Rattus_norvegicus Locus Mono:88:SNORD50
snOPY snoRNA Orthological Gene Database
Rattus_norvegicus Mono:88:SNORD50
Rattus_norvegicus
Mono:88:SNORD50
8
SNORD50
1001..1072
2072
GGTACCGTTGTGAACTTCCTATCCTAGCGCAGCAGCTAACGATATTTCGGGATTGGAGC
CCAGGCCCCGGTAGACCGAGCAGCCTGCCCAAAGGCCGCATGCGCTCTAGCTCCTCAGTC
CCAGCTTGGGGGTGGGGGTTCTTAACACAGCAGGGTTTGTAAAAACAATCTAGGAGCTTT
GTGCTGTTCGGAAGGTACGGATATATCACCTAAAGAGACACACGATTATATTCACAGGGA
CAATGGCGCCATTGTTCTTCGCGTCTTCAAAGCAGTTTCCAGAGGAAACAAAGGTAAAAG
ACGATGCAGTTTCTAATTTGAGCATACTGTTGGCTTAGAGCAGTAGGGACTGGTGTGTGA
TGCTTAAAATTTGTTTCTTTTCAATATATTAGATGGCGGGGAGCTCAAAGCATCCGAGAG
AATTCGTGAAGGGAGGAAAGTTGCTTAAAACTTGACCATGTTAAAGGTGCGTAGATTTTT
TTCTCAGCATAGGGAATATTTTTCCCTTTGTGAGATAAGAATCGGCTTCCTGCATGCTAG
TATGTTCCAAAATAGTGCTGGCCGACCACTGCAGCGTCTCCTACTCTTGCCTTAGTTGTG
AGACATAATTGTGCAAACAGTGATTACCCGAAGATGATGACCTGAATACAGACACAGCTA
ATGTACATGGAAATAGTGCTGGCCAGTCCCGGCAGCTTCTGCTCTCCTTTTTAATTTGCA
ATGGCTGCAGTGAGTGCATAGTACGAGACATAACTGGTCTGAACAGTGATGAACTGTATC
CCAAAGATGATGTCCTGAATACTGAGACAGGAACACTGTTTAAATGACGTCGTCTTGTCT
CTTTATGCAGTTCTTACTCCTGGCACGTCATGATACTTTCTGCCAGCAGTGAATGCCAGC
CCATTGAGATGCCCGTCCTCTGGGAAGCTCCTGGAGCAGAAATGCATGTGAGCGATGCTC
CTTTTCTTTCCTTTTTCTGCAGAACATAATGTCACCGGTCTGATCTATGATGATCCTATC
CCGAATCTGAATTCCTGTTGAAAAAATATAATTACGGATCTGGCTTCTGAGATGGACCGT
TAAAGTGGATTGTTGTGTTCTGTTTTAAAGTTGGCAGCGATGTGATACCTGTTTTTCTTT
TTTAGGGCCAGTGAGAGGAGACTTCTTGCGAAGGAAAACTGGATGTGGTGATGTTCAGAA
AAAGCAGACACAAGAAGCAAATACAGAGTATTAGTACTGGGATGTTTGAGATGGGGTCTG
CATGGCCCTTGCTGTGTCCCTCTTAAACTGTCTAGTGGATGGGACAGCATCTGGTATGGC
CTGCAGAGTTGAGCCTTGTGTATACCTTTTGAAGGCTCTATGTTAATGTATGACAGAGTG
TTCTATTCTGGGAAGGTTATGGGTGAGCTGAGGATACAACTTTACAGACTAAGCACAATG
AGTGTACAATTACTGTAAAAAAGGCAGTTCAACATTTTTATTGGTTATGAATTGTTTCCT
TATTCATCCAACAGTGATCACTTGGGAGTGCTGCAATAAACATTCAGCTGCAAATATTTA
TTCAGTTGTTCTTGTGTCAGAAGATGAACCAGAGGGCCCTGGTATAATATGTTTCACTTA
CATGGAAATTGAGTTTTCAAAGTTTGCCCACTCAGTGCATACATGTTATTTGTTGTGTCT
TTTCTATGTGAATATTTCCCTTTTGATTTCATTCTTGATTCCTTGGCTAATCAAGAGTAA
CCGAAGAGTAAGGCAGGCAGATAAATCCCTTGAGCCCAGTCAAAGGCTCATTATTAGTTG
ATGAATCTCAGGCCCAGAACAGGGTCAGATGCTGTTCATTATTTCAAAACAATTGGTGCA
CTGAACCTTTAGCCTCAGCAGAGGCAGGTGGGTCTCTCATTTCCAAGACTGGTCTACAGA
GCAAGTTTCAGGACAGCTACACGGAGAAACAAGTGGACAGGGTTTTCTGAGAAGCTTAAA
ACCTGTAGACCTTTTACTCAAGCTGGCAAACCGTAAAAAGCAAGGCAGTGTTGTGAAATG
GCTTTTAAGCATCTTTCTGTACTTAGAGTGTAC
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved