus_norvegicus Locus Mono:249:SNORA64
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:249:SNORA64
Rattus_norvegicus
Mono:249:SNORA64
3
SNORA64
1001..1137
2137
TAGACGCACTTGAGGATTTCTCCCACAAAGGAACTTTACATTTTTTTTCTCCTGCGTTT
GGATTCTGAAGATTATTGATGTAAGAATAGCCACATGAATAAATTCAGACATATTTAGGG
GGACTCTGAGGAATGTCCTTCCCTCGTTCTTGATATTTCATGTACCTTTGAATCAGCTTA
AGGAGAACTAGTTCTCTGCTCCTTCTGTTTAAATAACACATTTCTGCATCTCCATTGTCT
TTGTGATTAGTCTTGAAACCCACGTCAGGAATGACCTGTCTTAAATTGTTTGCACATCTA
GTGGCACATCTCCATAAAATCCTTAGCTGGCTCCATGAACCTTTATTCGACCGATGCTGT
TCACCCAAACCCAGCATCTCAGAAAAAAATTCTCGGCCCTGAATTAGTCATTGACTTCTA
CGTTAAAGTTAGTTTTCTGGACTCAGACAACTGAAATGAGTGCATTTGTATCCTTTCCAT
GGCTTGAGCATATCTTTCAGGTAACCGACTTTCTTACTCCTTTGGACCCAGTGCTCCAGC
AGACACTGAGAGTTGTCTGCACTGGCTGCAATAGTAAAGACATCTACTGAGATAAAGGCG
CTGTTGGTATAGCCTGATGTGGAATAGGTGTATCTCTTCCCGATAGGAAATGGATATTTG
TGCTGCCTCCTAAAGTTTTCTATCCCCAGAAAGACAAGAGGGCTCTGCCTGATGGACACA
TATGCTTCTAAGGCTACCCTTGATAGTGTTTATATCTGGAAATGGAATCTAGGAGGGGTC
TGTGAATGAAGGCATTGACCTATTTCTTGTAGCTTAGCTTTTCCAATGAGATATTCCCCC
AAACCCACCTAAGCAGTGAGTATTCATCTCAGAGATTTACTTACACCCTTTTAAAAACTG
CTTTTCACTGTTAGGGATAAACCCAGGACCGTGCATATCCTATATTAACACTCTGTCACT
GGACTTGGGCATTGCCATCTTTATTTTGAAGTAGTCACCCAACTCTCTCACTCTGCATGG
CTACACTACATGCAGTCTCCCGTGTGACTTTCGTACTGGGAGAGAGAGAAAGCGAGTTCC
TCCAGTACTTTGGATTGGCTTCACAGTAGCCTTTCTTGCCTAGAGGAGCACCACAGGTCA
AAAAACAAACAAACAAACAAACAAAACAAAACAAAACAAAACAAAAAAACTGGAAAAAAA
ACAAATAGGGACCCTCCAAATTTCTCAGGATGGTGTTGAACTCACTCTGCAACCCAGGAG
CCATTGACTTGCAATTCTCCTGCCTCAGCGTCATTAGTAACCGGGATCACAGGCATATAC
CATCAAGTCTATCTTGGAAACTAATCTGACACCCATCACTTTACTTCCCCAGATTCTTTT
TGAAGATCCAGTGTACTTGCTATCCAAGATACCAAAGAGAGTTAAGTCATGGTGTCTCGT
TGAATGATGTAGATACTGCCTTGAGCTTACCAAGCCCAAACAGGTTTCCTATATTCTTTG
TTTAGAAAGCAGTTTTACTGTTCACTGGTAATCAAATTGTATGCATATGGTGATACAAGA
CACATCTATATGGAACAATTTACGTAAAGTGGATTTATTACATGTAGCTGTGCAGCAAAG
CACAAAGGGTTATCTAGGCTGTTATGAGCATATCTGTAACATACCTACCAGGCTATACAA
AGTTGCACAGGACAAGGGAAACGTTCAAGTGTGCCTGCCCTTGATGTCACAGCTTAAGGA
ATCTCAGCTCTGGAAATACAATTCGCAGGTGCTACTTATAGGCAAAGCTGCAAAGGAAAT
CTTAATCCAGGAGAAGGAGGCAATAGCCAAAGTCAGTTATGGTTTTATTTTTCCTTTACT
GGAAACTGTACACTCCTTGGAAGGAAATTGGGAAAGGCCTGAGATATTTCAGGAAGCCTT
CCTAACTCAAAATATGGCGTTTCCAGTCCCTTTAATAGTTGTCAAAAGCTACACACAAGA
AAGGAAGGGGAGGGATAAAGCTGAACCAAAGCTAACACAGAATGGTCCTGTGGTTCCATG
AGTGACAGGAAGCAAGTGTCACATCTTTGTGGCCAGGAACTCTCATTACCTATGTTCTCT
CCTCTCTAACAGAGTGTCATGTGCCTTTGGCTCTTCTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved