Rattus_norvegicus Locus Poly:23:SNORD116
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Poly:23:SNORD116
Rattus_norvegicus
Poly:23:SNORD116
1
SNORD116, SNORD116, SNORD116, SNORD116, SNORD116
1001..1093, 3579..3671, 6281..6373, 8855..8947, 11430..11522
12522
TACATAAGAAGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGT
TCTCATCGAATGCAGAGTAGGACTAATAGGTGTAGAAATTTATGATTATGGAGGGTGCTC
CGATTGTGGCCAAAGCATTTAAGATTCTGGTGGTTTCTATGGGAAGAGTAAGGCCTGATT
TTCTCTGTCATATCCGGCTGAACTGAGATTTACTTATTTTTGTAGACAACTTCCATTAAG
CCATGTTAGTGGTCTCATTCTGTTGTGTACCTCGTGCCAATTTCTTTGGATGGTTCTCAA
GTGATGTACATACTACTGTAGTTATCGGGATCAGATATTGGCTTCGTCCCATCTTAAGAA
CTTTGTTGCATGGTTACCTCCAGGAATTCGGTTATAGAATTGGGAAAATTATGTCCCAAA
CAGTTCCTCGGGAAAAAAATATCTCTTATATGGATTGTGAGGGCAAATTTCTAGAGGACG
GATGGAGTGCTGAGAGAGCCCCTGTGTTCGATAAATTAAGAACTAACAACAATGCATCAC
AGTCTCCATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACTTT
CAGGGACAGTGTCCCGGTCTCATACCGGACAAGGACGGCTTGCAGAGGAACTGAGTATGG
AACATCAGATGAAGTTGGAAGAAGCCTAACATCGCCTGCCCTGATGTCATCAGTTGAAGC
TCTCTTGCCTGAGGATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGGAACT
CATAGTGCTCAGGTGTTGATGGAGCTCGCAGGAGTTCCCAACCTTGAATCATGATCCTTT
TGACCTGGTCCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGG
TTCGTGGTAAAGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATTTTG
AGTATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTTCCA
ATAAAACATTCCTTGGAAAGCTGAAGAAAATGAGTGAAAACTCAATACCGCCAATATCAT
CGTGACTGCGGTCCAGCACCTGGGATCACAAATGTCACTGAGAGACTCAAATAGCCTCCA
TTCATCTTGCGAGACTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTTGCTTGCCTAA
ATCACCAGAAATCATGGCCTAAATCAAGGCTTCACCTTTTGCTCTAATGATAACATGCTT
TCCGGTTGAGGAGATCATTGTCAATATCTTGGAAGTTAGCCCTACCGACTCCATCAGCAA
TAATGTATAGAGGTTGTGAGGCAAATGTAAGTTTAGCGGGGGCGGCATAGTTCAACAATG
TACACTGGAATGTCAGGAAATGTGTTTCTGTCCGTGACTGAAGCCTTCGCATGAATGATA
ACCCTTCTGTTTAATAAAACAGAGATACATAACGGGAAGGTTACAGGCGACACGTGGAAT
GAGGCAGTAGCAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTGTGTGAAAACAAAG
CTCTGTTTTCTTGAAAGACTGATTGTGGCCCTGGCAATTAGGTTGGAAAGAGAGCCTTGG
AATTTAAAAGGTTGGCATGTAGCCTTCTTGTCGGTGGATTCTAGAAGTGCATGCTTTCAA
ATGTCCCAGGATTCATACCACCTTTTTGGATGTATGGAGAACGCCCATTTTAATCCTAGT
TTCTATGTTTATTGTTGGGACATGTTTTGTCAGTCTATCCGTGTAGTTTGCCAGCAGTTC
TTATGGATTGACTGTACCAAAATGGTCTGGACATACATCTCCTCCTCTTCTAGGATCTAA
AAATGTGAGCATGCAAGTTTCTTTCTTACACACACTCCTTCTAGGAATTTTATATTTTGG
TATGGCCGTAGAAGATAGGCATGGAGTGTCTGTGGGATTATCTTTTCTTATGGTTTTGAT
GGGGCCTCGCTGAAGGTTAACTTGGCATTTTGGCTATGTGTTTTGGGGCTGATGGTAGTC
CTGTTATCTTAGACATTGTTCTTTTCTCCAAGCAAATATCAACAAGAAATTGTGTTTCCA
TTTGATTATGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATATATCTC
AGTGACTACAGGTTATGCTTGTGTTTGGTGACCTGAGAGGGTTTGAACAGACACTTTCTG
TGTGGTGATCAATGTCATATCCCACAGCAATAGAACTCACAGGAATTTCGTACCAGTCAA
AACCTGAATAGGAGATATATGAGTATGGGCAGAGAAAGAGAGAAAGAACAAGTGTTGAAG
AGGCTAAGCATGTGTGAGACAGAGGAAGACAGTGAGAGACAATAAGAGAGAAAGGGGGGG
GAGGAGAGATGGGGGTTGAAGTGGAAAAGAGGACACTGTGATATTAAAGCAGATATCTTG
ATTGACAGAAATAAGGAAACCAAATAGAGAGAATGTGAGTGAGAAACTGAGAAGCTAGGA
GAGTCACTGCTAGTCAATTTCAGAGAGAAAGTGATGAAGCGAGATAGAGAAAGAGTACAT
AAGAAGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGTTCTCTT
CGAAGGCAGAGTAGGACTAATAGGTGTAGTATGTTATGATTATGGAGGGTGCTCCGATTG
TGGCCAAAGCATTTAAGATTCTGGTGGTTTCCCTGGGAAGAGTAAGTCCTGATTTTCTCT
GTCATATCCGGCTGAACTGAGATTTACTTATTTTAGTAGACAACTTCCATTAAGCCTTGT
TAGTGGTCTCATTCTGTTGTGTACCTCGTTCCAATTTCTTTGGATGGTTCTCAAGTGATG
TACATACTACTGTAGTTTTCGGGATCAGATATTGGGTTCGTCCCATCTTAAGAACTTTGT
TGCATGGTAACCTCCAGGAATTTCGGTGATAGAATTGGGAAACTTCTGTCCTCACACAGT
TCCTTGGAGGAAAAATATCTCTGATATGGATTGTGAGGGCAAATTTCTAGAGGACGGAAG
GAGTGCTGAGAGAGCCCAAGTGTTTGATAAATTAAGAACTAACAACAATGCATCACAATC
TCCATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACTTTCAGG
GACAGAGTCCCTGTCTCATACCGGACAAGGACGGCTTGCTGAGGAACTGAGTATGGAACA
TCAGATGAAGTTGGAAGAAGCCTAACATCGCCTGCCCTGATGTCATCAGTTGAAGCTCTC
TTGCCTGAGGATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGGAACTCAAA
GTGCTCAGGTGTTGATGGAGCTCGCAAGAGTTCCCAACCTTGAATCATGATCCTTTGGGA
CCTGGTTCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGGTTC
ATGGTAAAGGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATTTTGAG
TATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGAACGATGATGATTTCCAAT
AAAACATTCCTTGGAAAGCTGAGCAAAATGAGTGAAAACTCAATACTGCCACTATCATCG
TGACTGAGGTCCAGCACCTGGGATCACAAATGTCACTGAGGGACTCACATGGCCTCCCTT
CATCTTGCGAGACTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTTGCTTGCCTACAT
CACCAGAAATTATGGCCTAAATCAAGGCTTCACCTTTTGCTCTAATGATAACCTGCTTTC
TGGTTGAGGAGATCATTGTCAGTATCTGGGAAGTTAGCCCTACCAACTCCATCAGCAATA
ATGTATAGTAGGTTGTGAGGCAAATGTAAGTTTAGCGGGGGCAGCATAGTTCAACAATGT
ACACTGGAATGTCAGGAAATGTGTTTCTGTCCGTGTCTGAAGCCTTCGCATGAATGATAA
CCCTTCTGTTTCATAAAACAGAGATACATAACGGGAAGGTTACAGGCGACATGTGGAATG
AGGCAGTAGCAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTGTGTGGAAACAAAGC
TCTGTTTTCTTGAAAGACTGATTGTGGCCATGGCAATTAGGTTGGAAAGAGAGCCTTGGA
ATTTAAAAGGTTGGCATGTAGCCTTCTTGTCGGTGGATTCTAGAAGTGCATGCTTTCAAA
TGTCCCAGGATTCATACCACCTTCATGGATGTATGGAGAACACCCATTTTAATCCTAGTT
TCTATGTTTATTGTTGGGACATTTTTTGTCAGTCTATCCGGGTAGTTTGCCAGCAGTTCT
TATGGATTGACTGTACCAAAATGGTCTTGACATACATCTCCTCCTCTTCTAGGACTAAGA
ATGTGAGCATGCAAGTTTGTTTCTTACACACACACCTTCTAGGAATTTTATATTTTGGTT
TGGCCGTAGAAGATAGGCATGGAGTGTCTGCAGGATTATCTTTCCTTATGGTCTTCATGT
GGCCTTGCTGAAGGTTAACTTGTCATTTTGGCTATGTGTTTTGGGGCTGATGGTAGTCCT
GTTATCTTAGACATTGTTCTTTTCTCCAAGCAAATATCAACAAGAAATTGTGTTTCCATT
TGATTAAGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATATATCTCAG
TGACTACAGGTTATGCTTGTGTTTGGTGACCTGAGAGGGTTTGAACAGACACTTTCTCTG
TGGTGATCAATGTCAGATACCACAGCGATAGCACTCACAGGAATTTAGTACCAGTCAAAA
CCTGTATAGGAGATATATGAGCATGGACAGAGACAGAGAGAAAGTACAATTGTTGAAGAG
GCTAAGATGTGTGAGACAGAGGAAGACAGTTAGAGACAGAAAGAGAGAGAGGGGGGGGAT
AGAGGGGAGGGTGAAGTGGAAAAGAGGACACTGTGATATTAAAGCAGATATCTTGATTGA
CAGAAATAAGGAAACCAAATAGAGAGAATGTGAGTGAGAAACTGAGAAGCTAGGAGAGTC
ACTGCAAGTCAATTTCCGAGAGAAAGTGAAGAAGCGAAATAGAGAAAGAGTACATAAGAA
GTCAATGGTGGGAGGGTTGGGAGGGGAACACCCATAAGGAAGGGGAGGGGGGAGGGGGAT
GTTTGCCCGGAAACCGGGAAAGGGAATAACACTCGAAATGTATATAAGAAATACTCAAGT
TAATAAAAAAAAAAAAGAGAAATAAAAAAAAAAGAAAAAAAAAGAGAAATGAATCGGTTC
TCATCGAAGGCAGAGTAGGACTAATAGGTGTAGTATGTTATAATTATGGAGGGTGCTCCA
ATTGTGGCCAAAGCTATTAAGATTCTGGTGGTTTCCATGGGAAAGTAAGGCCTGATTTTC
TCTGTCATATCTGGATGAACTGAGATTTACTTATTTTTGTAGACAACTTACATTAAGCCA
TGTTAGTGGTCTCATGCTGTTGTGTACCTCGTGCCAATTTCTTTGGATGGTTCTCAAGTG
ATGTACATACTACTGTAGTTTTCGGGATCAGATATTGGATTCGTCCCATCTTAAGAACTT
TGTTGCATGGTAACCTCCTGGAATTCGGTGATAGAATTGGGAAAATTATGTCCCCAAACA
GTTCCTTGGAGGAAAAATATCTCTGATATGGATTGTGAGGGCAAATTTCTAGAAGACGGA
AGGAGTGCTGAGAGAGCCCAAGCGTTCTATAAATTAAGAACTAACAAGAGTGCATCACAG
TCTCCATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCTTTACTTTCA
GGGACAGAGTCCCTGTCTCATACTGGACAAGGACGGCTTGCAGAGGCACTGAGTATGGAA
CATCAGATGAAGTTGGAAGAAGCCTAACTTTGCCTGCCCTGATGTCATCAGTTGAAGCTC
TCTTGCCTGAGGATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGTAACTCA
AAGTGCTCAGGTGTTGATGGAGCTCGCAGGAGTTCCCAACCTTGAATCATGATCTTTTGG
GACCTGGTTCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGGT
TCGTTGTAAAGGATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATTTTG
AGTATACTAAGTGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTTCCA
ATAAAACATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCAATACCGCCACTATCAT
CGTGACTGAGGTCCAGCACCTAGGATCACAAATGTCACTGAGGGACTCACATGGCCTCCC
TTCATCTTGCGAGACTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTAACTTGCCTAA
ATGACCAGAAATCATGGCCTAAATCAAGGCTTCACCTTTTGCTCTAATGATAACATGCTT
TCCGGTTGAGGAGATCCTTGTCACTATCTTGGAAGTTAGCCCTACCAACTCCATCAGCAA
TAATGTATAGTAGGTTGTGAGGCAAATGTAAGTTTAGCGGGGGCAGCAGAGTTCAAATAT
GTACACTGGAATGTGAGGAAATGTGTTTCTGTCCCTGTCTGAAGCCTTCGCATGAATGAT
AACCCTTCTGTTTCATAAAACAGAGATACAGAACGGGAAGGTTACAGGCAACACGTGGAA
TGAGGCAGAAGCAATTCTCAGGAACTTGGGAATGTGGACTCTTCCTGTGTGAAAACAAAG
CTCTGTTTTCTTGAAAGACTGATTGTGGCAATGGCAATTAGGTTGGAAAGAGAGCCTTGG
ATTTTTAAAGTTGGCATGTAGCCTTCTTGTCGGTGGATTCTAGAAGTGCATGCTTTCAAA
TGTCCCAGGATTCGTACCACCTTTATGTATGTATGGAAAACACCCATTTTAATCCTAGTT
TCTATGTTTATTGTTGGGACATTTTTTGTCAGTCTATCCGGGTAGTTTGCTAGCAGACCT
TATGGATAGACTGTACCAAAATGGTCTGGACATACATCTCCTCCTCTTCTAGGATCTAAG
AATGTGAGCATGCAAGTTTGTTCCTTACACACAGTTCTTCTAGGAATTTTATATTTTGGT
ATGGCCGTAGAAGATAGGCATGGTGTGTCTGCGGGATTACCTTTCCTTATGGTCTTGATG
TGGCCTTGGTGAAGGTTAACTTGGCATTTTGGCTATATGTTTTGGGGCGGATGTTAGTCC
TCTTATCTTAGACATTGTTCTTTTCTCCAAGCAAATATCAACAAGAAATTGTTTTTCCAT
TGATTATGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATATATCTCAG
TGACTACAGGTTATGCTTGTGTTTGGTGACCTGAGAGGGTTTGAACAGACACTTTCTCTG
TGGTGATCAATGTCAGATACCACAGCAATAGCACTCACAGGAATTTCGTACCAGTCAAAA
CCTGTATAGGAGATATATGAGCATGGACAGAGAAAGAGAGGAAGAACAATTGTTGAAGAG
GCTAAGCATGTGTGAGACAGAGGAAGACAGTGAGAGACAGTAAGAGAGAGAGGGGGGGGA
GGACAGAGAGGGGGTGAAATGGAAAAGAGGACAATGTGATATTAAAGCAGATATCTTGAT
TGACAGAGATAAGGAAACCAAATAGAGAGAATGTAAGTGAGAAACTGAGAAGCTAGGAGA
GTCACTGCAAGTCAATTTCAGAGAGAAAGTGAAGAAGCGAGAGAGAGAAAGAGTACATAA
GAAGTCCATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGTTCTCATGG
AAGGCAGAGTAGGACTAATAGGTGTAGTATGTTATGATTATGGAGGGTGCTCCGATTGTG
GCCAAAGCTATTAAGATTCTGATGGTTTCCATGGGAAGAGTAAGGCCTGATTTTCTCTGT
CATATCCGGCTGAACTGAGATTTACTTCTTTTTGTAGACAACTTCCATTAAGCCATGTTA
GTGGTCACATTCTGTTGTGTACCTCGTGCCAATTTCTTTGGATGGCTCTCAAGTGATGTA
CATACTGCTGTAGTTTTCGGGATCAGATATTGGCTTCGTCCCATCTTAAGAACTTTGTTG
CATGGTAACCTCCAGGAATTCGGTGATAGAATTGGGAAACTTCTGTCCTCACACAGTTCC
TTGGAGGAAAAATATCTCTGATATGGATTGTGAGGGCAAATTTCTAGAGGACGGAAGGAG
TGCTGAGAGAGCCCAAGTGTTCAATAAATTATGAACTAACCACAATGCATCACAGTCTCC
ATGATTTGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCATTACTTTCAGGGAC
AGAGTCCCTGTCTCATACTGGACAAGGACGGCTTGCAGAGGAACTGAGTATGGAACATCA
GATGAAGTTGGAAGAAGCCTAACGTTGCCTGCCCTGAAGTCATCAGTTGAAGCTCTCTTG
CCTGAGGATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGTAACTCAAAGTG
CTCAGGTGTTGATGGAGCTCGCAGGAGTTCCCAAATTTGAATCATGATCCTTTGGGACCT
GGTTCAGGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGGTTCGTG
GTAAAGATGTGAATGTCTTGAATTCTGTTCACTCACCAAACCTGATCTATTTTGAGTATA
CTAAGTATCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTTCCAATAAAA
CATTCCTTGGAAAGCTGAACAAAATGAGTGAAAACTCAATACCGCCACTATCATCGTGAC
TGAGGTCCAGCACCTAGGATCACAAATGTCACTGAGGGACTCACATGGCCTCCCTTCATC
TTGCGAGACTTGGATCCAGTGAGAGAGCCTTCAGAATGTTCTTTGCTTGCCTAAATCACC
AGAAATCATGGCCTAAATCAAGGCTTCACCTTTTGCTCTAATGATAACATGCTTTCCGGT
TGAGGAGATCATTGTCAGTATCTTGGAAGTTAGCCCTACCAACTCCATCAGCCATAATGT
ATAGTAGGTTGTGAGGCAAATGTAAGTTTAGCGGGGGCAGCATAGTTCAACAATGTACAC
TGGAATGTCAGGAAATGTGTTTCTGTCCGTGTCTGAAGCCTTCGCATGAATGATAACCCT
TCTGTTTCATAAAACAGAGATACAGAACGGGAAGGTTACAGGCAACACGTGGAATGAGGC
AGAAGCAATTCTCAGGAACTTGGGAATGTGGACTCTTCCTGTGTGAAAACAAAGCTCTGT
TTTCTTGAAAGACTGATTGTGGCAATGGCAATTAGGTTGGAAAGAGAGCCTTGGAATTTT
AAAGTTGGCATGTAGCCTTCTTGTCGGTGGATTCTAGAAGTGCATGCTTTCAAATGTCCC
AGGATTCGTACCACCTTTATGTATGTATGGAGAACACCCATTTTAATCCTAGTTTCTATG
TTTATTGTTGGGACATTTTTTGTCAGTCTATCCGGGTAGTTTGCCAGCAGACCTTATGGA
TAGACTGTACCAAAATGGTCTGGACATACATCTCCTCCTCTTCTAGGATCTAAGAATGTG
AGCATGCAAGTTTGTTCCTTACACACAGTTCTTCTAGGAATTTTATATTTTGGTATGGCC
GTAGAAGATAGGCATGGTGTGTCTGCGGGATTACCTTTCCTTATGGTCTTGATGTGGCCT
TGGTGAAGGTTAACTTGGCATTTTGGCTATATGTTTTGGGGCGGATGTTAGTCCTGTTAT
CTTAGACATTGTTCTTTTCTCCAAGCAAATATTAACAAGAAATTGTTTTTCCATTGATTA
TGAAAGTGAGCTGTATGCTTAGGATCATGCTGTTGATAATAACATATATCTCAGTGACTA
CAGGTTATGCTTGTGTTTGGTGACCTGAGAGGGTTTGAACAGACACTTTCTCTGTGGTGA
TCAATGTCAGATACCACAGCAATAGCACTCACAGGAATTTCGTACCAGTCAAAACCTGTA
TAGGAGATATATTAGCATGGACAGAGAAAGAGAGGAAGAACAATTGTTGAAGAGGCTAAG
CATGTGTGAGACAGAGGAAGACAGTGAGAGACAGTAAGAGAGAGAGGGGGGGGAGGACAG
AGGGGGGGTGAAATGGAAAAGAGTACAATGTGATATTAAAGCAGATATCTTGATTGACAG
AGATAAGGAAACCAAATAGAGAGAATGTGAGTGAGAAACTGAGAAGCTAGGAGAGTCACT
GCAAGTCAATTTCAGAGAGAAAGTGAAGAAGCAAGAGAGAGAAAGAGTACATAAGAAGTC
CATTCATCTAATGTGGATGAGAATCTTATATGATATTTGAATCGGTTCTCATCGAAGGCA
GAGTAGGACTAATAGGTGTAGTATGTTATGATTATGGAGGGTGCTCGGATTGTGGCCAAA
GCTATTACGATTCTGATGTTTTCCATGGGAAGAGTAAGGCCTGATTTTCTCTGTCATATC
CGGCTGAACTGAGATTTACTTATTTTTGTAGACAACTTCCATTAAGCCATGTTAGTGGTC
ACATTCTGTTGTGTACCTCGTGCCAATTTCTTTGGATGGCTCTCAAGTGATGTACATACT
ACTGTAGTTTTCGGGATCAGATATTGGCTTCGTCCCATCTTAAGAACTTTGTTGCATGGT
AACCTCCAGGAATTCGGTGATAGAATTGGGAAACTTCTGTCCTCACACAGTTCCTTGGAG
GAAAAATATCTCTGATATGGATTGTGATAGCAAATTTGTAGAGGACGGAAGGAGTGCTGA
GAGAGCCCAAGTGTTCAATAAATTATGAACTAACCACAATGCATCACAGTCTCCATGATT
TGCAAGGAATCCAATAAAGTGGGGGAATGTGCTATTTGCATTACTTTCAGGGACAGAGTC
CCTGTCTCATACTGGACAAGGACGGCTTGCAGAGGAACTGAGTATGGAACATCAGATGAA
GTTGGAAGAAGCATAACGTTGCCTGCCCTGAAGTCATCAGTTGAAGCTCTCTTGCCTGAG
GATACCTGAAGTGAAAGGTAAGAAACACTTGACTTTCCAAAGGAACTCAAAGTGCTCAGG
TGTTGATGGAGCTCGCAGGAGTTCCCAACTTTGAATCATGATCCTTTGGGACCTGGTTCA
GGCTCACTGCCTGTGGCTACTCCTGTGATTGGAGAATAGGCCCATTGGTTCGTGGTAAAG
GATGTGAATGTCTTGAATTCTGTTCGCTCACCAAACCTGATCTATTTTGAGTATACTAAG
TGTCATGGCAGGGGGTACACCAGCGTGCTTGGATCGATGATGATTTCCAATAAAACATTC
CTTGGAAAGCTGAACAAAATGAGTGAATACTCAATACCACCACTATCATCGTGACTGAGG
TCCAGCACCTGGGATCACAAATGTCACTGGGGGACTCACATGGCCTCCATTCATCTTGCG
AGAGTTGGATCCAGTGAGAGATCCTTCAGAATGTTCTTTGCTTGCCTAAATCACCAGAAA
TCATGGCCTAAATCATGGCATCACCTTTTGCTCTAATGATAACATGCTTTCCGGTTGAGG
AGATCATTGTCAGTATCTTGGAAGTTGGCCCTACCAACTCCATCAGCAATAATGTATAGT
AGGTTGTAAGGCAAATGTAAGTTTAGCGGGGGCAGCATAGTTCAACAATGTACACTGGAA
TGTCAGGAAATGTGTATCTGTCCGTGTCTGAAGCCTTCGCATGAATGATAACCCTTCTGT
TTCATAAAACAGAGATACAGAACGTGAAGGTTACAGGCGACATGTGGAATGAGGCAGTAG
CAATTCTCAGGAACTATGGGAATGTGGACTCTTCCTGTGTGAAAACAAAGCTCTGTTTTC
TTGGAAGACTGATTGTGGCCCTGGCAATTAAGTTGGAAAGAGAGCCTTGGAATTTAAAAG
GTTGGCATGTAGCCGTCTTGTCGGTGGATTCTAGAAGTGCATGCTTTCATATGTCCCAGG
ATTCATACCACCTTCATGAATGTATGGAGAACACCCATTTTAATCCTAGTTTCTATTTTA
TTGTTGGGACATTTTTTGTCAGTCTATCGGGGTAGTTTGCCAGCAATTCTTATGGATGAC
TGTAACAAATATGGTCTGGATATACATCTCCTCGTCTTCTAGGATCTAAGAATGTGAGCA
TGCAAGTTTGTTTCTTACACACAGTCCTTCTAGGAATTTTATATTTTGGTTTGGCCGTAG
AAGATAGGCATGGAGTGTCTGTGGGTTTATCTTTCCTTATGGTTTTGATGTGGCCTTGCT
GAAGGTTAACTCGGCATTTTGGCTATGTGTTTTGGGGCTGATGGTAGTCCTGTTATCTTA
GACATTGTTCTTTTCTCCAAGCAAATATCAACAAGAAATTGTG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved